ID: 900959184

View in Genome Browser
Species Human (GRCh38)
Location 1:5908576-5908598
Sequence GCTCAGCTCAGACCGCTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900959180_900959184 -1 Left 900959180 1:5908554-5908576 CCAGAACGGCAGCCAAGCAGGAG 0: 1
1: 0
2: 1
3: 6
4: 127
Right 900959184 1:5908576-5908598 GCTCAGCTCAGACCGCTGGCGGG 0: 1
1: 0
2: 0
3: 19
4: 146
900959177_900959184 18 Left 900959177 1:5908535-5908557 CCACGGGTGTCTCGGGACTCCAG 0: 1
1: 0
2: 0
3: 9
4: 90
Right 900959184 1:5908576-5908598 GCTCAGCTCAGACCGCTGGCGGG 0: 1
1: 0
2: 0
3: 19
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900959184 Original CRISPR GCTCAGCTCAGACCGCTGGC GGG Intronic
900528748 1:3142382-3142404 GCCCAGCTCAGGTCTCTGGCAGG - Intronic
900959184 1:5908576-5908598 GCTCAGCTCAGACCGCTGGCGGG + Intronic
901669762 1:10849366-10849388 GCCCAGCTCAGCCCGCCAGCAGG - Intergenic
901821937 1:11835867-11835889 GCCCTGCTCAGACCACGGGCGGG - Intronic
907670802 1:56473357-56473379 GGTCAGCTGAGATGGCTGGCTGG - Intergenic
908757142 1:67479478-67479500 GCTGAGCTCAGGTCCCTGGCTGG + Intergenic
912276097 1:108260645-108260667 ACTCAGCTCTGACAGTTGGCAGG + Intergenic
912292131 1:108433713-108433735 ACTCAGCTCTGACAGTTGGCAGG - Intronic
913163411 1:116165474-116165496 GCTCATCTCACACAGCTGGGTGG - Intergenic
918963102 1:191305974-191305996 GCTCGGCTCACAACACTGGCCGG + Intergenic
919728819 1:200900285-200900307 CCTCAGCTCAGTACCCTGGCAGG + Intronic
921104332 1:211960431-211960453 GCCCAGTTCAGAACGCTTGCTGG - Intronic
922787064 1:228288121-228288143 GCTCAGCTCACACCGCAGCGTGG - Exonic
922787172 1:228288685-228288707 GCTCAGCTCACACCGCAGCGTGG - Exonic
922788080 1:228293413-228293435 GCTCAGCTCACACCGCAGCACGG - Exonic
922970137 1:229729234-229729256 GCTCTGGTCAGAACGCTGGCAGG + Intergenic
1065790135 10:29252989-29253011 GCTCAGCTCAGTGCCTTGGCTGG + Intergenic
1067139153 10:43641514-43641536 GCTCAGCTGAAACTGTTGGCTGG + Intergenic
1074489152 10:113923285-113923307 CCTCATCTCAGCTCGCTGGCAGG + Intergenic
1075071011 10:119319855-119319877 GCTCAGCCCAGAAGGCTGGCAGG + Intronic
1075587239 10:123666704-123666726 GCTCAGCATCGACCGCTGGGTGG + Exonic
1076032110 10:127168229-127168251 GCTGACCTCAGCCAGCTGGCTGG + Intronic
1078599498 11:12717719-12717741 GCTCACCCCAGGCCCCTGGCAGG + Intronic
1082848815 11:57747142-57747164 GCTCAGAACAGACCACTGCCTGG - Intronic
1083855086 11:65389318-65389340 GCTCAGCTGAGGCCTCTGCCTGG - Intronic
1085312131 11:75522971-75522993 GCTCAGCTCAGGCTGCTGTGTGG - Intronic
1087037777 11:93772240-93772262 GCTCAGCTCATGCTACTGGCTGG + Intronic
1088916057 11:114228727-114228749 GCCCACCTCAGACAGCAGGCTGG - Intronic
1090162376 11:124509594-124509616 GCCCAGTTCAGACCGCTTGCCGG + Intergenic
1096476468 12:51912173-51912195 GCTGAGCTCAGACTGCAGGCAGG - Intronic
1102519762 12:113471081-113471103 GGCCGGCTCAGAGCGCTGGCGGG - Intronic
1103163541 12:118750919-118750941 GCTCTGCTCAGACACCTGGGAGG - Intergenic
1104651159 12:130535081-130535103 GCTGACCTCTGATCGCTGGCCGG + Intronic
1104952934 12:132450589-132450611 GCTCAGCTCACCCCGCAAGCAGG - Intergenic
