ID: 900955405

View in Genome Browser
Species Human (GRCh38)
Location 1:5883592-5883614
Sequence CCCACAGTGAATGGAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 1, 2: 0, 3: 19, 4: 303}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900955405_900955411 3 Left 900955405 1:5883592-5883614 CCAGCACCTCCATTCACTGTGGG 0: 1
1: 1
2: 0
3: 19
4: 303
Right 900955411 1:5883618-5883640 CAGTGGGTTCATCCTCCACCCGG 0: 1
1: 0
2: 3
3: 16
4: 173
900955405_900955417 22 Left 900955405 1:5883592-5883614 CCAGCACCTCCATTCACTGTGGG 0: 1
1: 1
2: 0
3: 19
4: 303
Right 900955417 1:5883637-5883659 CCGGCACCTCCCTTCACTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 142
900955405_900955415 21 Left 900955405 1:5883592-5883614 CCAGCACCTCCATTCACTGTGGG 0: 1
1: 1
2: 0
3: 19
4: 303
Right 900955415 1:5883636-5883658 CCCGGCACCTCCCTTCACTGTGG 0: 1
1: 0
2: 2
3: 12
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900955405 Original CRISPR CCCACAGTGAATGGAGGTGC TGG (reversed) Intronic
900478731 1:2888200-2888222 CCCACAGTGAGGGGAGCTGAGGG + Intergenic
900608572 1:3534875-3534897 CCCAAGGGGAATGGAGGGGCTGG - Intronic
900955405 1:5883592-5883614 CCCACAGTGAATGGAGGTGCTGG - Intronic
900955416 1:5883637-5883659 CCCACAGTGAAGGGAGGTGCCGG - Intronic
902467798 1:16628862-16628884 CTTAGAGTGGATGGAGGTGCTGG + Intergenic
902744275 1:18463127-18463149 CCGAGGGTCAATGGAGGTGCAGG - Intergenic
903657267 1:24956994-24957016 CCCACAGGGACTGCATGTGCTGG + Intronic
903767122 1:25742017-25742039 CCCACAGTGCAGGGAGGTAGTGG + Intronic
903820353 1:26097481-26097503 CCCACAGTGAATGTAACTGGAGG + Intergenic
905203706 1:36330681-36330703 CCCATGGTGAATGGAGGAGATGG - Intergenic
905322117 1:37125479-37125501 CAGCCAGTGAATGGAGATGCTGG + Intergenic
906444554 1:45884030-45884052 TCCTCAATGAATGGAGTTGCTGG + Intronic
906564557 1:46789510-46789532 CCCACAGTTTGTGGAGGGGCTGG + Intronic
907047700 1:51309713-51309735 TACACAGTGAATAGAGCTGCTGG - Intronic
907275219 1:53313260-53313282 CCCTCAGTGAATGTTGGAGCTGG + Intronic
907440451 1:54475200-54475222 CCGACTGTGAATGGAGGGGTTGG + Intergenic
907873724 1:58466128-58466150 CCCCCAGCCAATGGAGGAGCGGG + Intronic
908662908 1:66456200-66456222 CCCCCAGTGATTGAAGGTGAGGG - Intergenic
910676686 1:89822033-89822055 CCTCCAGTAACTGGAGGTGCTGG - Intronic
912645859 1:111391149-111391171 CCGCCAGAGAATGGAGGAGCAGG - Intergenic
915625716 1:157112958-157112980 GCCAAAGTGAATGGCAGTGCGGG + Intergenic
915973997 1:160372993-160373015 GCCACAGGGAAAAGAGGTGCAGG + Intergenic
917539289 1:175897763-175897785 CCCAGAGTGGATGGAGGACCGGG + Intergenic
919923825 1:202181950-202181972 CCCACAAGGCAGGGAGGTGCAGG - Intergenic
920387558 1:205579676-205579698 CACCCAGTGAATGGAGGAGAAGG + Intronic
1063138327 10:3236154-3236176 CCCACAGTGAAGGGACGGGGAGG - Intergenic
1063659981 10:8028419-8028441 CCACCAGTAAATGGAGGTCCTGG - Intergenic
1066526409 10:36284033-36284055 CCCACAGGGCATGCAGGGGCGGG + Intergenic
1067688000 10:48479327-48479349 CCCACAGAGAATGGAGATGAGGG + Intronic
1067812214 10:49438758-49438780 CCTACATAGAATGGAGGTACAGG + Intergenic
1069295218 10:66835615-66835637 CCCACAGTGGGTGGTGGTGGGGG - Intronic
1069838911 10:71327088-71327110 CCCACAGCTAATTGAGTTGCAGG - Intronic
1069941926 10:71962532-71962554 CCCATAGTGAATGGAGGGTGGGG + Intergenic
1071384312 10:85104235-85104257 CCCACAGAGGATGGAGCAGCAGG - Intergenic
1072133419 10:92519439-92519461 CCAGCAGTGAATGGAGGAGCAGG + Intronic
1072155877 10:92723213-92723235 CCCACTGTGAAGGGAGGAGAAGG + Intergenic
