ID: 900948315

View in Genome Browser
Species Human (GRCh38)
Location 1:5843709-5843731
Sequence CACTTTGCCTCGAGGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900948315_900948322 15 Left 900948315 1:5843709-5843731 CCTTTGTTCCTCGAGGCAAAGTG No data
Right 900948322 1:5843747-5843769 GAGCTCCATGGGTTGAGAAGTGG No data
900948315_900948323 16 Left 900948315 1:5843709-5843731 CCTTTGTTCCTCGAGGCAAAGTG No data
Right 900948323 1:5843748-5843770 AGCTCCATGGGTTGAGAAGTGGG No data
900948315_900948325 25 Left 900948315 1:5843709-5843731 CCTTTGTTCCTCGAGGCAAAGTG No data
Right 900948325 1:5843757-5843779 GGTTGAGAAGTGGGTCTGCCTGG No data
900948315_900948318 -7 Left 900948315 1:5843709-5843731 CCTTTGTTCCTCGAGGCAAAGTG No data
Right 900948318 1:5843725-5843747 CAAAGTGAAGGTGCCGTGCGTGG No data
900948315_900948319 3 Left 900948315 1:5843709-5843731 CCTTTGTTCCTCGAGGCAAAGTG No data
Right 900948319 1:5843735-5843757 GTGCCGTGCGTGGAGCTCCATGG No data
900948315_900948320 4 Left 900948315 1:5843709-5843731 CCTTTGTTCCTCGAGGCAAAGTG No data
Right 900948320 1:5843736-5843758 TGCCGTGCGTGGAGCTCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900948315 Original CRISPR CACTTTGCCTCGAGGAACAA AGG (reversed) Intergenic
No off target data available for this crispr