ID: 900953937

View in Genome Browser
Species Human (GRCh38)
Location 1:5875378-5875400
Sequence CACGAGTCTGGCCCCCCGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900953933_900953937 7 Left 900953933 1:5875348-5875370 CCTGCCTATTCCTGAGAGACTCT 0: 1
1: 0
2: 0
3: 7
4: 171
Right 900953937 1:5875378-5875400 CACGAGTCTGGCCCCCCGCACGG 0: 1
1: 0
2: 0
3: 1
4: 60
900953935_900953937 -3 Left 900953935 1:5875358-5875380 CCTGAGAGACTCTTCACAGACAC 0: 1
1: 0
2: 3
3: 14
4: 219
Right 900953937 1:5875378-5875400 CACGAGTCTGGCCCCCCGCACGG 0: 1
1: 0
2: 0
3: 1
4: 60
900953934_900953937 3 Left 900953934 1:5875352-5875374 CCTATTCCTGAGAGACTCTTCAC 0: 1
1: 0
2: 0
3: 12
4: 165
Right 900953937 1:5875378-5875400 CACGAGTCTGGCCCCCCGCACGG 0: 1
1: 0
2: 0
3: 1
4: 60
900953931_900953937 19 Left 900953931 1:5875336-5875358 CCACACAGCATCCCTGCCTATTC 0: 1
1: 0
2: 1
3: 23
4: 237
Right 900953937 1:5875378-5875400 CACGAGTCTGGCCCCCCGCACGG 0: 1
1: 0
2: 0
3: 1
4: 60
900953932_900953937 8 Left 900953932 1:5875347-5875369 CCCTGCCTATTCCTGAGAGACTC 0: 1
1: 0
2: 1
3: 13
4: 149
Right 900953937 1:5875378-5875400 CACGAGTCTGGCCCCCCGCACGG 0: 1
1: 0
2: 0
3: 1
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900953937 Original CRISPR CACGAGTCTGGCCCCCCGCA CGG Intronic
900158703 1:1213458-1213480 GCCGAGTCTGGGCCCCCGGAGGG + Intronic
900553486 1:3268495-3268517 CATGAGCCTCGCCCCTCGCAGGG - Intronic
900953937 1:5875378-5875400 CACGAGTCTGGCCCCCCGCACGG + Intronic
912739583 1:112181782-112181804 AAAGAGTCTGGCCCCCTGGATGG + Intergenic
922724093 1:227914563-227914585 CTCCAGTCTGGCCCTGCGCAGGG + Intergenic
922725354 1:227920537-227920559 CCCGAGCCTGGGCACCCGCACGG + Exonic
1064057022 10:12106434-12106456 CACGAGGCTGGGGCCACGCAGGG - Intronic
1074892690 10:117748682-117748704 CAAGAGTCTGGTCCCTGGCAGGG - Intergenic
1081709044 11:45205335-45205357 CAGGAGACTGGCCCCAGGCAGGG + Intronic
1082159948 11:48880092-48880114 CACGCCTCAGGCCCCCGGCATGG + Intergenic
1086714909 11:90052098-90052120 CAGGAGGCTGGCCTTCCGCAGGG + Intergenic
1091919980 12:4296278-4296300 CTCTATTCTGGCCCCCGGCAAGG - Intronic
1096233740 12:49912133-49912155 CACCATTCTGGTCCCCTGCAGGG - Intergenic
1101593026 12:106139599-106139621 CCCGAGGCTGGCACCCCGCGGGG + Exonic
1103418003 12:120757550-120757572 CACCATTCTGGCCCACAGCATGG + Intergenic
1108269920 13:48749317-48749339 CACGAGTCTGCACACCCGCTAGG - Intergenic
1110001116 13:70202298-70202320 CAAGAGCCTGGCACCCAGCATGG + Intergenic
1119080130 14:71685072-71685094 CAGTAGTCTGGCCACCCCCAGGG + Intronic
1121532925 14:94671174-94671196 GACGTGCCTGGCCCCCCTCATGG + Intergenic
1122906247 14:104802886-104802908 CATGAGCCTGGCCCCACGCTAGG + Exonic
1125599648 15:40908192-40908214 CACTGGTCTGGCCCCCCGGAAGG + Intergenic
1129138243 15:73573597-73573619 CACGTGTCTGGACCTCTGCAGGG + Intronic
