ID: 900947069

View in Genome Browser
Species Human (GRCh38)
Location 1:5837054-5837076
Sequence TTTGCTTTCTGAACTAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900947062_900947069 22 Left 900947062 1:5837009-5837031 CCAGCTCCAGGGCAGAAAGCCAG No data
Right 900947069 1:5837054-5837076 TTTGCTTTCTGAACTAGAGGTGG No data
900947060_900947069 27 Left 900947060 1:5837004-5837026 CCTTCCCAGCTCCAGGGCAGAAA No data
Right 900947069 1:5837054-5837076 TTTGCTTTCTGAACTAGAGGTGG No data
900947061_900947069 23 Left 900947061 1:5837008-5837030 CCCAGCTCCAGGGCAGAAAGCCA No data
Right 900947069 1:5837054-5837076 TTTGCTTTCTGAACTAGAGGTGG No data
900947067_900947069 -7 Left 900947067 1:5837038-5837060 CCACACGGGAAATCAATTTGCTT No data
Right 900947069 1:5837054-5837076 TTTGCTTTCTGAACTAGAGGTGG No data
900947066_900947069 3 Left 900947066 1:5837028-5837050 CCAGCTCAAACCACACGGGAAAT No data
Right 900947069 1:5837054-5837076 TTTGCTTTCTGAACTAGAGGTGG No data
900947063_900947069 16 Left 900947063 1:5837015-5837037 CCAGGGCAGAAAGCCAGCTCAAA No data
Right 900947069 1:5837054-5837076 TTTGCTTTCTGAACTAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900947069 Original CRISPR TTTGCTTTCTGAACTAGAGG TGG Intergenic