ID: 900961790

View in Genome Browser
Species Human (GRCh38)
Location 1:5927075-5927097
Sequence CTGCCTCAGCAGAAGCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 725
Summary {0: 1, 1: 2, 2: 17, 3: 90, 4: 615}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900961789_900961790 1 Left 900961789 1:5927051-5927073 CCAAGAGGCTCTGAGCACAGGGT 0: 1
1: 0
2: 2
3: 20
4: 253
Right 900961790 1:5927075-5927097 CTGCCTCAGCAGAAGCAGCTAGG 0: 1
1: 2
2: 17
3: 90
4: 615
900961785_900961790 19 Left 900961785 1:5927033-5927055 CCAGGACATGGGTCTAAACCAAG 0: 1
1: 0
2: 1
3: 21
4: 178
Right 900961790 1:5927075-5927097 CTGCCTCAGCAGAAGCAGCTAGG 0: 1
1: 2
2: 17
3: 90
4: 615

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900961790 Original CRISPR CTGCCTCAGCAGAAGCAGCT AGG Intronic
900278562 1:1850079-1850101 CTGCCTCAGCCTGAGTAGCTGGG + Intronic
900354242 1:2252403-2252425 CAGCCTCCCCAGAAGCAGCTTGG + Intronic
900373457 1:2342744-2342766 CTCCCTCAGCAGAGCCAGCATGG + Intronic
900566814 1:3337384-3337406 CAGCCTCAGGAGCAGCAGTTGGG - Intronic
900777214 1:4594208-4594230 CTGCCTCAGTGGGAGCAGCAGGG - Intergenic
900961790 1:5927075-5927097 CTGCCTCAGCAGAAGCAGCTAGG + Intronic
901008268 1:6182183-6182205 CAGCCTCCCCAGTAGCAGCTGGG + Intronic
901269615 1:7941799-7941821 CTGCCTCAGCCTCAGTAGCTGGG - Intronic
901575287 1:10195880-10195902 CAGCCTCCCAAGAAGCAGCTGGG + Intergenic
901813320 1:11779805-11779827 CTTCCTCAGCTGGAGCCGCTGGG + Exonic
901813868 1:11782804-11782826 CTGCCTGAGCCCAAGTAGCTGGG - Intronic
901875452 1:12164777-12164799 CGGCCTCAGCAGGAGAAGCCAGG + Intergenic
902082902 1:13833465-13833487 CTGGCTCAGCAGGTGCAGCGTGG - Intergenic
902885686 1:19403160-19403182 CTGCCTAAGCTGAAGCACCAGGG - Intronic
903850397 1:26302245-26302267 CTGCCTCAGCCTCAGTAGCTGGG - Intronic
904176005 1:28629447-28629469 CTGCCTCAGCCTGAGCATCTGGG + Intronic
904629293 1:31829368-31829390 CTGCTTCGGCAGCAGCACCTTGG - Intergenic
904966322 1:34377316-34377338 CTGCCTCACCAGAAACAGCCAGG - Intergenic
905222734 1:36460121-36460143 CTGCCTCAGCCCCAGTAGCTAGG + Intronic
905369710 1:37476565-37476587 CTGACTCAGCTGAAGCAGCCTGG + Intronic
905881788 1:41468718-41468740 CTGCCTCACCTGCAGCATCTGGG - Intergenic
906387082 1:45379276-45379298 CTGCCTCAGCAGGAGTAGCTGGG + Intronic
906692101 1:47799308-47799330 CTCCCTCAGCAGATGAAGCAGGG + Intronic
906992725 1:50755863-50755885 CAGCCACAGCTGCAGCAGCTGGG + Intronic
907171196 1:52466781-52466803 CTGCCTCAGCCTGAGTAGCTGGG + Intronic
907901872 1:58748459-58748481 CTGCCTCAGCAGGAGTAACTGGG - Intergenic
908245256 1:62222761-62222783 CTGCCTCAGCCTGAGTAGCTGGG - Intergenic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
910179328 1:84463973-84463995 ATGCCTCATCAGAGGCAGCATGG + Intergenic
910375056 1:86559329-86559351 CAACCTTAGGAGAAGCAGCTAGG - Intronic
912499531 1:110112860-110112882 CTGCCTTAGCAGCTGCAGCACGG - Exonic
912543880 1:110437145-110437167 CCACCTCAGCAGGAGCAGCTGGG + Intergenic
912982353 1:114387013-114387035 TAACCTCAGCAAAAGCAGCTGGG + Intergenic
913658594 1:120985582-120985604 GTGCCACAACAGAAGCAGATTGG + Intergenic
914009958 1:143768707-143768729 GTGCCACAACAGAAGCAGATTGG + Intergenic
914433354 1:147639588-147639610 CTACCTCCGGAAAAGCAGCTGGG - Intronic
914523207 1:148436828-148436850 GTGCCACAACAGAAGCAGATTGG + Intergenic
914648578 1:149677363-149677385 GTGCCACAACAGAAGCAGATTGG + Intergenic
915149832 1:153821677-153821699 CTGCCTCAGCCTCAGTAGCTGGG + Intronic
915201977 1:154237033-154237055 CTGGCTCTGCATAATCAGCTGGG - Exonic
915249523 1:154578247-154578269 CAGCCACAGCAGCAGCTGCTGGG - Exonic
915337140 1:155151317-155151339 CTGCCTCAGCCTGAGTAGCTGGG - Intergenic
915721525 1:157989275-157989297 CTGCCCCAACAGAAGCAGGCAGG - Intergenic
916318742 1:163479559-163479581 CAGCCACAGCTGTAGCAGCTAGG - Intergenic
916680629 1:167101686-167101708 TTGCCTCAGCCTAAGTAGCTGGG - Intronic
916756340 1:167773808-167773830 CTGCCACAGCCTAAGTAGCTGGG - Intronic
917345210 1:174022257-174022279 CAGCCTCAGCAGCAGCAGGTGGG - Exonic
918365941 1:183807654-183807676 AGGCCTGAGCTGAAGCAGCTGGG - Intronic
919491802 1:198213434-198213456 CTACCACTGCAGAAACAGCTGGG + Intronic
919725597 1:200880846-200880868 CTGCCTCAGCCCAAGTAGCTGGG + Intergenic
919800287 1:201350007-201350029 CTGCCTCAGCCTCAGTAGCTGGG + Intergenic
919892529 1:201986038-201986060 CTGCCTCAGCCCAAGTAGCTGGG + Intronic
920104098 1:203538354-203538376 CGCCTTCAGCAGAGGCAGCTTGG - Intergenic
920142996 1:203833250-203833272 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
920224314 1:204427022-204427044 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
920783015 1:209012871-209012893 CTCCTTCAGGAGAACCAGCTTGG - Intergenic
921000563 1:211039126-211039148 CAGCCACAGCTGGAGCAGCTGGG - Intronic
922115391 1:222608143-222608165 CAGCCACAGCTGAAGCAGGTGGG + Intergenic
922164076 1:223100514-223100536 CAGCCACAGCTGAAGCAGCTGGG - Intergenic
922969621 1:229725120-229725142 CAGCCGCAGCAGCAGCATCTGGG - Intergenic
923357720 1:233176897-233176919 CTGCCTCAGCCCGAGTAGCTGGG - Intronic
923506290 1:234609196-234609218 TTGCAGCAGCAGCAGCAGCTTGG - Exonic
923767347 1:236904509-236904531 CTGCCTCAGCCTGAGTAGCTGGG - Intergenic
1064030568 10:11880307-11880329 CTGTCTCATCAGAAGAGGCTGGG - Intergenic
1064121011 10:12619401-12619423 CTGCCTCAGCCCGAGTAGCTGGG + Intronic
1064188395 10:13183969-13183991 CTGCCTCACCCTCAGCAGCTGGG + Intronic
1064322904 10:14322230-14322252 CTGAGGCAGCAGAAGCAGCATGG + Intronic
1065548460 10:26846026-26846048 CTGCCTCAGCCTCAGTAGCTGGG - Intronic
1065745427 10:28836760-28836782 CTGCCTCAGCCGCAGTAGCTGGG + Intergenic
1065925520 10:30431815-30431837 CTGACCCGGCAGAAGCAGCCTGG - Intergenic
1066005130 10:31140035-31140057 CTGTCTCATGAGAAGCAGCAAGG - Intergenic
1067024881 10:42836250-42836272 CAGCCTCAGAAGGAGCAGCGAGG - Intergenic
1067108449 10:43381467-43381489 CTGCCTCATCCTAAGTAGCTGGG - Intergenic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067657871 10:48210986-48211008 CTGCCTGTGCAGATACAGCTGGG - Intronic
1067812325 10:49439397-49439419 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1068235464 10:54227402-54227424 CAGCCACAGCTGGAGCAGCTAGG + Intronic
1069126183 10:64637358-64637380 CTTGCTCAGGAGAGGCAGCTTGG + Intergenic
1069367848 10:67712520-67712542 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
1069391426 10:67940041-67940063 CTGCCTCAGCCAGAGCAGCTGGG + Intronic
1069893983 10:71669137-71669159 CTCCCTCAGCAGAACCATCAGGG - Intronic
1070141620 10:73742291-73742313 CTACCTCAGTAGGAGTAGCTGGG - Intergenic
