ID: 900948317

View in Genome Browser
Species Human (GRCh38)
Location 1:5843717-5843739
Sequence GGCACCTTCACTTTGCCTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900948317_900948322 7 Left 900948317 1:5843717-5843739 CCTCGAGGCAAAGTGAAGGTGCC No data
Right 900948322 1:5843747-5843769 GAGCTCCATGGGTTGAGAAGTGG No data
900948317_900948323 8 Left 900948317 1:5843717-5843739 CCTCGAGGCAAAGTGAAGGTGCC No data
Right 900948323 1:5843748-5843770 AGCTCCATGGGTTGAGAAGTGGG No data
900948317_900948319 -5 Left 900948317 1:5843717-5843739 CCTCGAGGCAAAGTGAAGGTGCC No data
Right 900948319 1:5843735-5843757 GTGCCGTGCGTGGAGCTCCATGG No data
900948317_900948326 23 Left 900948317 1:5843717-5843739 CCTCGAGGCAAAGTGAAGGTGCC No data
Right 900948326 1:5843763-5843785 GAAGTGGGTCTGCCTGGCTCAGG No data
900948317_900948320 -4 Left 900948317 1:5843717-5843739 CCTCGAGGCAAAGTGAAGGTGCC No data
Right 900948320 1:5843736-5843758 TGCCGTGCGTGGAGCTCCATGGG No data
900948317_900948325 17 Left 900948317 1:5843717-5843739 CCTCGAGGCAAAGTGAAGGTGCC No data
Right 900948325 1:5843757-5843779 GGTTGAGAAGTGGGTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900948317 Original CRISPR GGCACCTTCACTTTGCCTCG AGG (reversed) Intergenic
No off target data available for this crispr