ID: 900949356

View in Genome Browser
Species Human (GRCh38)
Location 1:5849236-5849258
Sequence AAGCCTCCCCTCACCATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900949350_900949356 -1 Left 900949350 1:5849214-5849236 CCAGGCCAGCATCCCGCCAGGGA No data
Right 900949356 1:5849236-5849258 AAGCCTCCCCTCACCATCCAGGG No data
900949351_900949356 -6 Left 900949351 1:5849219-5849241 CCAGCATCCCGCCAGGGAAGCCT No data
Right 900949356 1:5849236-5849258 AAGCCTCCCCTCACCATCCAGGG No data
900949341_900949356 23 Left 900949341 1:5849190-5849212 CCCCGTGGCACCCACTGTTTCGG No data
Right 900949356 1:5849236-5849258 AAGCCTCCCCTCACCATCCAGGG No data
900949339_900949356 29 Left 900949339 1:5849184-5849206 CCAAACCCCCGTGGCACCCACTG No data
Right 900949356 1:5849236-5849258 AAGCCTCCCCTCACCATCCAGGG No data
900949344_900949356 21 Left 900949344 1:5849192-5849214 CCGTGGCACCCACTGTTTCGGTC No data
Right 900949356 1:5849236-5849258 AAGCCTCCCCTCACCATCCAGGG No data
900949346_900949356 13 Left 900949346 1:5849200-5849222 CCCACTGTTTCGGTCCAGGCCAG No data
Right 900949356 1:5849236-5849258 AAGCCTCCCCTCACCATCCAGGG No data
900949343_900949356 22 Left 900949343 1:5849191-5849213 CCCGTGGCACCCACTGTTTCGGT No data
Right 900949356 1:5849236-5849258 AAGCCTCCCCTCACCATCCAGGG No data
900949347_900949356 12 Left 900949347 1:5849201-5849223 CCACTGTTTCGGTCCAGGCCAGC No data
Right 900949356 1:5849236-5849258 AAGCCTCCCCTCACCATCCAGGG No data
900949340_900949356 24 Left 900949340 1:5849189-5849211 CCCCCGTGGCACCCACTGTTTCG No data
Right 900949356 1:5849236-5849258 AAGCCTCCCCTCACCATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900949356 Original CRISPR AAGCCTCCCCTCACCATCCA GGG Intergenic
No off target data available for this crispr