ID: 900961435

View in Genome Browser
Species Human (GRCh38)
Location 1:5923610-5923632
Sequence GAGGATTACCAGGTGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900961435_900961446 12 Left 900961435 1:5923610-5923632 CCTCCAGCCACCTGGTAATCCTC 0: 1
1: 0
2: 2
3: 13
4: 188
Right 900961446 1:5923645-5923667 ACACCGGGCAGAGCCCTCTGGGG 0: 1
1: 0
2: 0
3: 16
4: 140
900961435_900961445 11 Left 900961435 1:5923610-5923632 CCTCCAGCCACCTGGTAATCCTC 0: 1
1: 0
2: 2
3: 13
4: 188
Right 900961445 1:5923644-5923666 GACACCGGGCAGAGCCCTCTGGG 0: 1
1: 0
2: 0
3: 9
4: 116
900961435_900961444 10 Left 900961435 1:5923610-5923632 CCTCCAGCCACCTGGTAATCCTC 0: 1
1: 0
2: 2
3: 13
4: 188
Right 900961444 1:5923643-5923665 GGACACCGGGCAGAGCCCTCTGG 0: 1
1: 0
2: 0
3: 36
4: 251
900961435_900961443 -3 Left 900961435 1:5923610-5923632 CCTCCAGCCACCTGGTAATCCTC 0: 1
1: 0
2: 2
3: 13
4: 188
Right 900961443 1:5923630-5923652 CTCATTCTTCATGGGACACCGGG 0: 1
1: 0
2: 3
3: 13
4: 162
900961435_900961442 -4 Left 900961435 1:5923610-5923632 CCTCCAGCCACCTGGTAATCCTC 0: 1
1: 0
2: 2
3: 13
4: 188
Right 900961442 1:5923629-5923651 CCTCATTCTTCATGGGACACCGG 0: 1
1: 0
2: 3
3: 16
4: 166
900961435_900961447 13 Left 900961435 1:5923610-5923632 CCTCCAGCCACCTGGTAATCCTC 0: 1
1: 0
2: 2
3: 13
4: 188
Right 900961447 1:5923646-5923668 CACCGGGCAGAGCCCTCTGGGGG 0: 1
1: 0
2: 2
3: 19
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900961435 Original CRISPR GAGGATTACCAGGTGGCTGG AGG (reversed) Intronic
900406641 1:2495768-2495790 GCGGCTGAGCAGGTGGCTGGAGG + Intronic
900961435 1:5923610-5923632 GAGGATTACCAGGTGGCTGGAGG - Intronic
901510175 1:9714413-9714435 GGGGTTAACCAGGTGGCAGGTGG + Intronic
901840164 1:11949326-11949348 GAGGATTAGCCGGTTCCTGGTGG - Intronic
901880607 1:12191665-12191687 GCGGATCTCCAGGAGGCTGGCGG - Intronic
903032203 1:20472007-20472029 GTGCAGTGCCAGGTGGCTGGTGG - Intergenic
904039335 1:27575298-27575320 GAGGGAAACCAGGCGGCTGGGGG + Intronic
904696437 1:32334407-32334429 GAGGAGAACCAGATGGCTGATGG + Exonic
905651774 1:39661526-39661548 GAGGAGTCCCAGGGGGCAGGAGG + Intronic
906056933 1:42924839-42924861 GAGGACTACAAGGCGGATGGCGG - Intergenic
906184785 1:43853586-43853608 GAGGTCTACCAGATGCCTGGTGG + Intronic
907126055 1:52052111-52052133 GAGAAATACCAGGTAGCTGCAGG - Intronic
907706160 1:56834544-56834566 GAAGATTACCAGGACTCTGGGGG + Intergenic
910796542 1:91103015-91103037 GAGGATAACTTGGTGGGTGGGGG + Intergenic
911530218 1:99035555-99035577 GATGGTTGCCAGGAGGCTGGGGG + Intergenic
912657243 1:111497906-111497928 GGGGATTACCAGGAGACTGAGGG + Intronic
913537006 1:119782771-119782793 GAGTATTACCTGAGGGCTGGGGG - Intergenic
