ID: 900951912

View in Genome Browser
Species Human (GRCh38)
Location 1:5862981-5863003
Sequence GAGGGTCCCACATGCGTAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 69}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900951912 Original CRISPR GAGGGTCCCACATGCGTAGA TGG Exonic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900951912 1:5862981-5863003 GAGGGTCCCACATGCGTAGATGG + Exonic
901665678 1:10824897-10824919 GAGGGTCCCTGATGCTTAGAGGG - Intergenic
902742943 1:18452588-18452610 CAGGGTCCCAGATGGGTAGAAGG + Intergenic
907402006 1:54230047-54230069 AGGGGTCCCACATGAGCAGAAGG + Intronic
910845985 1:91605212-91605234 GAGGGTTCCACCTTCGTGGATGG + Intergenic
1068464821 10:57376081-57376103 GAGTGTCCACCATGTGTAGAAGG + Intergenic
1074000030 10:109362611-109362633 GAGGGTCCCACATCCTAAGATGG + Intergenic
1074330546 10:112503274-112503296 GTGGTTACCACAGGCGTAGAAGG - Intronic
1075840364 10:125496859-125496881 TAATGTCCTACATGCGTAGAGGG + Intergenic
1076762829 10:132614076-132614098 GTGGGTCCCAAAGGCGTCGAGGG - Intronic
1078541719 11:12218362-12218384 GAGGGTCCCAGATGAGTGGGGGG - Intronic
1085476718 11:76793813-76793835 GAGGGTCCCACATGGGGAGGGGG + Intronic
1091103842 11:132899982-132900004 CAGGGTCCCCCATATGTAGACGG + Intronic
1097544150 12:60977941-60977963 GAGGGTCCCATAAGACTAGAAGG + Intergenic
1109652194 13:65343233-65343255 GAGGGTCCCACATGCATTGAGGG + Intergenic
1116065191 14:39973082-39973104 GAGGGTCCCACAAGCCTGGGTGG + Intergenic
1121066860 14:90975500-90975522 CAGGGGCACACATGCGTAGGGGG + Intronic
1122204663 14:100142581-100142603 AAGGGTCCCACAAGCGCACAGGG + Intronic
1126220987 15:46212793-46212815 GAGGGTCCCACATATGTTAACGG - Intergenic
1128456571 15:67834768-67834790 GAGGGTCCTAAACGCGGAGAGGG - Intergenic
1139476865 16:67207221-67207243 GAGAGTCCCACAGGAGTAGGTGG + Exonic
1143181588 17:4987281-4987303 GAGGGTCCCGCCCGCATAGAGGG + Intronic
1145313149 17:21711428-21711450 GTGGGTCCCACATGTGTCCATGG + Intergenic
1146843495 17:36169732-36169754 GAGGGTCCCACAGGAGTCCACGG - Intronic
1146855803 17:36257670-36257692 GAGGGTCCCACAGGAGTCCACGG - Intronic
1146864817 17:36330705-36330727 GAGGGTCCCACAGGAGTCCACGG + Intronic
1146871710 17:36381581-36381603 GAGGGTCCCACAGGAGTCCACGG - Intronic
1146879069 17:36432663-36432685 GAGGGTCCCACAGGAGTCCACGG - Intronic
1146883009 17:36453809-36453831 GAGGGTCCCACAGGAGTCCACGG - Intergenic
1147067676 17:37931299-37931321 GAGGGTCCCACAGGAGTCCACGG + Intronic
1147074596 17:37982205-37982227 GAGGGTCCCACAGGAGTCCACGG - Intronic
1147079207 17:38010854-38010876 GAGGGTCCCACAGGAGTCCACGG + Intronic
1147086119 17:38061744-38061766 GAGGGTCCCACAGGAGTCCACGG - Intronic
1147095146 17:38134796-38134818 GAGGGTCCCACAGGAGTCCACGG + Intergenic
1147102064 17:38185709-38185731 GAGGGTCCCACAGGAGTCCACGG - Intergenic
1149846656 17:60012220-60012242 GAGGGTCCCACAGGAGTCCACGG - Intergenic
1150085002 17:62268794-62268816 GAGGGTCCCACAGGAGTCCACGG - Intergenic
1151656848 17:75500170-75500192 GAGGGACCCACCCGCGTAGATGG - Intergenic
1152354114 17:79798344-79798366 GAGGGTCTCACGCGCGAAGATGG + Intronic