1070562912 10:77581419-77581441 CTGCCTCAGCCTCAGTAGCTGGG + Intronic
1070794024 10:79206621-79206643 CTGCCTTTGCAGAAGGAGCCAGG + Intronic
1071018970 10:81029743-81029765 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1071296458 10:84223895-84223917 TTGCCTGAGCAGAATCACCTGGG - Intronic
1071813300 10:89206915-89206937 GTGCAGCAGCAGGAGCAGCTCGG + Exonic
1072048141 10:91677657-91677679 CAGCCTCCTCAGGAGCAGCTGGG - Intergenic
1072312720 10:94171921-94171943 CTCCCTCAGCAGAAACACCTAGG + Intronic
1072893137 10:99343076-99343098 CTGCCTCAGCCTAAGTAGCTGGG + Intronic
1073402654 10:103271641-103271663 CTGCCTCAGCCCAAGTAGCTGGG + Intergenic
1074058186 10:109941710-109941732 CAGCCGTAGCAGAAGCACCTGGG + Intronic
1074298348 10:112211245-112211267 CTCCACCAGCAGAAGCACCTGGG + Intronic
1074454738 10:113587202-113587224 CTGCCTCAGCCCCAGTAGCTGGG - Intronic
1074756495 10:116627751-116627773 ATCCCTCCGCAGACGCAGCTAGG + Exonic
1074874989 10:117606776-117606798 CTGCCTCGGCTGAAGCTGGTGGG - Intergenic
1074944892 10:118271761-118271783 CTGCCTCAGCAGAAGCAGCAGGG - Intergenic
1075667480 10:124241241-124241263 GTGCCTCAGTAGGAGAAGCTGGG + Intergenic
1076361863 10:129895224-129895246 CTGCCTCACCAGCAGGAGTTTGG + Intronic
1076763121 10:132615615-132615637 CTGCCCCTGGTGAAGCAGCTGGG + Intronic
1076895882 10:133311718-133311740 CAGCCTCAGCAGAAGCCCCAGGG + Exonic
1077128486 11:956403-956425 GTGCCTCATCAGAGGCAGGTGGG - Intronic
1077363618 11:2152339-2152361 CTTCCCCAGCAGAGGCAGCCTGG - Intronic
1077444012 11:2581961-2581983 CAGCCTCTGCAGAAGCATCCTGG + Intronic
1077939684 11:6827842-6827864 CTGCCTAAGCAGAAACGTCTTGG - Intergenic
1078105318 11:8354725-8354747 CTCCCTGAGGAGCAGCAGCTGGG + Intergenic
1078201649 11:9189110-9189132 CAGCCACAGCTGGAGCAGCTGGG - Intronic
1079250458 11:18783226-18783248 CTGCCTCATGATAAGCAGCAAGG + Intronic
1079559445 11:21804003-21804025 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1079648501 11:22896506-22896528 CTGCCTCAGCCTGGGCAGCTGGG - Intergenic
1080319932 11:30996355-30996377 CAGCCACATCAGAAACAGCTTGG + Intronic
1082004553 11:47412363-47412385 CTGCAGCAGCAGCAACAGCTGGG + Exonic
1082035027 11:47638431-47638453 CTGCCTCAGCCTGAGTAGCTAGG - Intronic
1082070398 11:47935017-47935039 CAGCCTCAAGAGTAGCAGCTGGG - Intergenic
1082072965 11:47953906-47953928 CTGCCTCAGCTGGAGTAGCTGGG - Intergenic
1082137702 11:48568424-48568446 CTGACTCCTCAGAAGAAGCTTGG - Intergenic
1082617133 11:55374562-55374584 CTTCCTCAGAAGAAGCAACGTGG - Intergenic
1082625538 11:55479916-55479938 CTTCCTCAGAAGAAGCAACGTGG - Intergenic
1083121896 11:60521080-60521102 CAGCCACAGATGAAGCAGCTGGG + Intronic
1083179019 11:60972414-60972436 TGGCCTCAGCACAACCAGCTGGG + Intronic
1083222445 11:61261915-61261937 GTGCTTCAGGAGAAGGAGCTGGG + Intronic
1083608272 11:63992099-63992121 CTGCCTCAGCCTAAGTAGCTGGG - Intronic
1083768842 11:64855197-64855219 CTCCCTGAACGGAAGCAGCTGGG - Intronic
1083989727 11:66239405-66239427 CTGCCTCAGCCTGAGTAGCTAGG - Intronic
1084291460 11:68172343-68172365 CTGCCTCAGCCTAAGTAGCTGGG + Intronic
1085307483 11:75496180-75496202 CTGGCGCAGCAGAGGCTGCTGGG - Intronic
1085580517 11:77645943-77645965 CTGCATCAGTGGCAGCAGCTAGG - Intergenic
1085724715 11:78944220-78944242 CAACCTCTGCAGAAGCAGTTTGG + Intronic
1085768739 11:79306774-79306796 CTGCCTCAGCAGCCTCAGGTAGG - Intronic
1085975479 11:81648131-81648153 GTACCTCAGCAGAGGAAGCTGGG + Intergenic
1086541176 11:87914806-87914828 CTGCTTCAGCCAGAGCAGCTAGG - Intergenic
1087525809 11:99311042-99311064 CTGCCTCAGCCTGAGCAGCTGGG + Intronic
1088325115 11:108593290-108593312 CAGCCTCCGCAGCAGCCGCTCGG + Intronic
1089005491 11:115087454-115087476 CTGCCCCAGCACTGGCAGCTTGG - Intergenic
1089129828 11:116202929-116202951 CTACCCCAGCAGGAGCATCTTGG - Intergenic
1089569540 11:119395053-119395075 ATCCCCCAGCAGCAGCAGCTTGG - Intergenic
1090000241 11:122949947-122949969 CTGCCTCAGCAGGAGTATCTGGG + Intronic
1090387933 11:126367273-126367295 CAGCCTCAGGAGACGCTGCTGGG - Intronic
1090390572 11:126384719-126384741 CAGCCTCAGGAGATGCTGCTGGG - Intronic
1091187761 11:133661890-133661912 CTGCCACAGCAGAGGGAGCGGGG + Intergenic
1091705636 12:2691376-2691398 CCGCCTCTGCAGACGCAGCCGGG - Intronic
1091737694 12:2936634-2936656 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
1092202025 12:6591152-6591174 CTGCCTCAGTAGACGCTACTAGG - Intronic
1093112389 12:15167388-15167410 CAGCATCAGCAGAATCACCTGGG + Intronic
1093446716 12:19267845-19267867 CTGCCTCAGCCCAAGTAGCTGGG - Intronic
1093498576 12:19784148-19784170 CTGCATTAGCAGCTGCAGCTGGG - Intergenic
1093590464 12:20896021-20896043 CAGCCACAGCTGGAGCAGCTGGG + Intronic
1093997252 12:25655544-25655566 CAGCCTCAGCAGGTGAAGCTCGG - Intergenic
1094544315 12:31390521-31390543 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1095606257 12:44071240-44071262 CTGCCTGAGTGGATGCAGCTGGG + Intronic
1095763607 12:45869130-45869152 CTGCCTCAGCCTGAGTAGCTGGG + Intronic
1095766220 12:45898799-45898821 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
1097000820 12:55875009-55875031 CTGCCTCAGCCCAAGTAGCTGGG + Intergenic
1097012774 12:55965255-55965277 CTCCCCCAGCAGAATCAACTAGG - Intronic
1097021413 12:56023169-56023191 CAGCCTCAGCCGAATAAGCTGGG + Intronic
1097523795 12:60704202-60704224 CTGCCTCAGCAGGAGTAGCTGGG + Intergenic
1097857458 12:64479380-64479402 CTTCCTCAGCAGTGGCAGCCAGG - Intronic
1098021246 12:66158521-66158543 CTGCCTCAGCCCGAGTAGCTGGG - Intronic
1098127515 12:67315336-67315358 CTGCCTCAGCTGTAGCAGCTAGG - Exonic
1098242339 12:68481016-68481038 CTGCCTTGGCAGGAGTAGCTGGG - Intergenic
1098770599 12:74547934-74547956 CTGCCTCAGCCTCACCAGCTGGG + Intergenic
1099199532 12:79659179-79659201 CTGCCTTAGCCCAAGTAGCTGGG - Intronic
1099216467 12:79859799-79859821 CTGCCTCAGCAGCGGTAGCTAGG - Intronic
1100459899 12:94789143-94789165 CTGCCTCAGCCTGAGTAGCTGGG + Intergenic
1100626586 12:96339812-96339834 ATGCCTCAGCCCAAGTAGCTAGG - Intronic
1101340317 12:103837211-103837233 CAGCCACAGCTGGAGCAGCTAGG + Intronic
1101923139 12:108949381-108949403 CTGCCTCAGCCCAAGTAGCTGGG + Intronic
1102297358 12:111747511-111747533 CGCCCCCAGCAGAGGCAGCTGGG + Intronic
1102322367 12:111948217-111948239 CTCCCTCAACAGGAGCAGCAAGG - Intronic
1102471322 12:113161475-113161497 CAGCCGCAGCTGAAGCTGCTCGG + Intronic
1103088611 12:118081435-118081457 CTGCCTCAGCCTAAGTAGCTAGG + Intronic
1103564861 12:121810480-121810502 CTCCCTCAGGAAGAGCAGCTTGG - Exonic
1103622215 12:122194451-122194473 CTGCCCCAGCCTAAGTAGCTGGG - Intronic
