ID: 900949636

View in Genome Browser
Species Human (GRCh38)
Location 1:5851151-5851173
Sequence TTTGTATTCCACATCTAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900949635_900949636 11 Left 900949635 1:5851117-5851139 CCTCAGAACAGAAACATTCTAAT No data
Right 900949636 1:5851151-5851173 TTTGTATTCCACATCTAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900949636 Original CRISPR TTTGTATTCCACATCTAATT AGG Intergenic
No off target data available for this crispr