ID: 900947066

View in Genome Browser
Species Human (GRCh38)
Location 1:5837028-5837050
Sequence ATTTCCCGTGTGGTTTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900947066_900947071 7 Left 900947066 1:5837028-5837050 CCAGCTCAAACCACACGGGAAAT No data
Right 900947071 1:5837058-5837080 CTTTCTGAACTAGAGGTGGGCGG No data
900947066_900947069 3 Left 900947066 1:5837028-5837050 CCAGCTCAAACCACACGGGAAAT No data
Right 900947069 1:5837054-5837076 TTTGCTTTCTGAACTAGAGGTGG No data
900947066_900947068 0 Left 900947066 1:5837028-5837050 CCAGCTCAAACCACACGGGAAAT No data
Right 900947068 1:5837051-5837073 CAATTTGCTTTCTGAACTAGAGG No data
900947066_900947070 4 Left 900947066 1:5837028-5837050 CCAGCTCAAACCACACGGGAAAT No data
Right 900947070 1:5837055-5837077 TTGCTTTCTGAACTAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900947066 Original CRISPR ATTTCCCGTGTGGTTTGAGC TGG (reversed) Intergenic