1103662559 12:122532960-122532982 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
1103739132 12:123079460-123079482 CTGCCTCAGCCCAAGTAGCTGGG + Intronic
1105300956 13:19134156-19134178 CTGCCTCAGCAGGAGGAGCCTGG + Intergenic
1105861227 13:24415833-24415855 ATGCCTCAGCTGGAGTAGCTGGG - Intergenic
1106134034 13:26961150-26961172 AAGGCTCAGCAGGAGCAGCTGGG - Intergenic
1106211561 13:27652752-27652774 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
1106379001 13:29218002-29218024 CTGCCTCAGCCTCAGTAGCTGGG - Intronic
1106571654 13:30933221-30933243 CTGCCTCTGCAGACACAGCTGGG - Intronic
1107372377 13:39766718-39766740 CTCCCACAGAAGAAGCAGATGGG + Intronic
1107596573 13:41969223-41969245 CTGCCCCAGCTGAAGCAGCCAGG + Intergenic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1108057004 13:46495072-46495094 CTGCCCCAGCAGAAGTAGCAAGG - Intergenic
1108184348 13:47873465-47873487 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1109837360 13:67877388-67877410 CTGAGTCTGCAGCAGCAGCTGGG - Intergenic
1110209225 13:72953030-72953052 CAGCCTTGACAGAAGCAGCTGGG + Intronic
1110666363 13:78122163-78122185 CTGCCGCAGCAGAGGCAGATGGG - Intergenic
1112630485 13:101156395-101156417 CTCCCTCAGCAGAAAGAGCGGGG + Intronic
1112857809 13:103792482-103792504 CAGCCACAGCTGGAGCAGCTAGG + Intergenic
1113910886 13:113840721-113840743 CTGGCAGAGCAGAAGCAGCTCGG + Intronic
1114365993 14:22027482-22027504 CAGCCTTGACAGAAGCAGCTGGG - Intergenic
1114644401 14:24246448-24246470 CTGCCTCAGCCCAAATAGCTAGG - Intergenic
1114664886 14:24371797-24371819 CTGCCTCAGCAGGAGTAGCTGGG + Intronic
1115496392 14:34008804-34008826 CAGCCTCACCAGAATCTGCTGGG + Intronic
1115499244 14:34034811-34034833 CTGCCTCAGTAGGAATAGCTGGG - Intronic
1115603256 14:34976075-34976097 CTCCCTCAGCCCAAGTAGCTGGG - Intergenic
1115982738 14:39071749-39071771 CTGCCTCAGCCCAAGTAGCTGGG - Intronic
1116138659 14:40959741-40959763 TAGCCACAGCTGAAGCAGCTGGG + Intergenic
1116318043 14:43422997-43423019 CAGCCTCAGCCCAAGTAGCTGGG - Intergenic
1116931367 14:50694382-50694404 CAGCCACAGCAGGAGCAGCTGGG + Intergenic
1118069588 14:62231723-62231745 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
1118207833 14:63739563-63739585 CTGCCTCAGCCTCAGTAGCTGGG - Intergenic
1118857138 14:69632372-69632394 CTCCCTCAGTAAATGCAGCTGGG + Intronic
1119200535 14:72748713-72748735 CAGCCACAGCTGGAGCAGCTGGG - Intronic
1119291836 14:73501500-73501522 CTGCCTCAGCCTGAGTAGCTGGG + Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1120884128 14:89438874-89438896 CTGCCTCAGCTTGAGTAGCTGGG + Intronic
1121121463 14:91378348-91378370 CAGCCTCAGCTAAACCAGCTTGG + Intronic
1121146987 14:91592963-91592985 CAGCCACAGCTGGAGCAGCTGGG - Intronic
1121179519 14:91918261-91918283 CTGACTATGCAGAAACAGCTGGG - Intronic
1121568217 14:94926362-94926384 CTTCCTCAGGAGCAGCACCTGGG - Intergenic
1121964932 14:98295321-98295343 CTTTCCCAGCAGCAGCAGCTGGG - Intergenic
1122405194 14:101496626-101496648 CCGGCTCTGCAGAAGCATCTCGG - Intergenic
1122462994 14:101911160-101911182 CTGCCTCAGCCCGAGTAGCTGGG - Intronic
1122745142 14:103893218-103893240 CTGCCTCAGCCGGAGTAGCTAGG + Intergenic
1123039276 14:105483777-105483799 CTTCCTCTGCAGACTCAGCTTGG - Intergenic
1123757513 15:23408374-23408396 CTGCCTGAGCATTAGCAGTTTGG - Intergenic
1124016481 15:25880701-25880723 CTGCCTCACCAGAAACAGAATGG + Intergenic
1124254111 15:28127223-28127245 GTGTCTCTGCAGACGCAGCTGGG + Intronic
1124464107 15:29920711-29920733 CTTGCTCAGCAGGAGCAGCAGGG - Intronic
1124466880 15:29948147-29948169 CTGCCTCAGCAGGAGTGACTGGG - Intronic
1124792716 15:32744741-32744763 CTGCCTCTACAGAACCAGTTTGG - Exonic
1124933394 15:34146059-34146081 CTGCCTCAGCCTGAGTAGCTGGG + Intronic
1125549332 15:40533460-40533482 CTGCCTCAGAAGGAGTAGCTGGG + Intronic
1125934640 15:43624539-43624561 CTGCCTCAGCCTCAGTAGCTGGG + Intergenic
1126112016 15:45180972-45180994 CTGTGTCACCAGAAGCTGCTTGG + Intronic
1126317141 15:47382392-47382414 CTGCCTCAGCAGCAGTAGCTGGG - Intronic
1126488309 15:49207886-49207908 CTGCCTCAGCCTGAGTAGCTAGG + Intronic
1126702279 15:51379083-51379105 CTGCCGTAGCAGCAACAGCTGGG - Intronic
1126829362 15:52584255-52584277 CTGCCTCAGCTTGAGTAGCTGGG + Intronic
1127314964 15:57786077-57786099 CTGTCTCATCAGAAACAACTGGG - Intergenic
1128228427 15:66018536-66018558 CTGACTCAGCAGATACAGCCAGG - Intronic
1128719309 15:69934681-69934703 CTGGCACAGCTGAAGCATCTAGG + Intergenic
1129924401 15:79350028-79350050 CTGCATCAGGATAAGTAGCTTGG + Intronic
1131236796 15:90703907-90703929 CTGCCTCAGCTTCAGTAGCTGGG + Intergenic
1132383283 15:101381616-101381638 AGGCCTGAGCAGGAGCAGCTGGG - Intronic
1132907638 16:2291211-2291233 CTGCCTCAGCCTCAGTAGCTGGG - Intronic
1133054698 16:3139854-3139876 CTGCCTCAGCCTGAGTAGCTGGG + Intronic
1133440583 16:5817804-5817826 CTGCCTCAGCCTCAGTAGCTGGG + Intergenic
1133588337 16:7217215-7217237 CTCCCACAGCAGGAGTAGCTGGG + Intronic
1133763707 16:8820725-8820747 CTGACTCAGGAAAGGCAGCTGGG + Intronic
1134010016 16:10844985-10845007 CTGCCTCAGCCTCAGTAGCTGGG + Intergenic
1134030045 16:10984764-10984786 CTGAGTCAGCAGAATCAGCAGGG + Intronic
1134257310 16:12622863-12622885 CTGCCTCAGCCTGAGTAGCTGGG + Intergenic
1134282903 16:12833533-12833555 CTGCCTTAGCAGAAAGTGCTGGG + Intergenic
1134458821 16:14414387-14414409 CTGCCTGAGCATTAGCAGTTTGG + Intergenic
1134492712 16:14707693-14707715 CTCCCTCAGCAGAAGCGGTGAGG + Intergenic
1134498093 16:14746815-14746837 CTCCCTCAGCAGAAGCGGTGAGG + Intronic
1134586128 16:15412686-15412708 CTGCCTCAGCCCAAGTAGCAGGG + Intronic
1135313800 16:21426329-21426351 CTCCCTCAGCAGAAGCGGTGAGG - Intronic
1135366724 16:21858609-21858631 CTCCCTCAGCAGAAGCGGTGAGG - Intronic
1135445091 16:22512549-22512571 CTCCCTCAGCAGAAGCGGTGAGG + Intronic
1136193813 16:28637088-28637110 CTCCCTCAGCAGAAGCGGTGAGG + Intergenic
1136249240 16:28993059-28993081 CTACCTCAGCCCAAGCAGCGGGG + Intergenic
1136310464 16:29405032-29405054 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1136323912 16:29506820-29506842 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1136368351 16:29820335-29820357 CAGCTGCAGCAGAAGCAGCCCGG + Exonic
1136438597 16:30246803-30246825 CTCCCTCAGCAGAAGCGGTGAGG - Intronic
1138953324 16:61940786-61940808 CTGACTCAACAGCAGCGGCTTGG + Intronic
1139476219 16:67203762-67203784 CAGCTCCAGCAGACGCAGCTTGG - Exonic
1139677343 16:68533286-68533308 CTGCCTCAGCCTGAGTAGCTGGG + Intronic
1139858148 16:69997418-69997440 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1140287061 16:73613840-73613862 CTGCCGCAGCAGCAGGAACTCGG - Intergenic
