ID: 900947063

View in Genome Browser
Species Human (GRCh38)
Location 1:5837015-5837037
Sequence TTTGAGCTGGCTTTCTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900947063_900947069 16 Left 900947063 1:5837015-5837037 CCAGGGCAGAAAGCCAGCTCAAA No data
Right 900947069 1:5837054-5837076 TTTGCTTTCTGAACTAGAGGTGG No data
900947063_900947070 17 Left 900947063 1:5837015-5837037 CCAGGGCAGAAAGCCAGCTCAAA No data
Right 900947070 1:5837055-5837077 TTGCTTTCTGAACTAGAGGTGGG No data
900947063_900947071 20 Left 900947063 1:5837015-5837037 CCAGGGCAGAAAGCCAGCTCAAA No data
Right 900947071 1:5837058-5837080 CTTTCTGAACTAGAGGTGGGCGG No data
900947063_900947068 13 Left 900947063 1:5837015-5837037 CCAGGGCAGAAAGCCAGCTCAAA No data
Right 900947068 1:5837051-5837073 CAATTTGCTTTCTGAACTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900947063 Original CRISPR TTTGAGCTGGCTTTCTGCCC TGG (reversed) Intergenic
No off target data available for this crispr