918188252 1:182146599-182146621 CAGTATTACCAGGTGTCTGTGGG - Intergenic
919377143 1:196808861-196808883 GAGGACTTCCAGGTGGGTGTGGG + Intergenic
919770266 1:201154137-201154159 CGGGCTCACCAGGTGGCTGGCGG - Exonic
920684847 1:208101606-208101628 GAGGAAGACCAGGTGGTTTGCGG + Intronic
922194469 1:223347836-223347858 GATGATTCCCAGTTGTCTGGAGG + Intronic
1063284571 10:4671589-4671611 CAGAATTACCAAGTGCCTGGTGG - Intergenic
1064002576 10:11675767-11675789 GAGCATAGCAAGGTGGCTGGGGG + Intergenic
1065997884 10:31076316-31076338 CAGGATTAGAAGGTGACTGGTGG + Intergenic
1067478852 10:46582742-46582764 GAGCCTTAGCAGGTGACTGGGGG + Intronic
1067615886 10:47759059-47759081 GAGCCTTAGCAGGTGACTGGGGG - Intergenic
1070758009 10:79005473-79005495 GTGGGGTCCCAGGTGGCTGGAGG - Intergenic
1072918322 10:99554291-99554313 AAGGAGTAGGAGGTGGCTGGAGG - Intergenic
1074115930 10:110457557-110457579 GAGGAGTAGGAGGTGACTGGGGG + Intergenic
1074806385 10:117057303-117057325 GCTGCTTACCAGGTGGCTTGGGG - Intronic
1075934626 10:126328932-126328954 GATGTCTGCCAGGTGGCTGGAGG + Intronic
1076455831 10:130594538-130594560 GAGTATGAGCAGGTGCCTGGAGG - Intergenic
1076979527 11:197260-197282 GAGGGTTACCAGGTGCTGGGAGG - Intronic
1077168314 11:1153542-1153564 GAGGGTTCCCAGGAGGCAGGTGG + Intergenic
1078524938 11:12093031-12093053 GAGCCTTACCAGGTGCATGGAGG + Intergenic
1079493560 11:21015850-21015872 GATGATTAGCAGGAGGCTTGTGG - Intronic
1080005856 11:27405653-27405675 TAAGATTACCAGGAGTCTGGTGG - Intronic
1080106448 11:28516257-28516279 GGCTATTACCAGGTGGGTGGTGG + Intergenic
1083254028 11:61485516-61485538 AAGGATGCACAGGTGGCTGGAGG + Intronic
1083309695 11:61777911-61777933 TAGGATTTCCAGGTGACAGGGGG - Intronic
1083722352 11:64609623-64609645 GAGGAGGACCAGGAGGCTGATGG - Intronic
1083990590 11:66243689-66243711 GAGGACACCCTGGTGGCTGGAGG - Exonic
1089385710 11:118066206-118066228 GGGTATTTCCAGGTGTCTGGGGG - Intergenic
1089893824 11:121907597-121907619 GAGGACAACCAGCTGGCTGGGGG - Intergenic
1091288836 11:134425390-134425412 CTGGATTGCCAGGAGGCTGGGGG - Intergenic
1091744517 12:2982583-2982605 GAGGTTTGCCTGGTGGCAGGAGG + Intronic
1094628226 12:32146722-32146744 GAGGATTACCGAGTGGCTCATGG + Intronic
1096022945 12:48337359-48337381 GAGGATGCCCAGGTGCCTGGTGG + Exonic
1098711646 12:73770102-73770124 AAGGATAACCTGGTGGATGGGGG - Intergenic
1101207912 12:102507333-102507355 GTGGCTTACCTGGTGGCTGGAGG + Intergenic
1101321508 12:103677010-103677032 GAGCCTCACCAGGAGGCTGGAGG - Intronic
1103015232 12:117489187-117489209 GAGCATTATTAGGGGGCTGGGGG + Intronic
1103059120 12:117844711-117844733 TGGGATTAGCAGGTGGTTGGTGG - Intronic
