ID: 900954248

View in Genome Browser
Species Human (GRCh38)
Location 1:5876938-5876960
Sequence TCGGACTTTTTCAGCCACCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900954248_900954253 6 Left 900954248 1:5876938-5876960 CCCCGGTGGCTGAAAAAGTCCGA 0: 1
1: 0
2: 0
3: 2
4: 37
Right 900954253 1:5876967-5876989 TATATTCTGTCCCCAGGATTTGG 0: 1
1: 0
2: 0
3: 10
4: 153
900954248_900954252 0 Left 900954248 1:5876938-5876960 CCCCGGTGGCTGAAAAAGTCCGA 0: 1
1: 0
2: 0
3: 2
4: 37
Right 900954252 1:5876961-5876983 TTTTCTTATATTCTGTCCCCAGG 0: 1
1: 0
2: 1
3: 30
4: 356
900954248_900954255 10 Left 900954248 1:5876938-5876960 CCCCGGTGGCTGAAAAAGTCCGA 0: 1
1: 0
2: 0
3: 2
4: 37
Right 900954255 1:5876971-5876993 TTCTGTCCCCAGGATTTGGGAGG 0: 1
1: 0
2: 1
3: 26
4: 228
900954248_900954254 7 Left 900954248 1:5876938-5876960 CCCCGGTGGCTGAAAAAGTCCGA 0: 1
1: 0
2: 0
3: 2
4: 37
Right 900954254 1:5876968-5876990 ATATTCTGTCCCCAGGATTTGGG 0: 1
1: 0
2: 0
3: 20
4: 199
900954248_900954256 14 Left 900954248 1:5876938-5876960 CCCCGGTGGCTGAAAAAGTCCGA 0: 1
1: 0
2: 0
3: 2
4: 37
Right 900954256 1:5876975-5876997 GTCCCCAGGATTTGGGAGGAAGG 0: 1
1: 0
2: 4
3: 35
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900954248 Original CRISPR TCGGACTTTTTCAGCCACCG GGG (reversed) Intronic
900954248 1:5876938-5876960 TCGGACTTTTTCAGCCACCGGGG - Intronic
909520709 1:76564921-76564943 TTGAACTTTTTCTGCCACCTAGG - Intronic
916197890 1:162241869-162241891 TCTTACTTTTTCAGCAACCCTGG + Intronic
1106247657 13:27962882-27962904 TCTGGCTTTTTCTGCCACTGAGG - Exonic
1119052510 14:71383966-71383988 TGGGGCTTTTTCAGTCACCCAGG + Intronic
1131536997 15:93245783-93245805 TCGGTATTTTGCAGCCACCTGGG + Intergenic
1133051520 16:3119873-3119895 TCGGACTTGGTCACCCACCAGGG + Exonic
1133449053 16:5888137-5888159 TGTGACTTTCTCAGCCACTGTGG + Intergenic
1151164390 17:72191591-72191613 TCTGACATTGTCAGCCAACGAGG + Intergenic
1152516546 17:80828182-80828204 TCAGACTCGTTCAGACACCGGGG - Intronic
1152703633 17:81832185-81832207 TGTGTCTTTTTCAGCCAACGAGG + Intronic
1158244059 18:55410816-55410838 TCGGACATTTTCATCCATCATGG - Intronic
1160871119 19:1278481-1278503 TCTGACTTTTTGAGCCCCCAGGG + Intronic
1162441676 19:10696131-10696153 TAGGGCTTTCTCAGCCAACGTGG - Intergenic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1165403953 19:35618759-35618781 TTGGACTTTTTCAGCCTCTGTGG + Intronic
939879263 2:147611583-147611605 TGGGAATTTTTCAGCCATTGTGG - Intergenic
945213024 2:207403318-207403340 TCTGACTGTGTCAGCCTCCGGGG + Intergenic
948590459 2:239046566-239046588 TCTGACTTTTTCAGAGACAGAGG + Intergenic
950365011 3:12476826-12476848 CCAGAGTTTTTCAGCCACCCAGG + Intergenic
951972665 3:28464620-28464642 TCTAACTCTTTCAGCCACAGAGG + Intronic
952051953 3:29394817-29394839 TCAGACTGCTTCAGCCACAGTGG + Intronic
953137790 3:40198241-40198263 TGGGACTTTTTAAGCATCCGAGG - Intronic
955323230 3:57989889-57989911 TTGCTCTTTTTCAGCCACTGAGG + Intergenic
965548190 3:169936757-169936779 TAGGAGTTTCTCAGCCACGGTGG - Intronic
982088540 4:151860978-151861000 GCGGCCTTTATCAGCCACCTGGG + Intergenic
993457836 5:88145309-88145331 TGGGACTTTTCCGCCCACCGCGG - Intergenic
995203316 5:109450584-109450606 TCGTACCTATTCTGCCACCGGGG - Intergenic
995533775 5:113115654-113115676 ACGGAACTTTTCTGCCACCGAGG - Intronic
996378749 5:122843306-122843328 TCTGAGTCTTCCAGCCACCGAGG - Intergenic
997365806 5:133324564-133324586 TGTGACTTTTTCATCCACTGTGG + Intronic
1000340821 5:160275873-160275895 TTGGACTTTTTGAGACACCTTGG - Intronic
1006860728 6:37170192-37170214 TCGGGCCTCCTCAGCCACCGCGG - Exonic
1011865170 6:91816430-91816452 TCGTACAATTTCAGCCACCCAGG - Intergenic
1012574464 6:100775121-100775143 AGGGACTTTTTCAGCCACTAGGG + Intronic
1015312505 6:131781095-131781117 CTGGACGTTTTCAGCCACCACGG + Intergenic
1037024348 8:14014638-14014660 TTGGACATTTTCAGCCATCTGGG - Intergenic
1049566972 8:143345345-143345367 TCAGACCTTTTCAGCCACCAGGG - Intronic
1062584553 9:137243290-137243312 GCGGACATTTTTAGCCCCCGAGG - Exonic
1188346768 X:29076994-29077016 TTGGACTATTACAGCCACCTTGG - Intronic