1073071215 10:100794396-100794418 GCCACAGAGAATGGTGGTGGTGG + Intronic
1075552330 10:123401504-123401526 CCCTCCCTGAATGGAAGTGCAGG + Intergenic
1076033622 10:127180180-127180202 CCCACAGTGTATCTGGGTGCTGG + Intronic
1076088204 10:127654480-127654502 CACACTCTGCATGGAGGTGCTGG + Intergenic
1076193393 10:128498494-128498516 TGCACCGTGAATGGAAGTGCAGG + Intergenic
1076245662 10:128945519-128945541 GGCACAGTGCCTGGAGGTGCGGG + Intergenic
1076458764 10:130623828-130623850 CCCACAGTGAAAAGAGGAGGAGG - Intergenic
1076494265 10:130886611-130886633 CCCCCAGTGAAGGGAAGTGAAGG - Intergenic
1076555846 10:131320986-131321008 CCCACAGGCAAGGGAGCTGCAGG + Intergenic
1078406867 11:11077739-11077761 CCCACTGTGCTTGGATGTGCTGG + Intergenic
1081455715 11:43220484-43220506 CCCCCATTGAATGTAGGTTCTGG + Intergenic
1084173459 11:67411377-67411399 CCCACAGTGAAAGGCAGAGCCGG + Intronic
1084793933 11:71491713-71491735 CCCACGGTGAACGGAGTGGCCGG + Intronic
1089742043 11:120591207-120591229 CCCACAGTCAAGGGAGGAGATGG + Intronic
1090188548 11:124753507-124753529 CCCACAGTAAAGAGAGGTGGGGG + Exonic
1091209405 11:133843666-133843688 CCCCCAGTGAACACAGGTGCAGG + Intronic
1092020377 12:5197473-5197495 CACACAGCAAATGGGGGTGCTGG - Intergenic
1092868690 12:12786902-12786924 CCCGCAGGGAATGGAGAGGCCGG + Exonic
1094469587 12:30791380-30791402 CCCTCACTGAATGGATCTGCTGG - Intergenic
1095407684 12:41885783-41885805 GCCACAGTGATTGATGGTGCAGG - Intergenic
1097098834 12:56571739-56571761 CCCACTGTCAATGGATGAGCAGG + Exonic
1097264357 12:57737282-57737304 TCCAGAGTGATTGGAGGTGCAGG + Exonic
1098085854 12:66842420-66842442 ACAACAGTGAGTGGAGATGCTGG - Intergenic
1100420139 12:94424521-94424543 CCCACTGTCAATGGATGAGCAGG - Intronic
1100927668 12:99567939-99567961 CTCACAGTGGAAGGTGGTGCTGG - Intronic
1101580254 12:106036511-106036533 CCCACAGTAAATGGCAGAGCTGG + Intergenic
1102096358 12:110244534-110244556 CCCACAGTGTGTGGAGCTGCTGG + Intergenic
1102229426 12:111252335-111252357 CCCAAGGTGAATGGGGATGCAGG + Intronic
1103966878 12:124645759-124645781 CCTAGAGAGAGTGGAGGTGCTGG - Intergenic
1104513986 12:129406784-129406806 CTCAGAGTGAGTGGAGGCGCAGG - Intronic
1104550109 12:129748903-129748925 TCCTCAGTGTTTGGAGGTGCAGG - Intronic
1107624965 13:42272453-42272475 CCCAGAGTAGAGGGAGGTGCTGG + Intronic
1107643695 13:42472215-42472237 CCCACAGTGATTGGTGGATCTGG + Intergenic
1110239217 13:73248179-73248201 CACATAGTAAATGGAGGAGCTGG + Intergenic
1110935900 13:81288298-81288320 CCCACAATGCATGGATGTTCGGG + Intergenic
1117304709 14:54461950-54461972 CCAACAGTGAATCAAGGTGGGGG + Intergenic
1118314772 14:64719344-64719366 CCCACCGAGAATGGTGGTGGTGG - Intronic
1118891696 14:69915319-69915341 TCCACAGTGACAGGAGGTTCAGG - Intronic
1120462308 14:84812841-84812863 CCCACAGAGCATGGAGATGTTGG + Intergenic
1121584652 14:95054917-95054939 CCCACAGGGTGTGGAGGTGGAGG - Intergenic
1121787140 14:96670612-96670634 CTCACAGTGGGTGGAGGAGCAGG - Intergenic
1122247885 14:100417133-100417155 CCCATAGAGAAGGGAGGGGCAGG - Intronic
1122506419 14:102234596-102234618 CCCATAGTGAATGGAAGGGAGGG - Intronic
1123988410 15:25665346-25665368 CTCACAGAGCATGGAGGAGCAGG + Intergenic
1125714678 15:41812810-41812832 CCCAAAGAGCAAGGAGGTGCTGG + Intronic
1126679092 15:51186862-51186884 CACCCAGGGAATGGAGGTGGGGG - Intergenic
1128868631 15:71135779-71135801 CCCATAATGCATGGAGGTGGGGG - Intronic
1130070339 15:80641704-80641726 CCAACAATGAATGGATGTGCCGG + Intergenic
1132898088 16:2238298-2238320 CCCACAGGGATGGGAGGGGCCGG - Intronic
