ID: 900948322

View in Genome Browser
Species Human (GRCh38)
Location 1:5843747-5843769
Sequence GAGCTCCATGGGTTGAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900948313_900948322 21 Left 900948313 1:5843703-5843725 CCTCTCCCTTTGTTCCTCGAGGC No data
Right 900948322 1:5843747-5843769 GAGCTCCATGGGTTGAGAAGTGG No data
900948317_900948322 7 Left 900948317 1:5843717-5843739 CCTCGAGGCAAAGTGAAGGTGCC No data
Right 900948322 1:5843747-5843769 GAGCTCCATGGGTTGAGAAGTGG No data
900948314_900948322 16 Left 900948314 1:5843708-5843730 CCCTTTGTTCCTCGAGGCAAAGT No data
Right 900948322 1:5843747-5843769 GAGCTCCATGGGTTGAGAAGTGG No data
900948315_900948322 15 Left 900948315 1:5843709-5843731 CCTTTGTTCCTCGAGGCAAAGTG No data
Right 900948322 1:5843747-5843769 GAGCTCCATGGGTTGAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900948322 Original CRISPR GAGCTCCATGGGTTGAGAAG TGG Intergenic
No off target data available for this crispr