ID: 900947061

View in Genome Browser
Species Human (GRCh38)
Location 1:5837008-5837030
Sequence TGGCTTTCTGCCCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900947061_900947065 -7 Left 900947061 1:5837008-5837030 CCCAGCTCCAGGGCAGAAAGCCA No data
Right 900947065 1:5837024-5837046 AAAGCCAGCTCAAACCACACGGG No data
900947061_900947070 24 Left 900947061 1:5837008-5837030 CCCAGCTCCAGGGCAGAAAGCCA No data
Right 900947070 1:5837055-5837077 TTGCTTTCTGAACTAGAGGTGGG No data
900947061_900947069 23 Left 900947061 1:5837008-5837030 CCCAGCTCCAGGGCAGAAAGCCA No data
Right 900947069 1:5837054-5837076 TTTGCTTTCTGAACTAGAGGTGG No data
900947061_900947068 20 Left 900947061 1:5837008-5837030 CCCAGCTCCAGGGCAGAAAGCCA No data
Right 900947068 1:5837051-5837073 CAATTTGCTTTCTGAACTAGAGG No data
900947061_900947071 27 Left 900947061 1:5837008-5837030 CCCAGCTCCAGGGCAGAAAGCCA No data
Right 900947071 1:5837058-5837080 CTTTCTGAACTAGAGGTGGGCGG No data
900947061_900947064 -8 Left 900947061 1:5837008-5837030 CCCAGCTCCAGGGCAGAAAGCCA No data
Right 900947064 1:5837023-5837045 GAAAGCCAGCTCAAACCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900947061 Original CRISPR TGGCTTTCTGCCCTGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr