ID: 900948313

View in Genome Browser
Species Human (GRCh38)
Location 1:5843703-5843725
Sequence GCCTCGAGGAACAAAGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900948313_900948319 9 Left 900948313 1:5843703-5843725 CCTCTCCCTTTGTTCCTCGAGGC No data
Right 900948319 1:5843735-5843757 GTGCCGTGCGTGGAGCTCCATGG No data
900948313_900948318 -1 Left 900948313 1:5843703-5843725 CCTCTCCCTTTGTTCCTCGAGGC No data
Right 900948318 1:5843725-5843747 CAAAGTGAAGGTGCCGTGCGTGG No data
900948313_900948322 21 Left 900948313 1:5843703-5843725 CCTCTCCCTTTGTTCCTCGAGGC No data
Right 900948322 1:5843747-5843769 GAGCTCCATGGGTTGAGAAGTGG No data
900948313_900948320 10 Left 900948313 1:5843703-5843725 CCTCTCCCTTTGTTCCTCGAGGC No data
Right 900948320 1:5843736-5843758 TGCCGTGCGTGGAGCTCCATGGG No data
900948313_900948323 22 Left 900948313 1:5843703-5843725 CCTCTCCCTTTGTTCCTCGAGGC No data
Right 900948323 1:5843748-5843770 AGCTCCATGGGTTGAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900948313 Original CRISPR GCCTCGAGGAACAAAGGGAG AGG (reversed) Intergenic
No off target data available for this crispr