ID: 900955006

View in Genome Browser
Species Human (GRCh38)
Location 1:5881295-5881317
Sequence CCGTCCAACCCAGGTTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900955001_900955006 0 Left 900955001 1:5881272-5881294 CCTGTGGAGGTGAGCCATATCCT 0: 1
1: 0
2: 0
3: 2
4: 89
Right 900955006 1:5881295-5881317 CCGTCCAACCCAGGTTCTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 112
900954998_900955006 14 Left 900954998 1:5881258-5881280 CCCACGTGCAGGCACCTGTGGAG 0: 1
1: 0
2: 0
3: 9
4: 92
Right 900955006 1:5881295-5881317 CCGTCCAACCCAGGTTCTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 112
900954999_900955006 13 Left 900954999 1:5881259-5881281 CCACGTGCAGGCACCTGTGGAGG 0: 1
1: 0
2: 0
3: 26
4: 153
Right 900955006 1:5881295-5881317 CCGTCCAACCCAGGTTCTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900955006 Original CRISPR CCGTCCAACCCAGGTTCTCC TGG Intronic
900495113 1:2972672-2972694 CCGTCCCACACAGGAGCTCCAGG + Intergenic
900778335 1:4600927-4600949 ACATCCAACCCAGGTCCTGCTGG + Intergenic
900955006 1:5881295-5881317 CCGTCCAACCCAGGTTCTCCTGG + Intronic
901071222 1:6519728-6519750 CCGTCCAACACAGGTCCCCTGGG + Intronic
903120997 1:21217165-21217187 CTGTCCACCCTAGCTTCTCCAGG - Intergenic
903349370 1:22709148-22709170 CCCTCAAACCCTGGGTCTCCTGG + Intergenic
906196943 1:43935526-43935548 CCTGCCACCCCAGTTTCTCCAGG - Intronic
906667243 1:47630636-47630658 CCCTCCCACACAGGTTTTCCTGG + Intergenic
910237123 1:85048038-85048060 CCTTCCAGCCCAGGGGCTCCGGG + Intronic
1063124855 10:3128890-3128912 CCAGCCACCCCAGGTCCTCCTGG - Intronic
1065864234 10:29899744-29899766 CCTTCCACCTCAGCTTCTCCAGG - Intergenic
1065879945 10:30029415-30029437 CCGTGCAACTCAGGCTCTCGGGG + Exonic
1066100167 10:32110452-32110474 CCGTCCCTCCCACCTTCTCCTGG - Intergenic
1074497532 10:113992926-113992948 TCATCCAACCCTGGTTATCCCGG - Intergenic
1074681092 10:115908521-115908543 TGGTCCCACCCAGGTTGTCCAGG + Intronic
1076804390 10:132847775-132847797 CCTCTCAACCCAGGTTCTTCAGG - Intronic
1077116126 11:885415-885437 CTGTCCACCCCAGGCTGTCCCGG + Intronic
1081661048 11:44888630-44888652 GCTTCCAACCTAGGTACTCCTGG - Intronic
1084595998 11:70117468-70117490 CCTTCCCACCCAGGCTCCCCAGG + Intronic
1090122979 11:124052936-124052958 TCTTCAAACCCAGATTCTCCAGG + Intergenic
1091900877 12:4142924-4142946 CCACCCCACCCAGGTCCTCCAGG - Intergenic
1092233122 12:6788869-6788891 CCCTCCAAACCTGCTTCTCCAGG - Intronic
1100915056 12:99411037-99411059 TCCTCCAACCCAGGTGCCCCTGG - Intronic
1103201761 12:119093602-119093624 CCTTCCAGCCCAGGGTCCCCTGG - Intronic
1104464300 12:128978241-128978263 CCTTCCAGCCCAGGTGCTGCAGG - Intronic
1113453470 13:110430407-110430429 CCGACCAATCCAGGCTCTCCAGG - Exonic
1113607772 13:111622498-111622520 CTGTGCCTCCCAGGTTCTCCCGG + Intronic
1121238693 14:92412381-92412403 CCCTAAAACCCTGGTTCTCCTGG - Intronic
1126737961 15:51751239-51751261 CCGCCCGCCCCAGGTTTTCCTGG - Intronic
1129196700 15:73972835-73972857 CCGTCTCCCCCAGTTTCTCCTGG + Intergenic
1130085625 15:80776800-80776822 CCGTCTACTCCAGGTTTTCCTGG + Intergenic
1131177334 15:90218275-90218297 TGGTTCAACCCAGGTTCTCCTGG + Intronic
1132219608 15:100095563-100095585 CCTCCCAACACAAGTTCTCCTGG + Intronic