1152964060 18:98289-98311 GGGGGTCCCACAAGCCTAGGCGG - Intergenic
1157467300 18:47958275-47958297 GAGAGTATCACATGTGTAGAAGG - Intergenic
1160577167 18:79863443-79863465 GAGGGTCCCCCATGCGGACCAGG + Intergenic
1160678619 19:403534-403556 CAGGGTCACACATGCATACACGG + Intergenic
1161041282 19:2111924-2111946 GAGGGTCCCACGTGCCTGGGTGG + Intronic
1162807223 19:13144305-13144327 GAGGGTCCCTCCTGGGTAGCTGG - Exonic
1163685967 19:18711784-18711806 CACGGTCCCACATGTGTATAAGG - Intronic
925081713 2:1074188-1074210 GAGGGTCACACATGCACAGAGGG - Intronic
937346745 2:121130654-121130676 GAGGGTCCCAAATGTGCAGATGG - Intergenic
937845497 2:126574405-126574427 GAGGATCCCACAAGAGTGGAAGG - Intergenic
944902673 2:204231583-204231605 GAAGGACCCACATCCGTGGAGGG + Intergenic
947642033 2:231712280-231712302 GAGAGTCCCACCTGTGTAGTGGG + Intronic
1171119917 20:22559200-22559222 GAGGGTACCACATCCGCACATGG - Intergenic
1172426438 20:34859464-34859486 GAGGTTGCCACCTGCGTAGAAGG + Exonic
1172836205 20:37874838-37874860 GAGGCTGCCACATGCGAAGCAGG - Intergenic
1176343639 21:5720975-5720997 GAGGGTGCCTCATGAGTAAATGG + Intergenic
1176501188 21:7603481-7603503 GAGGGTGCCTCATGAGTAAATGG - Intergenic
1176537960 21:8119044-8119066 GAGGGTGCCTCATGAGTAAATGG + Intergenic
1179784971 21:43724352-43724374 GAGGGTCCCACCTGCTTACTGGG + Intronic
1182105665 22:27687304-27687326 GAGGGTCCCACATGCAGGGACGG - Intergenic
1203242907 22_KI270733v1_random:35399-35421 GAGGGTGCCTCATGAGTAAATGG + Intergenic
955750465 3:62181213-62181235 CAGGGTCCCACATCGGAAGAAGG + Intronic
958637767 3:96766556-96766578 GAGGGTCCCACAAGCCTAGGTGG - Intergenic
961566891 3:127770437-127770459 GAGGGTCCCAGAAACCTAGAGGG - Intronic
971033053 4:22661642-22661664 CAAGCTCCCACATGCGTAAAAGG + Intergenic
980867863 4:138574634-138574656 GAGGGTCCTTCATGAGAAGAGGG - Intergenic
989736607 5:44715249-44715271 GAGGTGCACACATGCGTAGTAGG - Intergenic
992164877 5:74039559-74039581 CAGGCTCCCAGATGAGTAGAGGG - Intergenic
997611666 5:135220012-135220034 GAGGGTCACACAGGCATAGAGGG - Intronic
998821065 5:146058434-146058456 AAGGGTCACACTTGTGTAGATGG + Intronic
1008656549 6:53619761-53619783 GAGGGTGGCACATGCAGAGAGGG - Intergenic
1018103604 6:160463257-160463279 GAGTGTCCCAAATGCGAAGCTGG + Intergenic
1034538813 7:151743060-151743082 GATGATCCCACATGAATAGAGGG + Intronic
1039414190 8:37379492-37379514 GAGCTTCCCACATGCCCAGAAGG + Intergenic
1047803284 8:128332047-128332069 TAGGGTCACACATGGGCAGAGGG + Intergenic
1053032089 9:34789083-34789105 GAGGCTCCCACAGGCCTGGATGG + Intergenic
1057420410 9:94907684-94907706 GAGGCTCCCAGATGCCTGGAAGG - Intronic
1059538098 9:115102434-115102456 GAGGGTTCCAGATGCCTTGAAGG + Intronic
1061887129 9:133596760-133596782 GAGGGTCCCCCATGAGTAGCTGG + Intergenic
1203459233 Un_GL000220v1:18482-18504 GAGGGTGCCTCATGAGTAAATGG + Intergenic
1189272653 X:39761937-39761959 GAGGGTCCCACCTACCTATAGGG - Intergenic
1189287308 X:39860893-39860915 GTGGGTCCTCCATGCGTAGGAGG - Intergenic
1197737471 X:129862369-129862391 CAGGGACACACATGCATAGAGGG + Intergenic