ID: 900957645

View in Genome Browser
Species Human (GRCh38)
Location 1:5897098-5897120
Sequence GTAGTTCATCGCTTATCGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 16}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900957642_900957645 8 Left 900957642 1:5897067-5897089 CCTTTGTCCTGTCTTTGTGGAGC 0: 1
1: 1
2: 1
3: 21
4: 225
Right 900957645 1:5897098-5897120 GTAGTTCATCGCTTATCGGTAGG 0: 1
1: 0
2: 0
3: 2
4: 16
900957643_900957645 1 Left 900957643 1:5897074-5897096 CCTGTCTTTGTGGAGCATGTATA 0: 1
1: 0
2: 0
3: 23
4: 175
Right 900957645 1:5897098-5897120 GTAGTTCATCGCTTATCGGTAGG 0: 1
1: 0
2: 0
3: 2
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900957645 Original CRISPR GTAGTTCATCGCTTATCGGT AGG Intronic
900957645 1:5897098-5897120 GTAGTTCATCGCTTATCGGTAGG + Intronic
1072589035 10:96810288-96810310 GTAGTTCACTCCTTATCTGTGGG - Intergenic
1076219850 10:128724320-128724342 GTATTCCATCGCTCATGGGTAGG - Intergenic
1101262824 12:103050010-103050032 GTAGTTCATTGCTTAGCGGGGGG - Intergenic
1105229892 13:18483011-18483033 GTACTTCATGGCTTATCTGTTGG - Intergenic
1111022348 13:82468531-82468553 GTTGTTAATCCCTTATCGGATGG + Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1114014140 14:18409839-18409861 GTACTTTATGGCTTATCTGTTGG - Intergenic
1154523515 18:15256830-15256852 GTACTTTATGGCTTATCTGTTGG + Intergenic
1159016514 18:63105396-63105418 GTAGTTCTTTGCTTATGGGAGGG + Intergenic
1167977460 19:53241854-53241876 GTTGTCCATCGCCTATTGGTGGG + Intronic
939370392 2:141291980-141292002 GTAGTTCATCGCATTGGGGTTGG - Intronic
1180438638 22:15340645-15340667 GTACTTTATGGCTTATCTGTTGG - Intergenic
1180521499 22:16211080-16211102 GTACTTTATGGCTTATCTGTTGG - Intergenic
978058355 4:104302889-104302911 GTAGGTCGTAGCTTATTGGTTGG - Intergenic
980734019 4:136859460-136859482 GTAGTTCTTATCTTATTGGTAGG + Intergenic
989180972 5:38576590-38576612 GTAGTTGTTTGCTTATCGGATGG - Intronic
1023164603 7:37331143-37331165 GTAGTTTTTCCCTTATCTGTGGG - Intronic
1201539073 Y:15086545-15086567 GTAGTTGATCCCTAATCTGTAGG + Intergenic