1103475909 12:121218506-121218528 GGGGATTTGCAGTTGGCTGGAGG + Intronic
1104271884 12:127289717-127289739 GTGGAATGCCTGGTGGCTGGGGG - Intergenic
1105303125 13:19152589-19152611 GAGGCTTAGCAGGTGCCTGCTGG + Intergenic
1106186668 13:27415790-27415812 GCAGACTACCAGGTGCCTGGTGG - Intergenic
1106998144 13:35512254-35512276 GAGGATTACCTGATGGTTGAAGG + Intronic
1107111934 13:36707376-36707398 GAGCATTATCGTGTGGCTGGGGG + Intergenic
1113936293 13:113996804-113996826 GAGGACGGCCAGGTGCCTGGTGG - Intronic
1119194115 14:72704387-72704409 CAGGATTCCCAGATGCCTGGGGG - Intronic
1119428729 14:74552128-74552150 GAGGAGTGCCAGTTGGGTGGAGG - Intronic
1120630727 14:86886838-86886860 GCGGATCACCAGGCGGGTGGAGG - Intergenic
1122151543 14:99728637-99728659 GAGTTTGACCAGGTGGCTGGAGG - Intergenic
1123011384 14:105351097-105351119 GAGAGGTGCCAGGTGGCTGGAGG - Intronic
1123705920 15:22951207-22951229 GGGGAGGTCCAGGTGGCTGGCGG - Intronic
1127332312 15:57951244-57951266 GAGGAATACAAGATGGCTAGGGG - Intergenic
1127836077 15:62792336-62792358 CATTCTTACCAGGTGGCTGGAGG + Intronic
1128716203 15:69910004-69910026 GAGGATTACTAGGAGTTTGGAGG - Intergenic
1129296968 15:74604901-74604923 GAGAATGACCAGATGGCTGCTGG - Intronic
1132678485 16:1130370-1130392 GAGGCTGCCCAGGAGGCTGGGGG + Intergenic
1135850368 16:25957879-25957901 GGGGATCAACAGGTGGCTGTTGG + Intronic
1136136379 16:28259097-28259119 CTGGATTCCGAGGTGGCTGGTGG - Intergenic
1136929958 16:34409934-34409956 GGGGAGTAGCATGTGGCTGGTGG - Intergenic
1136974616 16:35001871-35001893 GGGGAGTAGCATGTGGCTGGTGG + Intergenic
1140436124 16:74948598-74948620 GAAAAATACCAGGTGGGTGGTGG - Intronic
1141460430 16:84175691-84175713 GAGGAATAGCCAGTGGCTGGGGG + Intronic
1141998330 16:87648789-87648811 GAGGCTCTCCAGGTGCCTGGAGG + Intronic
1143772487 17:9177555-9177577 TAGGATTACCAGCTGGCTAAGGG + Intronic
1144874049 17:18387783-18387805 GAGGATTGCCTGGGGGCAGGAGG + Intronic
1146047653 17:29523323-29523345 GAGATGGACCAGGTGGCTGGAGG - Intronic
1147044936 17:37744996-37745018 GGGGAGTAACAGGTGTCTGGAGG - Exonic
1147440978 17:40447103-40447125 GAGTGTCAGCAGGTGGCTGGGGG + Intronic
1157753774 18:50200150-50200172 GTGGATTGCCAGCTGGCTGAGGG - Intergenic
1160510143 18:79448906-79448928 GAGGATGGCCTCGTGGCTGGTGG - Exonic
1164767134 19:30780816-30780838 GTGGTCTACCAGGAGGCTGGAGG + Intergenic
1166126549 19:40718234-40718256 GAGGATGACGTGGTGGCCGGGGG + Exonic
1166641539 19:44498708-44498730 GAGGATGCCCAGGTGTGTGGGGG - Intronic
1167791704 19:51687633-51687655 GAGGAGAACTGGGTGGCTGGAGG + Intergenic
925024252 2:595235-595257 GATGCTTGCCAGGAGGCTGGGGG + Intergenic
