ID: 900947060

View in Genome Browser
Species Human (GRCh38)
Location 1:5837004-5837026
Sequence TTTCTGCCCTGGAGCTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900947060_900947068 24 Left 900947060 1:5837004-5837026 CCTTCCCAGCTCCAGGGCAGAAA No data
Right 900947068 1:5837051-5837073 CAATTTGCTTTCTGAACTAGAGG No data
900947060_900947069 27 Left 900947060 1:5837004-5837026 CCTTCCCAGCTCCAGGGCAGAAA No data
Right 900947069 1:5837054-5837076 TTTGCTTTCTGAACTAGAGGTGG No data
900947060_900947070 28 Left 900947060 1:5837004-5837026 CCTTCCCAGCTCCAGGGCAGAAA No data
Right 900947070 1:5837055-5837077 TTGCTTTCTGAACTAGAGGTGGG No data
900947060_900947065 -3 Left 900947060 1:5837004-5837026 CCTTCCCAGCTCCAGGGCAGAAA No data
Right 900947065 1:5837024-5837046 AAAGCCAGCTCAAACCACACGGG No data
900947060_900947064 -4 Left 900947060 1:5837004-5837026 CCTTCCCAGCTCCAGGGCAGAAA No data
Right 900947064 1:5837023-5837045 GAAAGCCAGCTCAAACCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900947060 Original CRISPR TTTCTGCCCTGGAGCTGGGA AGG (reversed) Intergenic