1135324729 16:21519197-21519219 GTTACAGTGAATGGAGGTTCGGG - Intergenic
1135675931 16:24414892-24414914 CCCCCACTGAATGGATCTGCTGG - Intergenic
1135992267 16:27225260-27225282 GACACAGTGAATGGAGGGGCTGG + Intronic
1136269319 16:29139203-29139225 CCCACAGGGAATTGAGGAGTGGG + Intergenic
1137538427 16:49345001-49345023 TTCACAGTGAATGGAGGATCTGG - Intergenic
1138396057 16:56705586-56705608 CCCACACTGGATGGATGTGTAGG - Intronic
1139209867 16:65066754-65066776 CTCACAGGGACTGGAGGAGCAGG - Intronic
1141619963 16:85232049-85232071 CCCACAGTGAGAGGCGGTGCTGG + Intergenic
1141671582 16:85494876-85494898 CCCACACAGAAAGGAGGTGCCGG + Intergenic
1142072800 16:88100475-88100497 CCCACAGGGAATTGAGGAGTGGG + Intronic
1142232436 16:88906125-88906147 CCCACACTGCTTGGGGGTGCAGG - Intronic
1142373749 16:89696573-89696595 CCCACAGGGAATGGAGGGGAGGG + Exonic
1143457981 17:7080036-7080058 CCCACAGGTAATGGTGCTGCCGG - Exonic
1144709139 17:17388814-17388836 CACACAGTGAGTGGTGGGGCTGG - Intergenic
1146343459 17:32041545-32041567 CCCAGTGTGGATGGAGGGGCGGG - Intronic
1147498015 17:40936488-40936510 CCCACCGTCCATGGCGGTGCGGG - Exonic
1148195778 17:45711516-45711538 CCAACAGGGCATGGAGGTGGTGG - Intergenic
1148678177 17:49457170-49457192 CCCACAGAGACTGGATGTGGAGG - Intronic
1148913498 17:50955775-50955797 GCCACAGTGTCTGGATGTGCTGG + Intergenic
1150487495 17:65554069-65554091 CCTTCAGGGAAAGGAGGTGCCGG + Intronic
1150782480 17:68134466-68134488 CCCAGTGTGGATGGAGGGGCAGG + Intergenic
1150815921 17:68391850-68391872 CCCACAGTCCATGGAGCTGGTGG - Intronic
1151530604 17:74702341-74702363 TCCTCAGTGAAGGGTGGTGCTGG - Intronic
1151548455 17:74807544-74807566 CCCACTGGGAAAGGAGGGGCTGG - Intronic
1154026202 18:10709578-10709600 CCAACAGTGTATGGCTGTGCAGG - Intronic
1156257389 18:35410842-35410864 CGCCCAGTGAATGGAGGAGTTGG + Intergenic
1158721447 18:59928735-59928757 CCAGCACTTAATGGAGGTGCTGG - Intergenic
1160404328 18:78634761-78634783 CCCATAGTGCGTGGAGGTGCTGG + Intergenic
1160953037 19:1676613-1676635 GTCACAGTGGATGGAGGGGCTGG - Intergenic
1162060908 19:8094632-8094654 CACACAGTGATTGCAGGTGTTGG - Intronic
1162552909 19:11367797-11367819 CCCACAGTGATAGGAGGTGGGGG - Intergenic
1162801908 19:13115980-13116002 TCCAGAGTGAGTGGAGGTCCAGG - Exonic
1163021250 19:14482068-14482090 CCCACAGTCTGTAGAGGTGCAGG + Intronic
1163251299 19:16127825-16127847 CTCACAGGGCATGGAGTTGCTGG - Intronic
1163425428 19:17238305-17238327 CCCACAGGGAATGGACATTCTGG + Intronic
1163702216 19:18791545-18791567 CACACAGTGAATGAAAGTGGGGG - Intergenic
1163856347 19:19705301-19705323 CCTACTGTGAATGGTGATGCAGG + Intergenic
1166097347 19:40549182-40549204 CCCACAGTCCATGGAGTCGCAGG + Exonic
1168484101 19:56746454-56746476 CACAAAGTGAATGGAGAAGCTGG + Intergenic
1168690400 19:58373263-58373285 CCCACAGTGGGGGGAGGTGATGG - Intronic
1168713503 19:58514512-58514534 CCCAACGTGAAGGGAGGTCCTGG - Intronic
927081807 2:19637768-19637790 CCCAGTGTGAAGGGAGGGGCTGG - Intergenic
928659285 2:33484564-33484586 CCCAGTCTGAATGGTGGTGCTGG + Intronic
929358084 2:41050624-41050646 CCCACACAGCATGGAGGTCCTGG - Intergenic
931225155 2:60323049-60323071 TTCTCAGTGAATGGGGGTGCTGG - Intergenic
932852568 2:75200755-75200777 CCCGCAGTGAAAGGAGGGGGCGG - Intergenic
935024315 2:99261624-99261646 CCCACAGACAGTGGAGGAGCAGG + Intronic
937078024 2:119121226-119121248 CCCACAGTGCATGGAGGCTGAGG + Intergenic
937268898 2:120634604-120634626 CTCTCAGAGAATGGAGGTTCAGG + Intergenic
940047281 2:149423114-149423136 CCCACAGGGCAAGGAGGTACAGG + Intronic