1141128311 16:81416953-81416975 CGGCAGCAGCAGCAGCAGCTAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141180950 16:81753082-81753104 CATCCTCAGCAGAAGCTGGTGGG - Intronic
1141462762 16:84187469-84187491 GTGCGTCAGCAGTAGCACCTGGG + Intergenic
1141906328 16:87029165-87029187 GAGCCTCAGCAGAAGCTGGTGGG - Intergenic
1141949526 16:87331653-87331675 CTGTCTCTGCAGGGGCAGCTGGG + Intronic
1142357122 16:89606498-89606520 TTGCCTCAGCAAGAGTAGCTGGG + Intergenic
1142618842 17:1152974-1152996 CTGCCTCAGCCCAAGTAGCTGGG - Intronic
1142887685 17:2922989-2923011 CTGCCTCAGCTGGAGTAGCTGGG + Intronic
1142887758 17:2923442-2923464 CTGCCTTAGCTGGAGTAGCTGGG + Intronic
1143062839 17:4217432-4217454 CTGCCTCAGCCCGAGTAGCTGGG - Intronic
1143842616 17:9744990-9745012 CTGCCTCTGCTGCAGGAGCTGGG + Intergenic
1144299311 17:13908772-13908794 CTGCCTCAGCCTGAGTAGCTGGG - Intergenic
1144751312 17:17650289-17650311 CTGCCTCAGCCTCAGAAGCTAGG - Intergenic
1145220882 17:21087495-21087517 CCATCTCAGCAGAAACAGCTTGG - Intergenic
1146095021 17:29921687-29921709 CTGCCTCAGTAGGAGTAGCTGGG + Intronic
1146114755 17:30125081-30125103 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
1146379466 17:32318101-32318123 CTGCCTCAGTCTAAGTAGCTAGG - Intronic
1146410458 17:32579181-32579203 CTGCCTCAGCCTGAGTAGCTGGG + Intronic
1146803882 17:35849706-35849728 CTGCCTTAGCAAAAGCAATTTGG + Intronic
1147166924 17:38598458-38598480 CTGCACAAGCAGAAACAGCTAGG + Intronic
1147468606 17:40634246-40634268 CAGCCTCAGCTGGAGTAGCTGGG + Intronic
1147558549 17:41495184-41495206 CTGCCACGGCAAAAGCAGCTTGG - Intergenic
1147613693 17:41816017-41816039 CAGCCTCCGAAGTAGCAGCTGGG - Intronic
1148216623 17:45836995-45837017 CTCCCTCAGCAGGAGCTGCGGGG - Intergenic
1148602408 17:48904384-48904406 CTGCCTCAGCAGGAGTAGCTGGG + Intergenic
1148640733 17:49185367-49185389 CAGCCTCAGCTGGAGCAGCTGGG - Intergenic
1148911510 17:50945413-50945435 CTGCCTCAGCCTGAGTAGCTAGG + Intergenic
1149005188 17:51797736-51797758 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
1149429072 17:56582366-56582388 CTGCCTCTCCAGAATGAGCTGGG + Intergenic
1149551602 17:57544512-57544534 CTGCCAGGGCAGTAGCAGCTGGG + Intronic
1149812951 17:59695537-59695559 CTGCCTCCTGAGTAGCAGCTAGG - Exonic
1149932450 17:60769580-60769602 CCCCCTCAGTAGGAGCAGCTAGG + Intronic
1150065608 17:62106403-62106425 CAGTCTCTGCAGAAGAAGCTAGG + Intergenic
1150702606 17:67460855-67460877 CTGCCTCAGCCTCAGTAGCTGGG + Intronic
1150816608 17:68396866-68396888 CTCCCTAAGCAGGAGCAGCCAGG + Intronic
1151106081 17:71618656-71618678 CAGCCACAGCTGGAGCAGCTAGG - Intergenic
1151423106 17:74011584-74011606 CTGCCTCCTCAGCAGAAGCTGGG - Intergenic
1151614826 17:75202926-75202948 CTGCCTCAGCCTCAGTAGCTGGG + Intergenic
1152391213 17:80005196-80005218 CAGCCTCCGGAGTAGCAGCTTGG + Intronic
1152495593 17:80669120-80669142 CTGGCTCAGCAGGAGCAGCCAGG + Intronic
1152622244 17:81370858-81370880 CTGCCTCAGCCCGAGTAGCTGGG - Intergenic
1153010245 18:532172-532194 TTGGCACAGCAGAAGCAGCGTGG + Intergenic
1153539101 18:6135161-6135183 CAGCCACAGCTGGAGCAGCTGGG + Intronic
1154119594 18:11640690-11640712 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1154485803 18:14870772-14870794 CTGCCTTAGCAGAAGATACTGGG - Intergenic
1155464111 18:26116553-26116575 CTGCCTCAGCCTAAGTAGCTGGG + Intergenic
1156390061 18:36641838-36641860 CTGCCTCAGCCTCAGTAGCTGGG - Intronic
1156467549 18:37357283-37357305 CAGCCCCAGCTGGAGCAGCTAGG - Intronic
1156507242 18:37605647-37605669 CTGCCTCAGCACCTGTAGCTGGG + Intergenic
1156565461 18:38184104-38184126 CTGCCTCAGCCTGAGTAGCTGGG + Intergenic
1156855064 18:41772293-41772315 ATGCAGCAGCAGTAGCAGCTGGG + Intergenic
1157245531 18:46051109-46051131 CTGCCTCAGCCCAAAAAGCTGGG + Intronic
1157949700 18:52020976-52020998 CTGCCACAGCATATGCAACTTGG + Intergenic
1158071423 18:53475468-53475490 CAGCCACAGCTGGAGCAGCTGGG - Intronic
1158278689 18:55796745-55796767 CTACCTCAACAGAACTAGCTTGG - Intergenic
1158743441 18:60169267-60169289 CTGCCTCAGCCTGAGTAGCTGGG + Intergenic
1159433332 18:68384213-68384235 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
1159987907 18:74866898-74866920 CAGCCTCAGCCGGAGTAGCTGGG - Intronic
1160817866 19:1044572-1044594 CTGCATCTGCAGGAGCCGCTGGG - Exonic
1161002054 19:1915460-1915482 CTGGCTGAGCAGAAGCTCCTGGG + Intronic
1161094420 19:2381313-2381335 CAGGGTCAGCAGAGGCAGCTGGG + Intergenic
1161408525 19:4103374-4103396 CTGCCTCTGAAGAGGCACCTTGG - Intronic
1161509503 19:4662743-4662765 CTGCCTGAGGGGAAACAGCTGGG + Intronic
1161532386 19:4797817-4797839 CAGCCTCCCCAGTAGCAGCTGGG - Exonic
1161677298 19:5659027-5659049 CTGCCTCAGCCCAAGTAGCTGGG - Intronic
1162048827 19:8019671-8019693 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
1162504322 19:11073985-11074007 CTGCCTCAGCCTCAGTAGCTGGG - Intergenic
1163011445 19:14429084-14429106 CTGCCTCCCCAGATGGAGCTGGG - Intergenic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1163185481 19:15636154-15636176 CTGCTTGAGGAGAGGCAGCTTGG - Intronic
1163409930 19:17147796-17147818 CTGCCTCAGCTCGAGTAGCTGGG + Intronic
1163448768 19:17363280-17363302 CAGCCTCCCAAGAAGCAGCTGGG + Intronic
1163589545 19:18184461-18184483 CTGCCTCTGCAGATGCAAATTGG - Intergenic
1163724372 19:18914056-18914078 GGGCCTGAGCAGAAGCTGCTGGG - Intronic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1164241634 19:23394613-23394635 CTGCCTCAGCCCTAGTAGCTGGG - Intronic
1164666482 19:30042267-30042289 CAGCCACAGCTGGAGCAGCTAGG - Intergenic
1164809682 19:31146445-31146467 CTGTCTCAGCAGGGGCAGCTTGG - Intergenic
1165095742 19:33409051-33409073 CTGCCTCTACAGCTGCAGCTGGG + Intronic
1165293047 19:34904796-34904818 CTGCCTGAAAGGAAGCAGCTGGG + Intergenic
1166039684 19:40194243-40194265 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
1166415037 19:42589172-42589194 CTGTCTCAGTAGAAACAGCGGGG - Intronic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1167274676 19:48529693-48529715 CTGCCTCAGCCTGAGTAGCTGGG - Intergenic
1167550950 19:50160593-50160615 CTGCCTCAGCCTGAGTAGCTGGG + Intronic
1167867913 19:52343286-52343308 CTGCCTTAGCCCAAGTAGCTGGG - Intronic
1167884343 19:52488065-52488087 CTGCCTCAGCCTCAGTAGCTGGG + Intronic
1167918003 19:52757899-52757921 CTGCCTCAGCCAGAGTAGCTGGG + Intergenic
1168548362 19:57272632-57272654 CTGCCTCATCCCAAGTAGCTGGG - Intergenic
1168672295 19:58249757-58249779 ATGCCTCAGCAGCAGTTGCTTGG - Intronic
925153336 2:1632587-1632609 CTGCCTCCGCCGCAGCAACTTGG + Exonic
925404600 2:3597801-3597823 CTGCCTCAGCAGCAGTATTTTGG - Intronic
