ID: 900947068

View in Genome Browser
Species Human (GRCh38)
Location 1:5837051-5837073
Sequence CAATTTGCTTTCTGAACTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900947057_900947068 30 Left 900947057 1:5836998-5837020 CCCACACCTTCCCAGCTCCAGGG No data
Right 900947068 1:5837051-5837073 CAATTTGCTTTCTGAACTAGAGG No data
900947060_900947068 24 Left 900947060 1:5837004-5837026 CCTTCCCAGCTCCAGGGCAGAAA No data
Right 900947068 1:5837051-5837073 CAATTTGCTTTCTGAACTAGAGG No data
900947061_900947068 20 Left 900947061 1:5837008-5837030 CCCAGCTCCAGGGCAGAAAGCCA No data
Right 900947068 1:5837051-5837073 CAATTTGCTTTCTGAACTAGAGG No data
900947067_900947068 -10 Left 900947067 1:5837038-5837060 CCACACGGGAAATCAATTTGCTT No data
Right 900947068 1:5837051-5837073 CAATTTGCTTTCTGAACTAGAGG No data
900947066_900947068 0 Left 900947066 1:5837028-5837050 CCAGCTCAAACCACACGGGAAAT No data
Right 900947068 1:5837051-5837073 CAATTTGCTTTCTGAACTAGAGG No data
900947062_900947068 19 Left 900947062 1:5837009-5837031 CCAGCTCCAGGGCAGAAAGCCAG No data
Right 900947068 1:5837051-5837073 CAATTTGCTTTCTGAACTAGAGG No data
900947063_900947068 13 Left 900947063 1:5837015-5837037 CCAGGGCAGAAAGCCAGCTCAAA No data
Right 900947068 1:5837051-5837073 CAATTTGCTTTCTGAACTAGAGG No data
900947059_900947068 29 Left 900947059 1:5836999-5837021 CCACACCTTCCCAGCTCCAGGGC No data
Right 900947068 1:5837051-5837073 CAATTTGCTTTCTGAACTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900947068 Original CRISPR CAATTTGCTTTCTGAACTAG AGG Intergenic