942905397 2:181174201-181174223 CTCACACTGAAGGGAGGGGCAGG - Intergenic
944988078 2:205202059-205202081 CCTGCCGTGGATGGAGGTGCTGG - Intronic
946070495 2:217030564-217030586 CACACAATGAATGAAGGTGGGGG + Intergenic
946115988 2:217462723-217462745 CCCAATGTAAATGGAGGTGCTGG + Intronic
946292209 2:218753930-218753952 GCAAGAGTGAATGGGGGTGCGGG - Intronic
947010072 2:225555854-225555876 CCCAAAGTGAATGGAACTGAAGG - Intronic
948864893 2:240770239-240770261 CCCTCAGTGAATGGCTGTGCAGG - Intronic
1170871265 20:20208822-20208844 GACACAGTGGATGGATGTGCTGG - Intronic
1172163680 20:32885836-32885858 CCCACAGGGAATGGACATCCAGG - Intronic
1173510491 20:43624361-43624383 CCCTCAGTAAATGGAGATGGTGG + Intronic
1173995927 20:47338656-47338678 CCCATAGTGAGTGGCGGTGGTGG - Intronic
1174090903 20:48046551-48046573 CCCACAGCTACTGGTGGTGCTGG - Intergenic
1174819411 20:53713821-53713843 TCCACAGTAGTTGGAGGTGCTGG - Intergenic
1175767157 20:61599498-61599520 CCCACTGTGGCTGGAGGTGTGGG + Intronic
1178901715 21:36604313-36604335 CCCACAGTAACTGGAGGTCCAGG - Intergenic
1179680429 21:43016940-43016962 CCCTCAGGGAATTGTGGTGCCGG + Exonic
1180181783 21:46121378-46121400 GCCACAGGGAAAGGAGGAGCTGG + Intronic
1182521430 22:30886802-30886824 CTCACAGGGAATGGAGGTGGGGG + Intronic
1182917849 22:34051795-34051817 GCCACAGTGAATGGAGTTTGGGG + Intergenic
1183414944 22:37676592-37676614 GTCACACTGAATGGAGGGGCCGG - Intronic
1184617577 22:45648500-45648522 GCCACAGTGAGCGGAGGTGAAGG - Intergenic
1184619940 22:45669590-45669612 CCCACAGGGGCTGGAGGTGATGG + Intergenic
1184959863 22:47921196-47921218 CCCACAGTGCATGTAGCTGAGGG + Intergenic
1185139106 22:49090368-49090390 CCCACACTGGATGCAGGAGCTGG - Intergenic
949584428 3:5424027-5424049 CCAGCAGTGAAAGCAGGTGCTGG - Intergenic
950115636 3:10448904-10448926 CCCACAGTGGATGGATTTGGGGG - Intronic
961333776 3:126158156-126158178 CCCACAGTTATTGGAGAAGCTGG - Intronic
961819890 3:129570688-129570710 CGCTCAGTGAATTCAGGTGCTGG + Intronic
962409388 3:135128139-135128161 CCCTCAGTGAATGCAGTGGCAGG - Intronic
963059413 3:141212752-141212774 CAGACAGTGAAGGCAGGTGCTGG + Intergenic
964450537 3:156808484-156808506 CACAAAGTTAATGGAGGAGCTGG - Intergenic
966645790 3:182245205-182245227 CCCACAGTTCCTGGAAGTGCTGG - Intergenic
967364613 3:188671783-188671805 CCCACCCTCAGTGGAGGTGCAGG + Intronic
968693707 4:2009658-2009680 CCCACAGTGCAGGGAGGCCCCGG + Exonic
968946402 4:3666849-3666871 CCCACAGGGAAAGGAGGTCATGG + Intergenic
973542349 4:51946936-51946958 CCAAGAGTCAATGGAAGTGCAGG - Intergenic
975450732 4:74522982-74523004 CCCACACTGAGTGTAGGTGATGG - Intergenic
976472464 4:85445665-85445687 GCCACAGTGAATGTATATGCTGG - Intergenic
979061106 4:116061536-116061558 CTCATAGTGATTGGAAGTGCAGG - Intergenic
983918388 4:173316506-173316528 CCCAGAGTGAATGGAGGCAGGGG + Intronic
985123419 4:186666866-186666888 GCCACAGTGAATGGCAGAGCTGG + Intronic
985584214 5:720069-720091 CCCACAGATAATGGGGGAGCAGG + Intronic
985597716 5:804399-804421 CCCACAGATAATGGGGGAGCAGG + Intronic
988728755 5:33949314-33949336 CCCAGAGTGGGTTGAGGTGCAGG + Intronic
989631961 5:43494534-43494556 CCGACAGTGAATGGACTTCCCGG + Exonic
992093825 5:73342217-73342239 TGAACAGTGAATGGAGGTACTGG + Intergenic
993026856 5:82656926-82656948 CCCACAGTGACTGGAGGGTGTGG + Intergenic
994155062 5:96494081-96494103 CCCTCATTGAATGGAGGTAAAGG + Intergenic
996792370 5:127306621-127306643 GCCACAGTGAATGGATGGGATGG - Intronic
998289076 5:140895714-140895736 AGCCCATTGAATGGAGGTGCAGG - Intronic
998507991 5:142687302-142687324 CCCACAGAGCATGGGGGTGTGGG + Intronic