925443121 2:3905518-3905540 TAACCTCAGCACAAGCAGCTGGG - Intergenic
926578478 2:14608805-14608827 CTGCCTCAGCCCAAGTAGGTGGG - Intergenic
926684069 2:15685069-15685091 CTGACTCTGAAGAAGCAGCTGGG - Intergenic
926688145 2:15714365-15714387 CTCCCTCAGCAGAGGCAGCCTGG - Intronic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
927510071 2:23638931-23638953 CTGCCATAGTAGTAGCAGCTGGG - Intronic
927751376 2:25673459-25673481 CTGCCTCAGCCGAGGGGGCTGGG - Exonic
927828438 2:26326883-26326905 TTGCCTCAGCCCAAGTAGCTGGG + Intronic
928048860 2:27968247-27968269 CAGCCACAGCTGAAGCAACTGGG - Intronic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
929456879 2:42072482-42072504 CGGCCTCAGCTGCAGCTGCTGGG + Intergenic
929620773 2:43351725-43351747 CTGCATTTGCAGCAGCAGCTGGG + Intronic
930076651 2:47411219-47411241 CTGCCCCAGCAGGAGTAGCTTGG + Intronic
930269367 2:49238479-49238501 CTGCCTGAGCAGACACAGGTGGG + Intergenic
930442983 2:51432252-51432274 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
930811648 2:55547804-55547826 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
931033530 2:58211331-58211353 CAGCCACAGCTGGAGCAGCTGGG + Intronic
931352841 2:61507456-61507478 CTGCCACAGCCCAAGTAGCTAGG - Intronic
931369799 2:61651432-61651454 CTGCCTCAGCCTGAGCAGCTGGG - Intergenic
931881394 2:66574868-66574890 CAGCCGCAGCAGCAGCAGCAGGG + Intergenic
932468845 2:71940701-71940723 CTGCCTCTTCCCAAGCAGCTCGG - Intergenic
932486004 2:72084765-72084787 CTGCCGCACCAGGAGCAGCAAGG + Intergenic
932821652 2:74906567-74906589 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
933724724 2:85420225-85420247 CTGCCTCAGCCTCAGTAGCTGGG + Intronic
934140833 2:89045905-89045927 AGGCATCAGGAGAAGCAGCTGGG + Intergenic
934222791 2:90100801-90100823 AGGCATCAGGAGAAGCAGCTGGG - Intergenic
935102455 2:100009912-100009934 CTTTCCCAGCAGAAGCAGGTGGG + Intronic
935106607 2:100050784-100050806 CTGCCCCTGCAGATGCAGATGGG + Intronic
936161785 2:110088952-110088974 CTGCCCCAGCTCCAGCAGCTGGG + Intronic
936182878 2:110282402-110282424 CTGCCCCAGCTCCAGCAGCTGGG - Intergenic
936827771 2:116602782-116602804 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
937994641 2:127683948-127683970 CTGCCCCAGGAGAGGCAGCCTGG + Intergenic
939079152 2:137639211-137639233 CAGCCACAGCTGGAGCAGCTGGG - Intronic
939508329 2:143075982-143076004 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
939578068 2:143919516-143919538 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
940228145 2:151421945-151421967 CTGCCTCAGCAGGAGTAGCTGGG + Intronic
940255984 2:151729714-151729736 CTGCCTCAGCTGAACCACTTAGG + Intronic
941818549 2:169823095-169823117 CTGCCTTAGTATCAGCAGCTGGG + Intronic
942327329 2:174787106-174787128 CTGCCTCAGCCTGAGTAGCTGGG + Intergenic
942925398 2:181426094-181426116 CTGCCTCAGAAGAAAGAGTTTGG - Intergenic
943329601 2:186543159-186543181 CTGCCTCCTCCCAAGCAGCTGGG + Intergenic
943485939 2:188481543-188481565 GTCTGTCAGCAGAAGCAGCTTGG + Intronic
944101381 2:196031248-196031270 CAGCCACAGCTGGAGCAGCTGGG + Intronic
944804410 2:203267042-203267064 CTGCCTCAGCCTCAGTAGCTGGG - Intronic
944832278 2:203545038-203545060 CTGCCTCAGCCTCAGTAGCTGGG + Intergenic
945836752 2:214842986-214843008 CTGCCTCAGTCTGAGCAGCTGGG - Intergenic
946132465 2:217617626-217617648 CTGCCTCAGGAGCAGCTGCCTGG + Intronic
946417538 2:219547914-219547936 GCGCCCCAGCAGTAGCAGCTCGG - Exonic
947670714 2:231933839-231933861 CTGGCTCAGCACAGGCAGCCAGG + Intergenic
947875349 2:233464173-233464195 CCGCCTCAGAAGGAGCAGCTGGG + Exonic
947896749 2:233681416-233681438 CTGCCTCAGCCTCAGTAGCTGGG - Intronic
948174519 2:235932601-235932623 CTCACTCAGCAGAGGCTGCTTGG - Intronic
948199752 2:236121054-236121076 CTGCCTCAGCAGAAGCCCCAGGG - Intronic
948310050 2:236978475-236978497 CTGCCTCAGCCTGAGTAGCTGGG + Intergenic
948433164 2:237933619-237933641 CTGCCTCAGCAGGAGTAGCTGGG + Intergenic
948543142 2:238704058-238704080 CTGGCCCAGCAGCTGCAGCTGGG + Intergenic
948635035 2:239329415-239329437 CAGCCTCTGCAGCAGCAGCTTGG + Intronic
948635174 2:239330046-239330068 CAGCCTCTGCAGCAGCAGCTTGG - Intronic
949043321 2:241859199-241859221 CAGCCTCAGGAGGGGCAGCTCGG - Intergenic
1169110637 20:3031026-3031048 TTCCCTCAGCAGCTGCAGCTTGG + Intronic
1169304552 20:4477149-4477171 TTGCCTCAGAAGAAGCAGGTGGG + Intergenic
1169320837 20:4632036-4632058 TAGCCACAGCTGAAGCAGCTGGG - Intergenic
1170582149 20:17707268-17707290 CTGCCTCAGCCTCAGTAGCTGGG - Intronic
1172649051 20:36490307-36490329 CTCCCAAGGCAGAAGCAGCTGGG - Intronic
1172654795 20:36530076-36530098 CTGCCACAGCAGAAGCAGGAAGG - Intergenic
1173033910 20:39390374-39390396 CTGCCTAAGCAGAAGCAGATTGG - Intergenic
1173223550 20:41148073-41148095 CTGCTTCAGCAGAACCCACTAGG - Intronic
1173258487 20:41412304-41412326 CAGCCTCATCAGAAGAATCTGGG - Intronic
1173624574 20:44463004-44463026 CTGCCTCAGCCTTAGTAGCTGGG + Intronic
1175103895 20:56600277-56600299 CTGCCTCAGCTGGAGTAGCTGGG - Intergenic
1175138220 20:56840788-56840810 CTACCTCAGCAGAAGCATGTGGG - Intergenic
1175187474 20:57188751-57188773 CTGCCTCACCAGCAGCAGACTGG + Intronic
1176795525 21:13368697-13368719 CTGCCTTAGCAGAAGATACTGGG + Intergenic
1177266990 21:18798364-18798386 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
1178415898 21:32404916-32404938 CTTCCTCAGCCCAAGTAGCTAGG + Intergenic
1178669918 21:34581305-34581327 CTGCCTAAGCAGAGGCAGTTTGG - Intronic
1179182889 21:39060910-39060932 CTGTCACAGCAGGACCAGCTGGG - Intergenic
1179357584 21:40675081-40675103 GCCCCACAGCAGAAGCAGCTGGG - Intronic
1179718161 21:43300771-43300793 CTGCCTCAGTAGTAGTAGTTGGG + Intergenic
1179781552 21:43704106-43704128 CTGCCTCAGCCTCAGAAGCTGGG - Intergenic
1179941873 21:44645466-44645488 CTGCCTCAGCCTAAGTAGCTGGG + Intronic
1179959328 21:44759330-44759352 GAGCCTCAGCAGAAGGAGCCAGG - Intergenic
1180195737 21:46192403-46192425 CTGCTTGAGCAGGAGCAGCAGGG - Intronic
1181621398 22:24093966-24093988 CTATCTCAGGAGCAGCAGCTTGG + Intronic
1181743779 22:24941780-24941802 CTGCCTCAGCCTGAGTAGCTGGG + Intronic
1181758570 22:25042042-25042064 CTGCCTGTGAAGAACCAGCTGGG - Intronic
1182701627 22:32244641-32244663 CTGCCTCAGCCAAAGTAGCTGGG + Intronic
1183328855 22:37208712-37208734 ATGCCTGCGCAGAAGAAGCTGGG + Intronic
1183916428 22:41124130-41124152 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
1184102330 22:42347407-42347429 CTGCTCCAGCAGATGCAGCCTGG + Intergenic
1184380580 22:44142855-44142877 CTGCGTCAGCAGAAGCAGCAAGG - Intronic
1184381414 22:44147098-44147120 CAGTGTCAGCAGGAGCAGCTGGG + Intronic
