ID: 900947070

View in Genome Browser
Species Human (GRCh38)
Location 1:5837055-5837077
Sequence TTGCTTTCTGAACTAGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900947061_900947070 24 Left 900947061 1:5837008-5837030 CCCAGCTCCAGGGCAGAAAGCCA No data
Right 900947070 1:5837055-5837077 TTGCTTTCTGAACTAGAGGTGGG No data
900947063_900947070 17 Left 900947063 1:5837015-5837037 CCAGGGCAGAAAGCCAGCTCAAA No data
Right 900947070 1:5837055-5837077 TTGCTTTCTGAACTAGAGGTGGG No data
900947060_900947070 28 Left 900947060 1:5837004-5837026 CCTTCCCAGCTCCAGGGCAGAAA No data
Right 900947070 1:5837055-5837077 TTGCTTTCTGAACTAGAGGTGGG No data
900947067_900947070 -6 Left 900947067 1:5837038-5837060 CCACACGGGAAATCAATTTGCTT No data
Right 900947070 1:5837055-5837077 TTGCTTTCTGAACTAGAGGTGGG No data
900947062_900947070 23 Left 900947062 1:5837009-5837031 CCAGCTCCAGGGCAGAAAGCCAG No data
Right 900947070 1:5837055-5837077 TTGCTTTCTGAACTAGAGGTGGG No data
900947066_900947070 4 Left 900947066 1:5837028-5837050 CCAGCTCAAACCACACGGGAAAT No data
Right 900947070 1:5837055-5837077 TTGCTTTCTGAACTAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900947070 Original CRISPR TTGCTTTCTGAACTAGAGGT GGG Intergenic
No off target data available for this crispr