925332437 2:3069154-3069176 GGGGGTTGCCAGGAGGCTGGGGG + Intergenic
926076989 2:9950515-9950537 GAGGAGACCCGGGTGGCTGGTGG - Intergenic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
926589155 2:14721167-14721189 TGGGATTAGCAGGTGACTGGTGG - Intergenic
929589812 2:43137574-43137596 GAGGGGTCCCGGGTGGCTGGCGG - Intergenic
930990790 2:57651171-57651193 AGGCATTACCATGTGGCTGGAGG - Intergenic
932760500 2:74436391-74436413 GAGGGGTACCAGGGCGCTGGAGG + Intronic
936272305 2:111058350-111058372 CAGAATTACCAGGTGTCTAGGGG + Intronic
936559944 2:113528757-113528779 GAGGACTTCCAGCTGGTTGGGGG + Intergenic
937299547 2:120830675-120830697 GAGAATGTGCAGGTGGCTGGGGG + Intronic
938249923 2:129806619-129806641 GAGGATTGACAGGTGGATGGAGG - Intergenic
941211255 2:162642809-162642831 GTGGATAGCCAGGAGGCTGGAGG + Intronic
942688605 2:178561235-178561257 GAGAACTACCAGATGGCCGGTGG - Exonic
942941949 2:181629453-181629475 TAGGATTACCAGGTTGCTGGGGG - Intronic
945511386 2:210707102-210707124 GAGGATTCCAAAGGGGCTGGTGG - Intergenic
1172369562 20:34377775-34377797 GAGGATTACCTGGTCCCGGGAGG + Intronic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1173408636 20:42789950-42789972 GAAGATGAACCGGTGGCTGGGGG - Intronic
1173866783 20:46317574-46317596 GGGGAGTTCCAGGAGGCTGGAGG - Intergenic
1174278075 20:49418152-49418174 GAGGAGGACGGGGTGGCTGGGGG + Intronic
1175400883 20:58699267-58699289 GAGGATTTGGAGGTGGGTGGGGG + Exonic
1177833696 21:26168983-26169005 GAAAATTACTAGGAGGCTGGGGG + Intronic
1179491983 21:41746662-41746684 GAGGCGTATCAGGTGGCTGCAGG + Exonic
1182875117 22:33684958-33684980 GAGGATTTTCAGGTGTATGGGGG + Intronic
1183309839 22:37103383-37103405 GAGGCCCCCCAGGTGGCTGGCGG - Exonic
1184597536 22:45523281-45523303 AAGGGTAACCAGGTGGCTGAGGG + Intronic
1184882931 22:47322976-47322998 GAGGTTTCCCAGGAGCCTGGAGG + Intergenic
950364181 3:12471531-12471553 GAGGCTGTGCAGGTGGCTGGAGG - Intergenic
953716574 3:45321222-45321244 GAGGAATGGCAGGTGGCAGGAGG - Intergenic
960698259 3:120416458-120416480 CAGGATCACCAGGGAGCTGGAGG + Intronic
961546013 3:127633865-127633887 GAGAATTAGCAGGTGGGTGGTGG + Intronic
962631477 3:137280510-137280532 GAGGAATACCAGGTGGAAGCTGG + Intergenic
967078453 3:186026462-186026484 GAGGAATGACAGGGGGCTGGGGG - Intergenic
969525989 4:7704366-7704388 CCTGATTCCCAGGTGGCTGGGGG - Intronic
973162996 4:47041845-47041867 GAGGGTTTGCAGGTGGCAGGAGG - Intronic
978819850 4:112953772-112953794 GATTATTACCAGGTGCTTGGTGG + Intronic
979649027 4:123107784-123107806 GAGGGGTTCAAGGTGGCTGGGGG + Intronic
981581422 4:146252082-146252104 GAGAAATTCCAGATGGCTGGTGG + Intergenic