1129599044 15:76987507-76987529 CAAGATTCTGGCCAGCCGCAAGG - Intergenic
1129841276 15:78744625-78744647 CACGGTCCTGGCCCCCTGCAGGG - Intergenic
1134845557 16:17436990-17437012 CACAGGTCTGGCCCCCAGGAAGG - Intronic
1141817940 16:86425578-86425600 CAGGAGTCTGGGTCCCCGGATGG - Intergenic
1142024147 16:87803477-87803499 CACGTGTCTGGCCCCTCACTGGG - Intergenic
1143044303 17:4064438-4064460 CACCAGTCTGGCCTCCTCCATGG + Exonic
1144956138 17:19019791-19019813 CGCGTGTCTGGCTCTCCGCACGG - Exonic
1145264970 17:21375511-21375533 CACCAGTCTGACCCCCAGCTCGG - Intergenic
1156915470 18:42461415-42461437 TGGGAGTCTGGCCCCCAGCATGG + Intergenic
1161048407 19:2149580-2149602 CACAAGTCTGGGCCCCTTCAAGG - Intronic
1161288546 19:3480669-3480691 CCAGAGTCTGGCCTCCCGGAGGG - Intergenic
1161514483 19:4689099-4689121 GACGAGTCTGTCCCCCAGCCAGG + Intronic
1162028322 19:7906409-7906431 CCCCAGGCTGGCCCCCTGCAGGG - Intronic
1162567407 19:11451834-11451856 CTGGAGCCTGGCCCCCCCCAGGG + Exonic
1162831076 19:13285046-13285068 CGTGAGTATGGCCCCCAGCAAGG - Exonic
925032665 2:662871-662893 CACGACTCTGGCCCCACGTCGGG + Intergenic
925180035 2:1811575-1811597 CACGAGCCAGGACCCCCTCAGGG - Intronic
931172567 2:59819435-59819457 CAGGAGTCTATCACCCCGCAGGG - Intergenic
1173162294 20:40662065-40662087 CAGGAGGCTGGCCTCCTGCAGGG - Intergenic
1176952503 21:15064437-15064459 CCCGAGTCCGGCCCCGCTCAGGG + Intronic
1181052745 22:20245515-20245537 CACCAGTCTGGCCCCTGGGATGG - Intronic
1184019859 22:41813659-41813681 CAGGAGTCTGGGTCCCAGCATGG + Intronic
954333597 3:49903669-49903691 CTCGAGTCGGGCCCCCAGCCAGG - Intronic
968505809 4:970998-971020 CACGAGTGTGGCACCCAGCCTGG - Exonic
987489267 5:18555938-18555960 CACTGGTCTGGCCCCCCTCGAGG - Intergenic
1005883214 6:30075441-30075463 CGCGTGTCTGGCCCGCCGCTGGG - Exonic
1006844033 6:37050423-37050445 CACTAGCCTGGCCCCCGGCCTGG - Intergenic
1016658098 6:146543819-146543841 TCCGAGTCTGGCCCCCTGCCCGG - Exonic
1022083021 7:27042805-27042827 CACTTGTCAGGCCCCTCGCAGGG + Intergenic
1034992991 7:155559840-155559862 CACATGCCTGGCCCCGCGCAGGG - Intergenic
1035575390 8:701273-701295 CACGGGTCTGCCCCGCCGGACGG + Intronic
1038437361 8:27545458-27545480 CACGGGTCTTGCCGCCCACATGG + Exonic
1048333465 8:133486512-133486534 AACGGGTCTGGCTCCCCTCACGG - Intronic
1058286589 9:103187135-103187157 CCCGAGCCCTGCCCCCCGCAGGG - Intergenic
1059325889 9:113503794-113503816 CAGGAGCCTGGCCCCCTCCATGG - Intronic
1061471181 9:130827121-130827143 CAGGAGCCTGACCCCCAGCATGG + Intronic
1185467113 X:361729-361751 TACGTGTGTGGTCCCCCGCAGGG - Intronic
1186472765 X:9834227-9834249 CAGGACTGTGGCCCCCAGCATGG + Intronic
1199603389 X:149556950-149556972 CACAAGTCTGACACCCAGCAGGG - Intergenic
1199646998 X:149922525-149922547 CACAAGTCTGACACCCAGCAGGG + Intergenic