1132349672 15:101132105-101132127 CGCTCCAACCCACGGTCTCCAGG - Intergenic
1137555072 16:49465223-49465245 CCCCGCAACCCAGGGTCTCCGGG - Intergenic
1138507263 16:57484594-57484616 CCGTACCACTCTGGTTCTCCTGG + Intronic
1139557036 16:67719028-67719050 CCCTCCAACCCCGGCTCTGCGGG + Intronic
1141569902 16:84928162-84928184 CCGTCAAACCCAGCTCCACCAGG + Intergenic
1141603282 16:85138986-85139008 CCGGCCTCCCCAGGCTCTCCTGG - Intergenic
1142423924 16:89990679-89990701 CCGTCCTACCCATGTGCTCCAGG - Intergenic
1143552059 17:7636402-7636424 CCCTCCACCCCACCTTCTCCAGG + Intergenic
1143570536 17:7755270-7755292 CTGTCCCACCTGGGTTCTCCAGG - Intronic
1145043262 17:19592571-19592593 CTGGGCCACCCAGGTTCTCCTGG + Intergenic
1145103583 17:20096833-20096855 CCTCCCAACCCAGGGTATCCAGG - Intronic
1147874943 17:43614415-43614437 GCCTCCATCCCAGGCTCTCCAGG + Intergenic
1150295330 17:64004395-64004417 CAGACCTGCCCAGGTTCTCCAGG + Intronic
1154338954 18:13487804-13487826 CACTCCAAGGCAGGTTCTCCAGG - Intronic
1155920745 18:31600568-31600590 GTGTCTAACTCAGGTTCTCCTGG - Intergenic
1158872942 18:61706578-61706600 GTCTCCAACCCAGTTTCTCCTGG + Intergenic
1159915614 18:74185002-74185024 CCACCCCACCCAGGTTCTCATGG - Intergenic
1161958284 19:7508127-7508149 CTGTCCACCCCAGGATCTCCAGG - Intronic
1162315517 19:9936216-9936238 CCTCCCAACCCCGTTTCTCCGGG + Intronic
1163699211 19:18778791-18778813 CAGTTCCACCCAGGTTCTCAGGG - Exonic
1165859555 19:38900123-38900145 GCGCCCAACCCAGGTCCTCCGGG - Exonic
1166076047 19:40414466-40414488 AGGTCCAACCCCTGTTCTCCTGG + Intergenic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
925885912 2:8393619-8393641 CCATCCAACCCAATTTCTTCAGG - Intergenic
926316092 2:11711192-11711214 CCATCCAACCCAAATTCTTCAGG - Intronic
934216731 2:90038019-90038041 CCATCCACCCCAGGATCTCAGGG - Intergenic
935958527 2:108401395-108401417 CCCTCCAGCCCTGCTTCTCCGGG + Intergenic
938243678 2:129761652-129761674 TCTTCCTTCCCAGGTTCTCCAGG - Intergenic
940773913 2:157867098-157867120 CATTCCAACCCAGGTGCTCTTGG + Intronic
944114354 2:196171337-196171359 CCGGCCGCCGCAGGTTCTCCCGG + Exonic
946306966 2:218861539-218861561 CCTCACAACCCAGCTTCTCCTGG + Intronic
947170294 2:227304087-227304109 CCCTGCATCCCTGGTTCTCCAGG - Exonic
948430177 2:237913716-237913738 CCCCCCAACCCAGGTTGGCCCGG - Intergenic
948431653 2:237922813-237922835 CCCTCCTGCCCAAGTTCTCCCGG + Intergenic
948788836 2:240366625-240366647 AAGGCCAACCCAGGCTCTCCAGG - Intergenic
1169092649 20:2871096-2871118 CCCTCCTTCCCAGGGTCTCCAGG + Intronic
1170973745 20:21141226-21141248 CCGTCAAATCCCTGTTCTCCAGG - Intronic
1171439269 20:25147857-25147879 CCGTCCAGCCCTGGTCCCCCAGG - Intergenic
1175801466 20:61803316-61803338 CTGTCCAACCCAATTTCCCCGGG + Intronic
1175812139 20:61864162-61864184 CCGTCCAACTTGGGTGCTCCTGG - Intronic
1176992383 21:15513190-15513212 CAGTCCAAGCCAGATTTTCCTGG - Intergenic
1178117274 21:29430233-29430255 CAGGCCCACCCAGGTTGTCCAGG + Intronic
1179909263 21:44439271-44439293 CGGTCCCACCCAGCTTCACCAGG + Intronic
1179921653 21:44510690-44510712 CCCTGCAGCCCAGGCTCTCCGGG - Intronic
1180638679 22:17280903-17280925 CTGTCCAAGCCTGGTTCTCCAGG - Intergenic