983151356 4:164285683-164285705 GCGGATTACGAGGTCGCTGGTGG - Intronic
984035872 4:174667096-174667118 GAGGAAAACCAAGTCGCTGGTGG + Intronic
985930251 5:3051528-3051550 GAGGATTTCCAGGTGGCAGCAGG + Intergenic
986438635 5:7759342-7759364 GAGGCTGAGCAGGTGGCTGGAGG - Intronic
986694107 5:10336939-10336961 GAGGGTTACCAGGAGCTTGGAGG + Intergenic
988833825 5:35012336-35012358 GAGGAAAACTAGGTGGCTGGGGG - Intronic
988878245 5:35472016-35472038 GAGGACTACCGGATGGCTGAAGG - Intergenic
989697824 5:44224596-44224618 GAGGAATAGAAGGTGACTGGTGG + Intergenic
992771786 5:80055373-80055395 GAGCACTACCATGGGGCTGGGGG - Intronic
995734354 5:115283295-115283317 GGTGATTACCAGGAGTCTGGGGG - Intronic
997598844 5:135125894-135125916 CAGGAATGCCAGGTGGATGGAGG + Intronic
999662778 5:153883037-153883059 GAGGATTCTCAGGTGGTTGAGGG - Intergenic
1001310260 5:170605175-170605197 GAGGGTGGGCAGGTGGCTGGTGG - Intronic
1001511372 5:172325002-172325024 GACGATTGCCAGGGAGCTGGGGG + Intergenic
1003785581 6:9482624-9482646 AAGCATTAATAGGTGGCTGGTGG - Intergenic
1005767265 6:29024317-29024339 TGGGATTAGCAGGTGGTTGGTGG + Intergenic
1006385791 6:33730137-33730159 GAAGGTGACCACGTGGCTGGGGG - Intronic
1006459553 6:34150472-34150494 GATGCTCACCAAGTGGCTGGGGG + Intronic
1011088578 6:83570540-83570562 GAGGTTTACGGGGTGGCGGGGGG + Intronic
1012159037 6:95859764-95859786 AAGGATAAACAGGTGGCTGGTGG + Intergenic
1013069238 6:106713721-106713743 GGTGATTAGCAGGGGGCTGGCGG - Intergenic
1013860124 6:114625655-114625677 GAAGGTGACCAGATGGCTGGAGG - Intergenic
1015265661 6:131289689-131289711 TGGGATTAGCAGGTGGTTGGTGG - Intergenic
1017809430 6:157974362-157974384 GGGGAGGAGCAGGTGGCTGGGGG - Intergenic
1018202414 6:161407864-161407886 GGGGATTACAAGGTGCATGGTGG - Intronic
1018424406 6:163667451-163667473 GGGGATAACCTGGGGGCTGGAGG + Intergenic
1018718188 6:166551740-166551762 GAGGGTGATCAGGTGCCTGGTGG - Intronic
1018922178 6:168182963-168182985 TGGGATTAGCAGGTGACTGGTGG + Intergenic
1019168745 6:170116846-170116868 GAGGAAGAGCAGGAGGCTGGGGG + Intergenic
1019626961 7:2020634-2020656 GAGGCTGACCCGGTGGCTGTGGG + Intronic
1020357212 7:7290910-7290932 AGGGGTCACCAGGTGGCTGGGGG - Intergenic
1023986365 7:45099495-45099517 GGGGATTACCAGGTGCTGGGAGG - Intergenic
1026771167 7:73200557-73200579 GCTGATTTCCAGGTAGCTGGGGG - Intergenic
1026788680 7:73318101-73318123 GAGGAGGAGCAGGTGTCTGGGGG - Intronic
1027012035 7:74753954-74753976 GCTGATTTCCAGGTAGCTGGGGG - Intronic
1027076006 7:75192100-75192122 GCTGATTTCCAGGTAGCTGGGGG + Intergenic
1029379187 7:100201463-100201485 GAGGAAGATCAGGTGGGTGGGGG + Exonic
1030781910 7:113611257-113611279 GTGGATAACTGGGTGGCTGGTGG + Intergenic
