ID: 900949664

View in Genome Browser
Species Human (GRCh38)
Location 1:5851271-5851293
Sequence AGCCCACAGAAGTTCCCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900949664_900949668 12 Left 900949664 1:5851271-5851293 CCTACAGGGAACTTCTGTGGGCT No data
Right 900949668 1:5851306-5851328 AGACAGTGAACATTTCTGCTCGG No data
900949664_900949669 20 Left 900949664 1:5851271-5851293 CCTACAGGGAACTTCTGTGGGCT No data
Right 900949669 1:5851314-5851336 AACATTTCTGCTCGGCTTAGAGG No data
900949664_900949670 26 Left 900949664 1:5851271-5851293 CCTACAGGGAACTTCTGTGGGCT No data
Right 900949670 1:5851320-5851342 TCTGCTCGGCTTAGAGGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900949664 Original CRISPR AGCCCACAGAAGTTCCCTGT AGG (reversed) Intergenic
No off target data available for this crispr