999188297 5:149729185-149729207 CCCACAATGCATGAAGGGGCTGG - Intergenic
1001206237 5:169765894-169765916 CCCACAGTATCTGGAGATGCTGG + Intronic
1002168401 5:177362004-177362026 CCCACAGCGGAGTGAGGTGCAGG - Intronic
1002955684 6:1861188-1861210 CCCTCAGTGAATGAAGGAGCAGG + Intronic
1002970025 6:2006094-2006116 CACTGAGTGAATGGAGGTGAGGG - Intronic
1005146676 6:22699451-22699473 CTCCCAGTGAATGCAGATGCAGG + Intergenic
1005899589 6:30206053-30206075 CCCACAGGGAATGGAGCTCTAGG - Intronic
1006598593 6:35211467-35211489 GACACTGTGAATTGAGGTGCTGG - Intergenic
1007833977 6:44660165-44660187 ACCACAGCAAATGGAGGTGGAGG - Intergenic
1016373296 6:143395972-143395994 CCACCAGTAAATGGAGGAGCTGG + Intergenic
1020559353 7:9710561-9710583 CCCACTGTAAATGTAGGTACTGG - Intergenic
1023723372 7:43117714-43117736 CCCACAGTGTTTGGATGTGTGGG + Intronic
1024381538 7:48702603-48702625 CCCACAGTGGGTGGGGGTGGGGG + Intergenic
1024703423 7:51929414-51929436 CCCACAGTGAATGATGCAGCTGG + Intergenic
1026562212 7:71459673-71459695 CCCACAATGAATGGCTTTGCAGG - Intronic
1029540743 7:101180567-101180589 CGGACAGAGAACGGAGGTGCTGG - Intergenic
1030598283 7:111564385-111564407 CCCAAATTGAATGGAGCTCCTGG + Intergenic
1031808650 7:126338586-126338608 CCAACAAAGAATGCAGGTGCTGG + Intergenic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1034846757 7:154453292-154453314 GTCATAGTGAATGGAGGTTCTGG + Intronic
1035274330 7:157738306-157738328 CCCAGAGGGGAGGGAGGTGCTGG + Intronic
1037907974 8:22726673-22726695 CCAACAGTGAGTGGTGGTGCTGG + Intronic
1040896299 8:52372541-52372563 CTTACCGTGAATGGAGGTGCAGG - Intronic
1041443413 8:57924107-57924129 AAAACAGTGAATGGAGGTACTGG - Intergenic
1046963822 8:120140493-120140515 CCCTCAGGGCATGGAGTTGCTGG + Intronic
1048291968 8:133187993-133188015 CCCCCAGTAAATGGAAGAGCTGG + Intergenic
1048400940 8:134069908-134069930 GCCACAGTGAATGGTGATGAGGG - Intergenic
1049372242 8:142273432-142273454 CCCTCAGCGACTAGAGGTGCTGG + Intronic
1049510022 8:143022632-143022654 CCCACAGCGGAAGGAGGTGTTGG + Intronic
1052043233 9:23765195-23765217 GCCACACTGCATGGACGTGCTGG - Intronic
1053141328 9:35684675-35684697 CCCACAGGGGAGGGAGGTGAGGG - Intronic
1054804728 9:69386926-69386948 CCCACAGTGAAGGCAGGTCTTGG - Intronic
1055900325 9:81227056-81227078 CCCTCAGTGCATGGAAGTGAGGG - Intergenic
1056977332 9:91270350-91270372 CCCAAAGAGAAAGGAGGTGGAGG + Intronic
1057148200 9:92772757-92772779 CCCACACAGCATGGAGCTGCAGG - Intergenic
1060839453 9:126782235-126782257 CACACAGTGAATGCAGGTGAGGG - Intergenic
1060872893 9:127056939-127056961 GCCACAGAGTAGGGAGGTGCAGG + Intronic
1062585970 9:137250224-137250246 GCCACCGTGAATGGTGCTGCTGG - Intergenic
1185489742 X:512008-512030 CCCACAGGGAAAGGGGTTGCAGG - Intergenic
1185489755 X:512052-512074 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185489768 X:512096-512118 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185489780 X:512140-512162 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185489792 X:512184-512206 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185489804 X:512228-512250 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185489817 X:512272-512294 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185489830 X:512316-512338 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185489843 X:512360-512382 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185489856 X:512404-512426 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185489868 X:512448-512470 