1184595029 22:45508682-45508704 CTGCCTCTGCAGAGGCTGCATGG + Intronic
1184713277 22:46265695-46265717 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1184726149 22:46347805-46347827 CTGACCCAGCAGAAGCAGCAGGG - Intronic
1184742060 22:46434321-46434343 CTGAGTCAGCAGCAGCAGCTGGG + Intronic
949819402 3:8099876-8099898 CTGACTCAGAGGCAGCAGCTAGG + Intergenic
949917402 3:8975521-8975543 CTGCCTCAGTGCAAGCAGCGAGG - Intergenic
950042033 3:9925970-9925992 CTGCCTCAGCCTCTGCAGCTGGG + Intronic
950111872 3:10423853-10423875 CTACCTCAGCAGGCGAAGCTAGG - Intronic
950371541 3:12534856-12534878 CTGCCTCAGCCTAAGAAGCTGGG - Intronic
952384039 3:32826323-32826345 CTGCCTCAGCCTCAGTAGCTGGG - Intronic
952420027 3:33122289-33122311 CTGGTTCTGCAGAAGCAGCGGGG - Intronic
952849923 3:37719492-37719514 CTCCCTCTGCACAAGCAACTGGG - Intronic
952877027 3:37954694-37954716 CTGCTTCTGCAGCAGCGGCTTGG + Intronic
953392980 3:42544638-42544660 CTGCCTCTGCAGAAGCAGCCTGG + Intergenic
953393343 3:42547008-42547030 CTGACTCAGCAGAGCCAGGTGGG + Intergenic
953609983 3:44439485-44439507 CTGCCCCAGCATTAGTAGCTGGG + Intergenic
953732094 3:45458572-45458594 CTGCCTCAGCCCAAGTAGCTGGG - Intronic
953996092 3:47521180-47521202 CGGTCTCAGCAGAGGCAGCAGGG + Intergenic
954125231 3:48524242-48524264 GTGACTCATCAGAAACAGCTGGG + Intronic
955109665 3:55935807-55935829 CTTCCTCATTAGAAGCTGCTTGG - Intronic
956308758 3:67855831-67855853 CTGCCCCAGCTGATGCAGTTTGG - Intergenic
956785100 3:72636075-72636097 CTGCCTCAGCCTTAGTAGCTGGG + Intergenic
957759201 3:84533092-84533114 CAGCCACAGCAAGAGCAGCTAGG - Intergenic
958529594 3:95309532-95309554 CAGGCCCTGCAGAAGCAGCTAGG - Intergenic
959894949 3:111594943-111594965 CTGTTTCAGCAGGAGGAGCTGGG + Exonic
959968381 3:112381423-112381445 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
960383686 3:116994150-116994172 CTGGCTCAGCAGCTGCAGTTGGG - Intronic
960618271 3:119615696-119615718 CTGCCTCAGCAGGAGTAGCTGGG - Intronic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
961371372 3:126433921-126433943 TTGGCTCACCAGAGGCAGCTGGG + Intronic
962266678 3:133948942-133948964 CTGCCACAGCAGATGAAGCAAGG - Exonic
963211921 3:142702167-142702189 CTGCCTCAGCCTAAGTAGCTGGG + Intronic
963593020 3:147286658-147286680 CAGCCACAGCTGGAGCAGCTTGG + Intergenic
963693330 3:148533320-148533342 ATACCTCAGCAGAGCCAGCTTGG + Intergenic
963945646 3:151143470-151143492 CTGCCTCTGCAGCAGAAGCTGGG + Intronic
964298206 3:155257613-155257635 CTGTCTCAGCAGACACAGCTAGG - Intergenic
964305242 3:155332663-155332685 CTGGCACAGCAGATGCAACTGGG - Intergenic
965188446 3:165497769-165497791 CTGCCTCACCATTAGCAGTTAGG + Intergenic
965667937 3:171115876-171115898 GGGCATTAGCAGAAGCAGCTGGG + Intronic
966180446 3:177183621-177183643 CTGCCTCAGCCTCCGCAGCTGGG + Intronic
966590181 3:181673916-181673938 CTGCCTCAGCCTAAGTAGCTGGG - Intergenic
967905752 3:194498339-194498361 CTGCCTCAGCCTGAGTAGCTGGG - Exonic
968111831 3:196054607-196054629 CTGCCTCAGCAGAAGTAGCTGGG + Intronic
968558348 4:1261784-1261806 CTGCCTGGGGAGAAGCGGCTTGG + Intergenic
968782273 4:2592202-2592224 CTGCCTCAGCTTGAGTAGCTGGG + Intronic
968967850 4:3778339-3778361 CAGCTGCAGCAGCAGCAGCTGGG + Intergenic
969415374 4:7054263-7054285 GTGGCTGAGCAGCAGCAGCTGGG + Exonic
970455526 4:16219996-16220018 CTGGCAGAGCAGAAGCAGCGAGG - Intronic
970868189 4:20782594-20782616 CAGCCACAGCTGGAGCAGCTGGG + Intronic
972089175 4:35258276-35258298 ATCCCACAGCAGCAGCAGCTTGG + Intergenic
972872112 4:43313001-43313023 TAGCCACAGCTGAAGCAGCTGGG - Intergenic
973032215 4:45359320-45359342 CAGCCTCTGCAGCAGCAGCCTGG - Intergenic
973078626 4:45962185-45962207 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
975321936 4:73018717-73018739 CTACCTCTGCAGAAGGCGCTGGG + Intergenic
976051095 4:81012309-81012331 CAGCCACAGCTGGAGCAGCTAGG - Intergenic
976183578 4:82422228-82422250 CCGCCTCAGCCCAAGTAGCTGGG + Intergenic
976405627 4:84658258-84658280 CAGCCACAGCTGGAGCAGCTTGG + Intergenic
976519407 4:86008707-86008729 CTGCCTCAGCCTGAGTAGCTGGG + Intergenic
977463683 4:97357123-97357145 CAGCCACAGCTGGAGCAGCTGGG + Intronic
978340953 4:107720642-107720664 CTCCCTCAGCAGAGGCTGATTGG + Intergenic
979393284 4:120153620-120153642 CTGCCTCAGGCCAAGTAGCTGGG - Intergenic
979812508 4:125055356-125055378 CCCCATCAGCAGAAGCAGCTAGG + Intergenic
979927364 4:126583669-126583691 CTGGCTGAGCAGAAGCAGAAGGG - Intergenic
979975472 4:127190732-127190754 CTGCAGTAGCAGCAGCAGCTGGG + Intergenic
980335538 4:131468846-131468868 CAGCCACAGCTGAAGCAGCTTGG - Intergenic
980791145 4:137620997-137621019 CTGCCTCACAGGAAGCAGCCTGG + Intergenic
980915965 4:139033557-139033579 CTGCCTCAGCCTAAGCAGCTGGG - Intronic
982121275 4:152145741-152145763 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
982458581 4:155639459-155639481 CTGCCTCAGCTGGAGTAGCTGGG - Intergenic
982475448 4:155844382-155844404 CTGCCGATGCAGAAGCAGGTAGG - Intronic
983460729 4:168023044-168023066 CAGCCACAGCTGGAGCAGCTAGG + Intergenic
984358269 4:178693403-178693425 CTGCCTCAGCCCATGTAGCTGGG + Intergenic
984365519 4:178794308-178794330 CAGCCCCTGCAGAAGCACCTGGG - Intergenic
984442531 4:179791454-179791476 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
985645654 5:1083596-1083618 CAGGCTCATCAGCAGCAGCTGGG + Intronic
986150025 5:5120095-5120117 CTCCCTCTGCAGAACCAGCCTGG - Intergenic
986972849 5:13357165-13357187 CTGCCTCAGCCTGAGTAGCTGGG - Intergenic
987062206 5:14253466-14253488 CTGCCTCAGCCTGAGTAGCTGGG + Intronic
987809719 5:22819160-22819182 CTGCGTCAGCAATAGCAGCAGGG - Intronic
988361837 5:30246373-30246395 CTGCCTCAGCCGGAGTAGCTGGG + Intergenic
988426874 5:31074442-31074464 CGGCCACAGCTGGAGCAGCTGGG + Intergenic
988472281 5:31550676-31550698 CTGCCTTAGCAGGAGAAGCTGGG + Intronic
988620272 5:32816010-32816032 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
988808893 5:34765915-34765937 CAGCCACAGCTGGAGCAGCTGGG - Intronic
989341976 5:40386378-40386400 CAGCAACAGCAGCAGCAGCTGGG - Intergenic
989598002 5:43175001-43175023 CAGCCTCAGCAGCATCTGCTTGG - Exonic
989996208 5:50835425-50835447 CTGCCTCAGCCCCAGGAGCTGGG - Intronic
990291676 5:54358226-54358248 CTGCCTCAGCCTGAGTAGCTGGG - Intergenic
990329569 5:54712753-54712775 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
990407338 5:55504251-55504273 CTGCCTCAGCCTAAGTTGCTGGG - Intronic
990950009 5:61289403-61289425 TTGCCTCAGCAGAGAGAGCTTGG - Intergenic
991073307 5:62510846-62510868 CTGCCTCAGCAGGAGTAGCTGGG + Intronic