1105403850 13:20118343-20118365 GCTCAGGCCAGGCCCCTGGCGGG + Intergenic
1112433667 13:99375214-99375236 GAGCAGCCCAGAACGCTGGCAGG + Intronic
1113576929 13:111401787-111401809 GCTCACCTCAGACTGCTCCCTGG + Intergenic
1113597361 13:111543047-111543069 GCAGAGGTCACACCGCTGGCCGG - Intergenic
1114080831 14:19200498-19200520 GCCCAGCTCAGACCCTTGGAGGG + Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1116094992 14:40356249-40356271 GCTCATCTCAGCTGGCTGGCTGG - Intergenic
1120163556 14:81170400-81170422 GCCCAGCTGAGACCTGTGGCTGG + Intergenic
1122165676 14:99821865-99821887 GCTAACCACAGACCACTGGCAGG + Intronic
1128703055 15:69818147-69818169 TCTCAGCTCATACCGTTGGCTGG - Intergenic
1129113822 15:73353831-73353853 GCTCAGCTCAGGTCTCTGGAGGG + Intronic
1132690900 16:1181367-1181389 GCTCAGCTCCCACCGTTGCCGGG - Intronic
1132865256 16:2090045-2090067 GCTCAGCCCATCCAGCTGGCTGG + Exonic
1133041832 16:3065036-3065058 GCCAAGCTCAGACAGCCGGCAGG + Intergenic
1133384914 16:5361762-5361784 GCTCACCTGAGACAGCTGGGTGG - Intergenic
1133536740 16:6709819-6709841 GGCCAGATCAGAACGCTGGCTGG + Intronic
1136546642 16:30958363-30958385 GCTCGGCCCGGGCCGCTGGCCGG + Intronic
1140481098 16:75263308-75263330 ACCCACCTCAGACCTCTGGCTGG - Intronic
1142670900 17:1486956-1486978 GCTCAGATCCCACCGCGGGCAGG + Intronic
1143057157 17:4170943-4170965 GGGCAGAACAGACCGCTGGCAGG + Intronic
1145017790 17:19410423-19410445 GTTCAGCCCAGTCCGCAGGCCGG + Intergenic
1145940685 17:28741951-28741973 GCTCATCTGTGACCGCTGGAGGG - Exonic
1147317358 17:39627326-39627348 GCCCAGCACAGACCGCCGCCGGG + Exonic
1148027586 17:44599517-44599539 TCTCAGCACAGCACGCTGGCTGG + Intergenic
1148945632 17:51259967-51259989 GCTGGGCCCAGACCGGTGGCGGG + Exonic
1150828143 17:68494709-68494731 GCCCAGCTGAGACCGTTTGCCGG - Intergenic
1151327890 17:73390215-73390237 GAACAGCTCAGAGCACTGGCTGG + Intronic
1152278675 17:79372596-79372618 GCTCAGCCCAGTCTCCTGGCTGG + Intronic
1152863777 17:82710431-82710453 TCTCAGCCCAGACCCCTGCCTGG + Intergenic
1155648467 18:28111011-28111033 ACTCTGCACAGACCGATGGCTGG - Intronic
1157014741 18:43698656-43698678 GCTGAGCTCACACCCCTGGCTGG + Intergenic
1159178799 18:64874491-64874513 GATCAGCTCAGTCCACAGGCAGG + Intergenic
1159631934 18:70759089-70759111 GCTCAGCTCAGTCCTCTGTCTGG - Intergenic
1159656325 18:71032549-71032571 GCTCAGCTCTAACCCCAGGCTGG - Intergenic
1159958147 18:74534274-74534296 GCTCAGCTCTGCCTGCTGGCCGG + Intergenic
1160415178 18:78705087-78705109 GCCCAGCTCACATGGCTGGCTGG - Intergenic
1163833306 19:19558250-19558272 GCTCAGCTCCAGCCTCTGGCAGG + Intergenic
1165095988 19:33410235-33410257 GCTCAGCTCAGACCTTGGGTGGG - Intronic
1165549158 19:36568793-36568815 GCACAGCTCAGATCTCAGGCAGG + Intronic
1166702594 19:44890974-44890996 GCTCAGCACAGACCAATGGCGGG + Intronic
1167659875 19:50790375-50790397 GCTGAGCTCAGCCCACTGTCTGG - Intergenic
928411579 2:31058295-31058317 GCCCAGCCCAGCCCGCTGGGAGG - Intronic
932397135 2:71455922-71455944 GCTAGGCTCAGACCTCTGGTTGG + Intronic
933774697 2:85765069-85765091 GCTCAGCACTGACCCCTGACTGG - Intronic
