ID: 900947062

View in Genome Browser
Species Human (GRCh38)
Location 1:5837009-5837031
Sequence CTGGCTTTCTGCCCTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900947062_900947069 22 Left 900947062 1:5837009-5837031 CCAGCTCCAGGGCAGAAAGCCAG No data
Right 900947069 1:5837054-5837076 TTTGCTTTCTGAACTAGAGGTGG No data
900947062_900947065 -8 Left 900947062 1:5837009-5837031 CCAGCTCCAGGGCAGAAAGCCAG No data
Right 900947065 1:5837024-5837046 AAAGCCAGCTCAAACCACACGGG No data
900947062_900947068 19 Left 900947062 1:5837009-5837031 CCAGCTCCAGGGCAGAAAGCCAG No data
Right 900947068 1:5837051-5837073 CAATTTGCTTTCTGAACTAGAGG No data
900947062_900947064 -9 Left 900947062 1:5837009-5837031 CCAGCTCCAGGGCAGAAAGCCAG No data
Right 900947064 1:5837023-5837045 GAAAGCCAGCTCAAACCACACGG No data
900947062_900947071 26 Left 900947062 1:5837009-5837031 CCAGCTCCAGGGCAGAAAGCCAG No data
Right 900947071 1:5837058-5837080 CTTTCTGAACTAGAGGTGGGCGG No data
900947062_900947070 23 Left 900947062 1:5837009-5837031 CCAGCTCCAGGGCAGAAAGCCAG No data
Right 900947070 1:5837055-5837077 TTGCTTTCTGAACTAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900947062 Original CRISPR CTGGCTTTCTGCCCTGGAGC TGG (reversed) Intergenic