1032700706 7:134376426-134376448 TTGGTTTACCAGATGGCTGGTGG + Intergenic
1037764905 8:21766661-21766683 GAGGATGAACAGGGGCCTGGGGG + Intronic
1037776597 8:21839586-21839608 GAGGACTTCCTGGTGGCTGTGGG + Intergenic
1037989220 8:23308680-23308702 GAGGATGAGCAGATGGCTTGTGG + Intronic
1039350876 8:36762161-36762183 GGGGATTAGTAGGTGACTGGTGG + Intergenic
1041104477 8:54427826-54427848 GAGGATGACCATGAGGGTGGAGG - Intergenic
1043783455 8:84366475-84366497 GATGTTTAAAAGGTGGCTGGAGG + Intronic
1044756673 8:95469902-95469924 GAGGATTACCAGGTGGTGAAAGG + Intergenic
1046366082 8:113234942-113234964 GATGAATACCACCTGGCTGGTGG - Intronic
1047257693 8:123228076-123228098 GAGGATGCACAGGTGGATGGTGG - Intronic
1049892922 9:87607-87629 GAGGACTTCCAGCTGGTTGGGGG - Intergenic
1049982919 9:921167-921189 AGTGATTACCAGGGGGCTGGAGG - Intronic
1051669332 9:19494439-19494461 AAGGATGCCCAGGTGGCTGCAGG - Intergenic
1053734146 9:41087669-41087691 GAGGACTTCCAGCTGGTTGGGGG - Intergenic
1054694252 9:68343883-68343905 GAGGACTTCCAGCTGGTTGGGGG + Intronic
1054971273 9:71090479-71090501 GAGGGTGACCAGGTTGGTGGTGG - Intronic
1056144842 9:83719259-83719281 GATGAATACCACCTGGCTGGTGG - Intergenic
1057305150 9:93907948-93907970 GAGGGTGAACAGCTGGCTGGAGG - Intergenic
1057928354 9:99171922-99171944 GAGGACTCCCAGGTGGTTGATGG - Intergenic
1058993586 9:110277970-110277992 TAGGATTTCCAGGTGGGCGGTGG + Intergenic
1059689888 9:116674849-116674871 AAGGATAACTTGGTGGCTGGGGG - Intronic
1060838416 9:126775755-126775777 GGGGAGAACCAGGGGGCTGGGGG - Intergenic
1061013824 9:127970832-127970854 TAGGATTAGCAGGTGGCGGGTGG - Intronic
1061634995 9:131902057-131902079 GAGGATTGCTGGGTGGCTGGAGG - Intronic
1062037383 9:134388827-134388849 GAGGGTCTCCAGGTGTCTGGAGG + Intronic
1062071070 9:134555218-134555240 GAGGATAGCGAGGTGGGTGGAGG + Intergenic
1062081206 9:134624625-134624647 GAGGCAGACCAGATGGCTGGTGG - Intergenic
1062449366 9:136609114-136609136 GCGGGGTACCTGGTGGCTGGGGG + Intergenic
1189809209 X:44765333-44765355 GGGCATTACCAGGTTGCTGTGGG - Intergenic
1189847105 X:45148088-45148110 GAGGGTTAGCAGGTGGCTGGCGG + Intergenic
1192899460 X:75480537-75480559 GAGGAGAACTGGGTGGCTGGGGG - Intronic
1193212344 X:78822044-78822066 GAGGATTACCTGCTGGCTATAGG - Intergenic
1193398248 X:81011578-81011600 GAGGTTTTCCATTTGGCTGGTGG + Intergenic
1197435248 X:126420091-126420113 GAGGATCACCTGGAGGCAGGAGG - Intergenic
1199704428 X:150411564-150411586 GAGCTTTTCCAGGTGGTTGGAGG - Intronic
1199717758 X:150518463-150518485 GAGGAATAGAAGGAGGCTGGTGG + Intergenic
1199857465 X:151772043-151772065 AAGCATTTCCAGGTGACTGGAGG + Intergenic