ID: 900945142

View in Genome Browser
Species Human (GRCh38)
Location 1:5826818-5826840
Sequence CGAGGCCCGAGGAAAGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900945133_900945142 20 Left 900945133 1:5826775-5826797 CCAGCTGTGCTTGAGGCTTCACC No data
Right 900945142 1:5826818-5826840 CGAGGCCCGAGGAAAGCGGGAGG No data
900945134_900945142 -1 Left 900945134 1:5826796-5826818 CCGTCAACAGAATGCACCCCTGC No data
Right 900945142 1:5826818-5826840 CGAGGCCCGAGGAAAGCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900945142 Original CRISPR CGAGGCCCGAGGAAAGCGGG AGG Intergenic