ID: 900947064

View in Genome Browser
Species Human (GRCh38)
Location 1:5837023-5837045
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900947060_900947064 -4 Left 900947060 1:5837004-5837026 CCTTCCCAGCTCCAGGGCAGAAA No data
Right 900947064 1:5837023-5837045 GAAAGCCAGCTCAAACCACACGG No data
900947051_900947064 29 Left 900947051 1:5836971-5836993 CCCGGGGCCCGGAAAGCTAAGTC No data
Right 900947064 1:5837023-5837045 GAAAGCCAGCTCAAACCACACGG No data
900947055_900947064 3 Left 900947055 1:5836997-5837019 CCCCACACCTTCCCAGCTCCAGG No data
Right 900947064 1:5837023-5837045 GAAAGCCAGCTCAAACCACACGG No data
900947054_900947064 21 Left 900947054 1:5836979-5837001 CCGGAAAGCTAAGTCTAGCCCCA No data
Right 900947064 1:5837023-5837045 GAAAGCCAGCTCAAACCACACGG No data
900947059_900947064 1 Left 900947059 1:5836999-5837021 CCACACCTTCCCAGCTCCAGGGC No data
Right 900947064 1:5837023-5837045 GAAAGCCAGCTCAAACCACACGG No data
900947052_900947064 28 Left 900947052 1:5836972-5836994 CCGGGGCCCGGAAAGCTAAGTCT No data
Right 900947064 1:5837023-5837045 GAAAGCCAGCTCAAACCACACGG No data
900947061_900947064 -8 Left 900947061 1:5837008-5837030 CCCAGCTCCAGGGCAGAAAGCCA No data
Right 900947064 1:5837023-5837045 GAAAGCCAGCTCAAACCACACGG No data
900947057_900947064 2 Left 900947057 1:5836998-5837020 CCCACACCTTCCCAGCTCCAGGG No data
Right 900947064 1:5837023-5837045 GAAAGCCAGCTCAAACCACACGG No data
900947053_900947064 22 Left 900947053 1:5836978-5837000 CCCGGAAAGCTAAGTCTAGCCCC No data
Right 900947064 1:5837023-5837045 GAAAGCCAGCTCAAACCACACGG No data
900947062_900947064 -9 Left 900947062 1:5837009-5837031 CCAGCTCCAGGGCAGAAAGCCAG No data
Right 900947064 1:5837023-5837045 GAAAGCCAGCTCAAACCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type