ID: 900948314

View in Genome Browser
Species Human (GRCh38)
Location 1:5843708-5843730
Sequence ACTTTGCCTCGAGGAACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900948314_900948318 -6 Left 900948314 1:5843708-5843730 CCCTTTGTTCCTCGAGGCAAAGT No data
Right 900948318 1:5843725-5843747 CAAAGTGAAGGTGCCGTGCGTGG No data
900948314_900948320 5 Left 900948314 1:5843708-5843730 CCCTTTGTTCCTCGAGGCAAAGT No data
Right 900948320 1:5843736-5843758 TGCCGTGCGTGGAGCTCCATGGG No data
900948314_900948322 16 Left 900948314 1:5843708-5843730 CCCTTTGTTCCTCGAGGCAAAGT No data
Right 900948322 1:5843747-5843769 GAGCTCCATGGGTTGAGAAGTGG No data
900948314_900948323 17 Left 900948314 1:5843708-5843730 CCCTTTGTTCCTCGAGGCAAAGT No data
Right 900948323 1:5843748-5843770 AGCTCCATGGGTTGAGAAGTGGG No data
900948314_900948319 4 Left 900948314 1:5843708-5843730 CCCTTTGTTCCTCGAGGCAAAGT No data
Right 900948319 1:5843735-5843757 GTGCCGTGCGTGGAGCTCCATGG No data
900948314_900948325 26 Left 900948314 1:5843708-5843730 CCCTTTGTTCCTCGAGGCAAAGT No data
Right 900948325 1:5843757-5843779 GGTTGAGAAGTGGGTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900948314 Original CRISPR ACTTTGCCTCGAGGAACAAA GGG (reversed) Intergenic
No off target data available for this crispr