991340342 5:65601864-65601886 CAGCCACAGCTGGAGCAGCTGGG + Intronic
991616241 5:68499693-68499715 CTGCCTCAGGAGCAGTAGCTGGG - Intergenic
993879110 5:93342305-93342327 CTGCATCAGCCTAAGTAGCTGGG - Intergenic
994542817 5:101121623-101121645 CAGCCCCAGCTGGAGCAGCTAGG + Intergenic
994610937 5:102038296-102038318 CTGCCTCAGCCTCAGTAGCTGGG - Intergenic
995392434 5:111653579-111653601 CAGCCATAGCTGAAGCAGCTGGG + Intergenic
997056688 5:130452255-130452277 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
997549656 5:134740707-134740729 CTGCCTCAGCCAGAGTAGCTGGG + Intronic
998465358 5:142339553-142339575 CTGCCTCAGCCTAAGTAGCTGGG + Intergenic
998576683 5:143324420-143324442 CAGCCACAGCTGGAGCAGCTGGG + Intronic
998871525 5:146557345-146557367 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
998889328 5:146729638-146729660 CAGCCACAGCTGGAGCAGCTGGG - Intronic
999311242 5:150553570-150553592 CGGCCTCCCCAGGAGCAGCTGGG - Exonic
1001051209 5:168415955-168415977 CTGCCTCAGTGGAAGCAGTCGGG + Intronic
1001707446 5:173751642-173751664 CCGCCACAGCAGAACCATCTAGG + Intergenic
1001830299 5:174781318-174781340 CTGCCTCAGCCCGAGTAGCTGGG + Intergenic
1002000769 5:176195233-176195255 CTGCCTCAGGAGAAATGGCTGGG - Intergenic
1002042539 5:176525128-176525150 CTGCCTCAGCCCGAGTAGCTGGG - Intergenic
1002197338 5:177508599-177508621 TTGGCTCAGCACAAGCTGCTCGG + Intronic
1002253567 5:177943737-177943759 CTGCCTCAGGAGAAATGGCTGGG + Intergenic
1002322070 5:178382224-178382246 CAGCCGCAGCAGCTGCAGCTGGG - Intronic
1002588224 5:180266698-180266720 CTGCCTCAGCCCAAGTAGCTGGG + Intronic
1002724595 5:181286271-181286293 CTGCCTTAGCAGAAGATACTGGG - Intergenic
1003441431 6:6146191-6146213 GGGCCTCAGCAAAGGCAGCTGGG - Intronic
1003812767 6:9803451-9803473 CTGACTCAGCCCAAGTAGCTGGG + Intronic
1004144121 6:13048645-13048667 CTGCCTCAGCCTCAGTAGCTGGG + Intronic
1004330583 6:14717024-14717046 CTGCAGCAGCTGAAGCAGCCAGG + Intergenic
1004404935 6:15324064-15324086 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
1005172304 6:23002045-23002067 CTGCCCAAGGAGAAGCAGATAGG + Intergenic
1005329781 6:24738718-24738740 CTGCCTCAACAGCATAAGCTTGG + Intergenic
1005972721 6:30773972-30773994 CTGCCTCAGCCTGAGCAGCTAGG - Intergenic
1006328970 6:33375814-33375836 CTGCCTCAGCCTCAGTAGCTGGG + Intergenic
1006656554 6:35598853-35598875 GTGCCTCAGCCCAAGTAGCTGGG - Intronic
1007131280 6:39476509-39476531 CTGCACCATCAGAAGGAGCTGGG + Intronic
1007517290 6:42422813-42422835 CAGCCTCAGCTCAAGCAGCCTGG + Intronic
1008457931 6:51733422-51733444 CTGCCTCAGCCTCAGTAGCTGGG - Intronic
1008857770 6:56112513-56112535 CTTCCCCAGCAGAGGCAGCATGG + Intronic
1009316111 6:62223309-62223331 CAGCCACAGCTGGAGCAGCTAGG + Intronic
1010611848 6:77962961-77962983 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
1011321840 6:86104297-86104319 CTGCTTCAGCAGACTCAGATGGG + Intergenic
1011883395 6:92059821-92059843 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
1013236533 6:108201616-108201638 CTGCCTCAGCCTGAGTAGCTGGG - Intergenic
1014010249 6:116467321-116467343 CAGCCCCAGCAGCAGCAGCCAGG + Intergenic
1014934920 6:127375941-127375963 CTGCCTCAGCCCAAGTAACTGGG + Intergenic
1015935307 6:138402661-138402683 CTGCCTCAGAAGAAGAGGCAGGG - Intergenic
1015941485 6:138456994-138457016 CTGCCTCAGCCTGAGTAGCTGGG + Intronic
1015969634 6:138730953-138730975 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1016271893 6:142300171-142300193 CTGCCTCAGAAAAGGTAGCTGGG + Intergenic
1016568767 6:145489739-145489761 CAGCCTCAGCAGCATCTGCTTGG + Intergenic
1018390086 6:163335508-163335530 CTGCCACACCACAGGCAGCTCGG + Intergenic
1018491087 6:164294268-164294290 ATGCCTCAGCAGACTCAGCTGGG + Intergenic
1019178638 6:170174164-170174186 CAGAAGCAGCAGAAGCAGCTAGG - Intergenic
1019388373 7:771319-771341 CTGCCTCAGCAGTGGCACCCGGG - Intronic
1019661542 7:2226872-2226894 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
1019921599 7:4166846-4166868 CTACCTCAGCAGAGAGAGCTGGG + Intronic
1020143227 7:5623745-5623767 CAGCCTCAGAAGGATCAGCTGGG + Intronic
1020423431 7:8036062-8036084 CAGCTACAGCAGAAGCAGATGGG - Intronic
1021568685 7:22041299-22041321 AAGCCACAGAAGAAGCAGCTCGG - Intergenic
1022285105 7:28949290-28949312 GGGGCACAGCAGAAGCAGCTGGG + Intergenic
1023695434 7:42841121-42841143 CCGTCTCAGCAGCACCAGCTGGG + Intergenic
1023887815 7:44373692-44373714 CAGCCTCAGCTGTAGCAGGTAGG - Intergenic
1024563841 7:50665682-50665704 CTGCTTCTGTAGAAGCACCTGGG + Intronic
1024655600 7:51449027-51449049 CTGCCTCAGCCCAAGTAGCTGGG + Intergenic
1025036310 7:55594397-55594419 CTGCCTCAGCTAGAGCTGCTGGG - Intergenic
1025267511 7:57476073-57476095 CTGCCTTAGCCCAAGTAGCTGGG + Intergenic
1025704847 7:63853906-63853928 CTGCCTCAGCAGGAGTAGCTGGG - Intergenic
1025966192 7:66274250-66274272 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
1026922304 7:74164952-74164974 CTGCCTCATCCCAAGTAGCTGGG - Intergenic
1027369553 7:77494064-77494086 CTGCCACGGCTGGAGCAGCTGGG - Intergenic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1029241671 7:99167563-99167585 CTGCCTCAGCCTAAGTAGCTGGG + Intergenic
1029680401 7:102104777-102104799 CTGCCTCAGCCTAAGTAGCTGGG - Intronic
1029999974 7:105049329-105049351 CCGCCTCAGCTCAAGTAGCTGGG - Intronic
1031723956 7:125212791-125212813 CTGCATCAATAGAAGGAGCTTGG + Intergenic
1032179231 7:129661123-129661145 CAGCCACAGCTGGAGCAGCTGGG + Intronic
1032264015 7:130358106-130358128 CTGCCTCAGCTTAAGTAGATGGG + Intronic
1032465816 7:132144133-132144155 CTGCCTCAGAAGAATGATCTGGG + Intronic
1032827765 7:135589055-135589077 TTGCCTCAGCCTGAGCAGCTAGG - Intronic
1033579363 7:142717693-142717715 CTGCCACCGCAGAAGCACTTAGG + Intergenic
1033665785 7:143439120-143439142 CATCCTCAGCAGCAGCATCTGGG - Intergenic
1034058297 7:148059473-148059495 CTGCCTCAGCCAGAGTAGCTGGG - Intronic
1034282669 7:149864781-149864803 CTCCCACAGCAGAAGCAGTGAGG + Exonic
1034903001 7:154919299-154919321 CTGCCTCAGCCTGAGTAGCTGGG - Intergenic
1034941342 7:155232308-155232330 CCTCCTCACCAGAAGCACCTGGG - Intergenic
1035049422 7:155990126-155990148 CTGGCCCTGGAGAAGCAGCTGGG + Intergenic
1035127482 7:156619016-156619038 CGGCCTCCGCAGCAGCAGCTGGG + Intergenic
1035297474 7:157875663-157875685 CTGCAGCAGCAGCAGCACCTTGG + Intronic
1036515397 8:9439066-9439088 CTGCCTGAGATGATGCAGCTGGG + Intergenic
1037985706 8:23289276-23289298 CTGGCTGAGCAGCTGCAGCTAGG - Intronic
1038152596 8:24956135-24956157 CTGGCGCAGCACCAGCAGCTCGG + Exonic
1038296876 8:26300736-26300758 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
