ID: 900947071

View in Genome Browser
Species Human (GRCh38)
Location 1:5837058-5837080
Sequence CTTTCTGAACTAGAGGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900947063_900947071 20 Left 900947063 1:5837015-5837037 CCAGGGCAGAAAGCCAGCTCAAA No data
Right 900947071 1:5837058-5837080 CTTTCTGAACTAGAGGTGGGCGG No data
900947062_900947071 26 Left 900947062 1:5837009-5837031 CCAGCTCCAGGGCAGAAAGCCAG No data
Right 900947071 1:5837058-5837080 CTTTCTGAACTAGAGGTGGGCGG No data
900947061_900947071 27 Left 900947061 1:5837008-5837030 CCCAGCTCCAGGGCAGAAAGCCA No data
Right 900947071 1:5837058-5837080 CTTTCTGAACTAGAGGTGGGCGG No data
900947066_900947071 7 Left 900947066 1:5837028-5837050 CCAGCTCAAACCACACGGGAAAT No data
Right 900947071 1:5837058-5837080 CTTTCTGAACTAGAGGTGGGCGG No data
900947067_900947071 -3 Left 900947067 1:5837038-5837060 CCACACGGGAAATCAATTTGCTT No data
Right 900947071 1:5837058-5837080 CTTTCTGAACTAGAGGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900947071 Original CRISPR CTTTCTGAACTAGAGGTGGG CGG Intergenic
No off target data available for this crispr