935170005 2:100603528-100603550 GCTCAGCTGGGACTGTTGGCTGG + Intergenic
936402585 2:112176671-112176693 GTTCAGCTGAGTCAGCTGGCTGG + Intronic
937293844 2:120798207-120798229 GCACAGCTCAGAGAGCAGGCAGG + Intronic
937969237 2:127536615-127536637 GCCCAGGTCAGACAGCTGGTGGG + Intronic
946702198 2:222424786-222424808 GCTCTGCGCAGCCCGTTGGCCGG - Exonic
1169592065 20:7155488-7155510 GCTCAGCTCAGGTTGCTGACAGG + Intergenic
1170119239 20:12894047-12894069 GCTCTGCTCATACCTCAGGCTGG + Intergenic
1172146313 20:32760840-32760862 GCTCAGCTCAGCGCCCTGCCTGG - Intergenic
1179658502 21:42860266-42860288 GCTCAGCAGAGACAGCTGTCTGG - Intronic
1180499942 22:15922187-15922209 GCCCAGCTCAGACCCTTGGAGGG - Intergenic
1181804621 22:25367282-25367304 GCACAGCTCACACTGCTGGCAGG - Intronic
1181936974 22:26445978-26446000 GCCCAGCCCGGACAGCTGGCTGG - Intronic
1182236862 22:28883338-28883360 GCGGAGCGCAGACCGCGGGCGGG + Intergenic
1182983259 22:34692748-34692770 TCTCAGCTCAGGCCCCTGGCTGG - Intergenic
1184112915 22:42405698-42405720 GCTCAGCTCATCCCTCTGGCTGG + Intronic
1185292929 22:50036145-50036167 GCTCAGCTGGGACCCCTGGCAGG - Intronic
953095342 3:39769522-39769544 GCCCATCTCAGACCACTGGCTGG + Intergenic
953412165 3:42696784-42696806 GCCCTGCTCAGACACCTGGCAGG + Intronic
957538530 3:81537826-81537848 GTTTAGCTGAGACCCCTGGCTGG + Intronic
960703974 3:120464362-120464384 GCTCTGATTAGACCCCTGGCCGG + Intergenic
962818184 3:139020872-139020894 GCTAAGCTGAGCCCGGTGGCCGG - Exonic
965206744 3:165729123-165729145 GCTGAGCTCAGAGCTGTGGCAGG - Intergenic
967864921 3:194182183-194182205 GCTCAGGTTAGGCCCCTGGCTGG - Intergenic
967877745 3:194278375-194278397 TCCCAGGTCACACCGCTGGCAGG + Intergenic
968525983 4:1057436-1057458 GCTCTTCTCAGACCTCTGGGTGG - Intronic
968594503 4:1475349-1475371 GCTCAGCTCTGACATGTGGCAGG + Intergenic
969377225 4:6770908-6770930 GCTAAGGTCACACAGCTGGCTGG - Intergenic
969407275 4:7001916-7001938 CCACAGCTCAGACCGCAGGCAGG - Intronic
969669370 4:8581279-8581301 GCTGAGCGCAGACCAGTGGCTGG + Exonic
969860039 4:10028461-10028483 CCTGAGCTCACACAGCTGGCTGG - Intronic
970250920 4:14115195-14115217 GCTCAGCTAAGACCCCTTCCAGG + Intergenic
972124195 4:35742251-35742273 GCCCAGCTCAGAACCCTTGCTGG - Intergenic
973774218 4:54230500-54230522 GCTCAGTTCTGGCCGCAGGCAGG + Intronic
976661804 4:87547484-87547506 GCTCAGCAAAGACCTCTGTCTGG - Intergenic
978628529 4:110715675-110715697 GCTCAGCTGGGACTGTTGGCTGG - Intergenic
980836152 4:138195205-138195227 GATCAGGTCAGACCTCTGGACGG + Intronic
981453960 4:144932587-144932609 GCTCAGTTCAGAACCCTTGCTGG + Intergenic
981835936 4:149053362-149053384 GCTCAGCACAGACCAATGGCAGG + Intergenic
984906168 4:184627977-184627999 GCTCAGCTCTGGCCTCCGGCTGG + Exonic
985537330 5:472716-472738 GCTCGGCCCAGGCCGCTTGCGGG + Exonic
986149006 5:5109863-5109885 GGTCACCTCAGGCCGCTCGCTGG - Intergenic
988436737 5:31184247-31184269 GTTCAGCTGTGACCACTGGCTGG + Intergenic
989057465 5:37379145-37379167 GCGCAACTCAGACCACTGGAGGG - Intergenic
990792146 5:59494162-59494184 GGTGAGTTCAGACCACTGGCAGG + Intronic