1038439527 8:27561667-27561689 CTGCCTCTCCAAAGGCAGCTGGG + Intergenic
1038796060 8:30710602-30710624 CTGCCTCAGCACAAGTAGCTGGG - Intronic
1039515292 8:38127628-38127650 CTGCCTCAGCCTGAGTAGCTGGG - Intronic
1039603292 8:38860047-38860069 CTGCCTCAGCCTGAGTAGCTGGG + Intergenic
1040463785 8:47675698-47675720 ATGCCTCAGCCTAAGTAGCTGGG - Intronic
1041073737 8:54150177-54150199 CTGCCTCAGCCCGAGTAGCTGGG + Intergenic
1041370271 8:57152324-57152346 CTGCCTCAGCCTCAGTAGCTGGG + Intergenic
1041693290 8:60711369-60711391 CAGCCTCATCAGATACAGCTTGG + Intronic
1041746331 8:61212398-61212420 ATGCCTCAGCAGATGCAGCGGGG + Intronic
1042751543 8:72163050-72163072 CTGCCTTAGCAGCCCCAGCTAGG - Intergenic
1043264112 8:78240956-78240978 CTGCCTCAGCCTGAGTAGCTGGG + Intergenic
1043485869 8:80698744-80698766 CAGCATCAGCAGAGGCAGCCCGG + Intronic
1044495188 8:92869323-92869345 CTGCCTCAGCCCGAGTAGCTGGG - Intergenic
1045094539 8:98784307-98784329 GTGCCTCAGCAGTAGGTGCTGGG + Intronic
1045675847 8:104607482-104607504 CTGCCACAGCTGATGCAGCTGGG - Intronic
1047323200 8:123808893-123808915 GTGCCACAACAGAAGCAGATTGG + Exonic
1047836914 8:128703804-128703826 CTGCAGCAGCAGCAGCAACTTGG - Intergenic
1049002236 8:139833449-139833471 TTGCCAGAGCAGAAGAAGCTGGG - Intronic
1049194584 8:141308338-141308360 CTGCGTCAGCGGAAGCGGCGCGG - Intergenic
1049647758 8:143743348-143743370 CTGCCTCAGCCTGAGTAGCTGGG + Intergenic
1049660483 8:143817624-143817646 CTGCCACAGCAGCGGCAGGTGGG + Exonic
1049700367 8:144008488-144008510 CTGACTCAGCAAAAGCAAGTGGG + Intronic
1049708843 8:144054776-144054798 CTGCCCCAGCAGAGGCAGGCGGG + Intronic
1049823871 8:144654704-144654726 CTGGGTCTGCAGCAGCAGCTTGG - Intergenic
1050216792 9:3335004-3335026 CTGCCTCAGCTTCAGTAGCTGGG - Intronic
1050908319 9:11034209-11034231 CTGCCTCAGCATGAGTAGCTGGG + Intergenic
1050929060 9:11301294-11301316 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1051015826 9:12474842-12474864 CGGCCACAGCTGGAGCAGCTGGG - Intergenic
1051655088 9:19372748-19372770 CTGCCTCAGCCTGAGTAGCTGGG - Exonic
1051902689 9:22059919-22059941 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1051946201 9:22572874-22572896 CAGCCACAGCTGCAGCAGCTGGG - Intergenic
1052332427 9:27283356-27283378 CTGCCTCAGCCTGAGTAGCTAGG + Intergenic
1053221580 9:36317377-36317399 CTGCCTCAGCCTGAGTAGCTGGG + Intergenic
1053279453 9:36808388-36808410 CAGCCCCAGCAGAACCAGATGGG - Intergenic
1053371317 9:37564088-37564110 CTGCTGCAGCTGAAGCAGCTGGG - Intronic
1053886732 9:42649647-42649669 CTGCCTTAGCAGAAGATACTGGG - Intergenic
1054225751 9:62457097-62457119 CTGCCTTAGCAGAAGATACTGGG - Intergenic
1054928622 9:70613681-70613703 CTGCCTGTGGAGAAGAAGCTTGG + Intronic
1055383360 9:75733383-75733405 CTGCCTCAGCACAAAGTGCTGGG + Intergenic
1056129241 9:83567242-83567264 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1056204943 9:84310771-84310793 CTTCCTCAGAAGCTGCAGCTTGG - Intronic
1056534092 9:87512754-87512776 CTGCCTCAGAGTAAGTAGCTGGG + Intronic
1056616400 9:88170854-88170876 CTGCCTCAGCTTCAGCAGCTTGG + Intergenic
1056924407 9:90820558-90820580 CAGCCACAGCTGGAGCAGCTGGG + Intronic
1057287102 9:93765533-93765555 CTGCCTCAGTAGCAGCAGGCAGG - Intergenic
1057407066 9:94782075-94782097 CTGCCTCAGCCCAAGTAGCTGGG - Intronic
1057642220 9:96835571-96835593 CTGTTTCAGCTGAAGCAGCTAGG - Intronic
1058174508 9:101722131-101722153 CAGCCACAGCTGGAGCAGCTGGG - Intronic
1058510425 9:105712028-105712050 CTGCCTCAGCCTGAGTAGCTGGG + Intronic
1059279534 9:113120569-113120591 CTGCATCATCAGAACCACCTGGG + Intergenic
1059374363 9:113870778-113870800 TTGCCTCAGCAGAAGCCTTTGGG - Intergenic
1059587272 9:115619812-115619834 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1059792947 9:117660410-117660432 CTGCCTCCACAGAGGCAGCATGG - Intergenic
1059875269 9:118627821-118627843 CTGAGTCAGGAGCAGCAGCTGGG - Intergenic
1060496859 9:124125598-124125620 CTGGCTCTTCAGGAGCAGCTTGG + Intergenic
1060504119 9:124185525-124185547 CAGCCACAGCAGCAGCACCTGGG + Intergenic
1061155803 9:128860676-128860698 CTGCCTCAGCCTAAGTAACTGGG + Intronic
1061825742 9:133257184-133257206 CAGCCTCTGGAGAAGGAGCTGGG + Intronic
1062434873 9:136542504-136542526 CTCCCTCTGCAGAAGCCGCACGG - Intronic
1062525710 9:136977322-136977344 CTGCCCCAGCTGAGGCAGCGTGG - Intergenic
1062601506 9:137320499-137320521 TTGCCACAGCAGGGGCAGCTTGG + Intronic
1062614402 9:137389482-137389504 CTTTCCCAGCAGAGGCAGCTTGG - Intronic
1185642005 X:1593568-1593590 CTCCCGCAGCTGAAGCAGCCGGG + Exonic
1186163898 X:6806437-6806459 CCACCTCAGCCCAAGCAGCTGGG + Intergenic
1186748955 X:12601850-12601872 CAACTTCAGGAGAAGCAGCTTGG - Intronic
1186855228 X:13619905-13619927 TTGCCTCATGAGAAACAGCTTGG - Intronic
1187446931 X:19368671-19368693 CTGCCCCTGCAGAAGTAGCAGGG - Intronic
1187859092 X:23664732-23664754 CTCCCTCAGCAGAAGGAGGCTGG + Intronic
1187940797 X:24379032-24379054 CAGCCTCAGCTGGAGTAGCTGGG + Intergenic
1188325549 X:28797083-28797105 CAGCCACAGCTGGAGCAGCTGGG + Intronic
1190032073 X:46983515-46983537 TAGCCTCAGCAAAAGTAGCTGGG + Intronic
1190115993 X:47626692-47626714 AGGCCTCAGCAGCAGGAGCTGGG + Intronic
1191188556 X:57640112-57640134 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
1191713133 X:64174156-64174178 CAGCATCAGCAGAAGCAAGTTGG - Intergenic
1192278932 X:69663334-69663356 TAGCCACAGCTGAAGCAGCTGGG - Intronic
1193635972 X:83949117-83949139 CCTTCTCAGCAGGAGCAGCTAGG + Intergenic
1194729732 X:97439455-97439477 CTGCCTCAGCCCAAGTAGCTGGG - Intronic
1195210107 X:102646271-102646293 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1195838811 X:109149941-109149963 CAGCTTGAGCTGAAGCAGCTGGG - Intergenic
1196169770 X:112574718-112574740 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
1196512803 X:116532259-116532281 CTGCTGGAGCTGAAGCAGCTAGG + Intergenic
1197408330 X:126083830-126083852 TTGACTCAGAAGCAGCAGCTCGG - Intergenic
1197547074 X:127838497-127838519 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1199113300 X:143959576-143959598 CAGCCACAGCTGAAGCAGCTGGG + Intergenic
1199185500 X:144910793-144910815 CAGCTTGAGCTGAAGCAGCTGGG + Intergenic
1199600806 X:149540183-149540205 CAGCCACAGGAGAAGCAGGTCGG - Intergenic
1200066679 X:153507323-153507345 CTGCCTCCTCAGCACCAGCTGGG - Intronic
1200134394 X:153867855-153867877 CTGCGTCAGCAGGTGCAGGTCGG + Exonic
1200167264 X:154045364-154045386 CTGCCACAGGGGAAGCAGCAGGG + Intronic
1200563806 Y:4739365-4739387 CTGCCTCAGCCTGAGTAGCTGGG + Intergenic
1201452233 Y:14129070-14129092 CAGCCACAGCTGGAGCAGCTAGG - Intergenic