ID: 900954241

View in Genome Browser
Species Human (GRCh38)
Location 1:5876872-5876894
Sequence CAGGGGTGACGCCCAAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900954230_900954241 23 Left 900954230 1:5876826-5876848 CCCAGGCTCCAGGGGTCCTGCCC 0: 1
1: 0
2: 6
3: 124
4: 1735
Right 900954241 1:5876872-5876894 CAGGGGTGACGCCCAAGAACTGG 0: 1
1: 0
2: 0
3: 7
4: 105
900954232_900954241 15 Left 900954232 1:5876834-5876856 CCAGGGGTCCTGCCCACACCAAT 0: 1
1: 0
2: 0
3: 28
4: 210
Right 900954241 1:5876872-5876894 CAGGGGTGACGCCCAAGAACTGG 0: 1
1: 0
2: 0
3: 7
4: 105
900954235_900954241 2 Left 900954235 1:5876847-5876869 CCACACCAATCAGTATCAGAATC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 900954241 1:5876872-5876894 CAGGGGTGACGCCCAAGAACTGG 0: 1
1: 0
2: 0
3: 7
4: 105
900954231_900954241 22 Left 900954231 1:5876827-5876849 CCAGGCTCCAGGGGTCCTGCCCA 0: 1
1: 1
2: 2
3: 48
4: 672
Right 900954241 1:5876872-5876894 CAGGGGTGACGCCCAAGAACTGG 0: 1
1: 0
2: 0
3: 7
4: 105
900954234_900954241 3 Left 900954234 1:5876846-5876868 CCCACACCAATCAGTATCAGAAT 0: 1
1: 0
2: 0
3: 17
4: 161
Right 900954241 1:5876872-5876894 CAGGGGTGACGCCCAAGAACTGG 0: 1
1: 0
2: 0
3: 7
4: 105
900954236_900954241 -3 Left 900954236 1:5876852-5876874 CCAATCAGTATCAGAATCTCCAG 0: 1
1: 0
2: 1
3: 15
4: 150
Right 900954241 1:5876872-5876894 CAGGGGTGACGCCCAAGAACTGG 0: 1
1: 0
2: 0
3: 7
4: 105
900954233_900954241 7 Left 900954233 1:5876842-5876864 CCTGCCCACACCAATCAGTATCA 0: 1
1: 0
2: 1
3: 8
4: 179
Right 900954241 1:5876872-5876894 CAGGGGTGACGCCCAAGAACTGG 0: 1
1: 0
2: 0
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900954241 Original CRISPR CAGGGGTGACGCCCAAGAAC TGG Intronic