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185489880 X:512492-512514 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185489893 X:512536-512558 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185489906 X:512580-512602 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185489919 X:512624-512646 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185489931 X:512668-512690 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185489943 X:512712-512734 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185489955 X:512756-512778 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185489968 X:512800-512822 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185489980 X:512844-512866 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185489992 X:512888-512910 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490004 X:512932-512954 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490016 X:512976-512998 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490028 X:513020-513042 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490041 X:513064-513086 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490053 X:513108-513130 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490065 X:513152-513174 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490078 X:513196-513218 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490090 X:513240-513262 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490102 X:513284-513306 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490114 X:513328-513350 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490126 X:513372-513394 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490139 X:513416-513438 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490152 X:513460-513482 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490164 X:513504-513526 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490177 X:513548-513570 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490190 X:513592-513614 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490203 X:513636-513658 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490215 X:513680-513702 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490227 X:513724-513746 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490240 X:513768-513790 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490253 X:513812-513834 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490265 X:513856-513878 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490277 X:513900-513922 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490289 X:513944-513966 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490301 X:513988-514010 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490314 X:514032-514054 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490326 X:514076-514098 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490338 X:514120-514142 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490350 X:514164-514186 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490362 X:514208-514230 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490375 X:514252-514274 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490387 X:514296-514318 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490399 X:514340-514362 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490411 X:514384-514406 