995224793 5:109690110-109690132 GCTCAGCGCCGACCTCCGGCAGG - Exonic
997411928 5:133697178-133697200 GCTGAGCCCACACTGCTGGCAGG + Intergenic
1000253819 5:159519487-159519509 GCTCAGCTGGGACGGCTGGAAGG + Intergenic
1002282852 5:178143190-178143212 CCTCAGCTCAGAGCCCTGGCTGG - Intronic
1006518256 6:34556398-34556420 GCTTACCTCAGACCACAGGCAGG + Intergenic
1011660577 6:89590736-89590758 GCTGAGCTCAGATGGCTGACGGG + Intronic
1013597200 6:111671028-111671050 GTTCAGCTCAGGCTGCTAGCGGG + Intronic
1016076632 6:139804283-139804305 GCTCAGCTCATGCTACTGGCCGG + Intergenic
1017798462 6:157869582-157869604 GCTTAGCTCAGGGCGCTGGCAGG - Intronic
1018762594 6:166904720-166904742 TCCCAGCTGAGACCGCTGCCTGG - Intronic
1019597909 7:1866858-1866880 GCTCAGCTGCCAGCGCTGGCTGG + Intronic
1019711638 7:2520666-2520688 CCTCAGCTCAGACCCCTTCCTGG + Intronic
1021826331 7:24556039-24556061 GCTCAGCTCATAGAGCTGCCTGG - Intergenic
1021864936 7:24946152-24946174 GCTCAGCTGGGGCTGCTGGCTGG + Intronic
1023895212 7:44427421-44427443 GCTCAGCTCATTCCGAGGGCAGG + Intronic
1028830174 7:95319040-95319062 GCTCTGCTCAGGCAGCCGGCTGG - Intronic
1029161367 7:98554719-98554741 GCTCTGCTCACACCCGTGGCTGG + Intergenic
1035287485 7:157815482-157815504 CCTGAGCTCAGCCCACTGGCTGG - Intronic
1037792922 8:21963197-21963219 GCTCATCTCAGATGGCTGGGTGG + Intronic
1041648003 8:60273403-60273425 TCCCATCTCAGACCCCTGGCAGG - Intronic
1044313948 8:90727549-90727571 GCTCAGTTCAGAACCCTTGCTGG - Intronic
1045004538 8:97906499-97906521 ACTCAGTTCTGACCACTGGCTGG - Intronic
1047527828 8:125648760-125648782 ACTCAGCTCACACAGCTGGTGGG + Intergenic
1048750772 8:137671725-137671747 GCTCAGCTAGGACTGCTGGGTGG - Intergenic
1048863984 8:138745900-138745922 GCCCAGCTCAGACAACAGGCAGG + Intronic
1049312042 8:141938455-141938477 GCTCAGCCCTGTCTGCTGGCTGG - Intergenic
1049326179 8:142022667-142022689 GCGGAGCTCAGGCCGCGGGCAGG + Intergenic
1051606588 9:18923185-18923207 CCTCAGCTCAGACCCCAGCCAGG + Intergenic
1056707650 9:88965692-88965714 TTTCAGCTTAGAGCGCTGGCAGG + Intergenic
1057208977 9:93189365-93189387 CCTCAGCTCAGAGCACTTGCTGG + Intronic
1057229024 9:93307839-93307861 GCTCAGCACACACGGCGGGCTGG - Intronic
1057814085 9:98281055-98281077 GCACAGCTCTGACTGCTGCCGGG - Intergenic
1057904114 9:98971322-98971344 GCTCAGCTCAGGGCTCTGGGAGG - Intronic
1059309686 9:113379622-113379644 CCTCAGCACAGACCCCTCGCGGG + Intergenic
1060437736 9:123609293-123609315 GCTCAGCTCTGTACGCTGGGAGG + Intronic
1061550912 9:131334200-131334222 ACTCAGCTGAGGCTGCTGGCGGG + Intergenic
1186731652 X:12417029-12417051 GCTCGGCTCAGACCTCTTCCGGG + Intronic
1192034453 X:67546916-67546938 GCTCAGGTTAAACCTCTGGCAGG - Intronic
1194201739 X:90959734-90959756 GCTCAGCTGAGAACCCTTGCTGG - Intergenic
1194346785 X:92774551-92774573 GCTCAGTTCAGAACCCTTGCTGG - Intergenic
1198928253 X:141823334-141823356 GCTCAACTCTGACAGCTGCCAGG + Intergenic
1200083997 X:153593943-153593965 GGGCAGCTCAGAAGGCTGGCCGG - Intronic
1200547578 Y:4535181-4535203 GCTCAGCTGAGAACCCTTGCTGG - Intergenic
1200655117 Y:5891195-5891217 GCTCAGTTCAGAACCCTTGCTGG - Intergenic