1183824740 22:40377130-40377152 GCATCCAATCCAGGTTCTTCTGG + Intronic
1185258450 22:49849147-49849169 CCGTCCCACCGAGGTCCCCCGGG + Intergenic
950132410 3:10556229-10556251 ACGGAAAACCCAGGTTCTCCAGG + Intronic
954417330 3:50399717-50399739 GCATCAAACCCAGGTTCGCCTGG + Intronic
954445752 3:50545983-50546005 CCACCCCACCCAGGTGCTCCTGG + Intergenic
956235336 3:67063656-67063678 CCTTCCAACTCAGGTCCTCATGG + Intergenic
960052968 3:113254994-113255016 CCCTCCACCCCAGGTTGTCCTGG + Intronic
960459102 3:117911428-117911450 CCTTCCAACACTGGGTCTCCTGG + Intergenic
963106361 3:141650900-141650922 TCATCCGACCCAGATTCTCCAGG + Intergenic
966493399 3:180553034-180553056 TAGTGCAACCCAGGTTCACCGGG + Intergenic
966638186 3:182158630-182158652 CAGTCCTTCCCAGGGTCTCCAGG - Intergenic
976478351 4:85510625-85510647 CTGTCCTTCCCAGGTTCTCCAGG + Intronic
992527681 5:77628455-77628477 CGGGCCAACCCAGGTTTCCCAGG - Intergenic
997376882 5:133403744-133403766 CCTTCCAACTCTGCTTCTCCAGG - Intronic
1003886115 6:10522963-10522985 CTTTCCAAGCCAGGGTCTCCGGG - Intronic
1004251755 6:14028669-14028691 CGGTCCAAGCCTGGTACTCCTGG - Intergenic
1007615933 6:43179799-43179821 CCCTCCAACCCAGGAGCCCCTGG - Exonic
1007655059 6:43446748-43446770 CCGTCCCTCCCAGCTTCTCCAGG + Intronic
1010889874 6:81293481-81293503 CCGCCCAACCCCAGTTCTCTAGG + Intergenic
1014640944 6:123909602-123909624 CCACCCAACCCAGCTTCTCTTGG + Intronic
1019352058 7:558991-559013 CCGTCCCAGCCAGGTTCCCATGG + Intronic
1021963058 7:25891784-25891806 CCCTCCAACCCATGTTCTCTGGG + Intergenic
1027129525 7:75581198-75581220 CCGTCTAACCCAGGCTCTCATGG - Intronic
1029409500 7:100399653-100399675 CCTTCCACCCCACCTTCTCCAGG - Intronic
1029446304 7:100614805-100614827 CTGCCCAGCCCAGGTCCTCCAGG - Intronic
1029741750 7:102495064-102495086 CCGTTCCACGCAGGTGCTCCGGG - Exonic
1029759741 7:102594233-102594255 CCGTTCCACGCAGGTGCTCCGGG - Exonic
1029777104 7:102690143-102690165 CCGTTCCACGCAGGTGCTCCAGG - Intergenic
1033479654 7:141727212-141727234 AACTCCAACCCAGCTTCTCCTGG - Intronic
1035153140 7:156892423-156892445 CGGGCCCACCCAGGCTCTCCGGG + Intronic
1035213893 7:157350190-157350212 CAGTCCAACACAGATACTCCAGG - Intronic
1037411648 8:18604764-18604786 CCTTGCATCCCAGCTTCTCCAGG + Intronic
1038404334 8:27310644-27310666 CTCTCCGACCCAGGTTCTCAGGG - Intronic
1039957965 8:42221803-42221825 CCATCCAACCCGGATCCTCCAGG + Intergenic
1042862490 8:73328363-73328385 CCGGCCAGCCCAGCTTATCCAGG + Intergenic
1048382057 8:133874048-133874070 CCCCCCAACCCAAGCTCTCCAGG - Intergenic
1049583691 8:143423572-143423594 CCGTCCCATCCACGCTCTCCGGG + Intronic
1049660341 8:143817050-143817072 CCCTCCAACGCTGGGTCTCCTGG - Exonic
1051482310 9:17574134-17574156 GTGTCCAAGCCCGGTTCTCCAGG - Intergenic
1055558636 9:77500927-77500949 CCATACAACCCAGCTACTCCTGG - Intronic
1060039977 9:120291914-120291936 CAGGCCCTCCCAGGTTCTCCTGG + Intergenic
1061149411 9:128820421-128820443 CAGCCCCACCCAGGGTCTCCTGG - Exonic
1061810032 9:133156942-133156964 CGGTCCCACCCAGGTTGTCTAGG - Intronic
1186299521 X:8184389-8184411 CCATACAGCCCAGGTTCTCCTGG - Intergenic
1195938564 X:110147744-110147766 CCATCCACCCCAGCTTCTCAAGG + Intronic
1200476997 Y:3650062-3650084 CCCTCCAACCCTGCTCCTCCTGG - Intergenic