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490424 X:514428-514450 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490436 X:514472-514494 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490461 X:514560-514582 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490473 X:514604-514626 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490485 X:514648-514670 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490497 X:514692-514714 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490509 X:514736-514758 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490521 X:514780-514802 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490534 X:514824-514846 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490546 X:514868-514890 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490558 X:514912-514934 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490570 X:514956-514978 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490582 X:515000-515022 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490595 X:515044-515066 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490607 X:515088-515110 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490619 X:515132-515154 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490632 X:515176-515198 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490644 X:515220-515242 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490656 X:515264-515286 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490669 X:515308-515330 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490682 X:515352-515374 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490694 X:515396-515418 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490706 X:515440-515462 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490719 X:515484-515506 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490731 X:515528-515550 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490743 X:515572-515594 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490755 X:515616-515638 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490767 X:515660-515682 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490780 X:515704-515726 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490792 X:515748-515770 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490804 X:515792-515814 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490817 X:515836-515858 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490829 X:515880-515902 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490841 X:515924-515946 CCCACAGGGAAAGGGGCTGCAGG - Intergenic
1185490853 X:515968-515990 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185490866 X:516012-516034 CCCACAGGGAAAGGGGATGCAGG - Intergenic
1185642279 X:1595038-1595060 GCCACAGGGAATGGTGGAGCCGG + Intronic
1191778426 X:64843374-64843396 CCCATAGTGAATGGAGGATGGGG - Intergenic
1192152931 X:68723333-68723355 GGCACAGTGCTTGGAGGTGCAGG - Intronic
1198351815 X:135812587-135812609 GCTACTGTGAATGGTGGTGCAGG - Intronic
1198355631 X:135847105-135847127 GCTACTGTGAATGGTGGTGCAGG - Intronic
1198357542 X:135864384-135864406 GCTACTGTGAATGGTGGTGCAGG - Intergenic
1198359452 X:135881671-135881693 GCTACTGTGAATGGTGGTGCAGG - Intronic
1199091884 X:143702346-143702368 CCAAGATAGAATGGAGGTGCTGG - Intergenic
1201901289 Y:19047651-19047673 CCCACAGTGGGTGGAGGTCTGGG - Intergenic