ID: 900963879

View in Genome Browser
Species Human (GRCh38)
Location 1:5944222-5944244
Sequence GCTTACAGCTTCCACCACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900963874_900963879 9 Left 900963874 1:5944190-5944212 CCCATCGCACCAGCCAGCCTGTT 0: 1
1: 0
2: 0
3: 7
4: 93
Right 900963879 1:5944222-5944244 GCTTACAGCTTCCACCACGCAGG 0: 1
1: 0
2: 0
3: 5
4: 95
900963877_900963879 -4 Left 900963877 1:5944203-5944225 CCAGCCTGTTTTCAGCTGTGCTT 0: 1
1: 0
2: 3
3: 18
4: 270
Right 900963879 1:5944222-5944244 GCTTACAGCTTCCACCACGCAGG 0: 1
1: 0
2: 0
3: 5
4: 95
900963876_900963879 0 Left 900963876 1:5944199-5944221 CCAGCCAGCCTGTTTTCAGCTGT 0: 1
1: 0
2: 2
3: 34
4: 230
Right 900963879 1:5944222-5944244 GCTTACAGCTTCCACCACGCAGG 0: 1
1: 0
2: 0
3: 5
4: 95
900963878_900963879 -8 Left 900963878 1:5944207-5944229 CCTGTTTTCAGCTGTGCTTACAG 0: 1
1: 0
2: 0
3: 9
4: 182
Right 900963879 1:5944222-5944244 GCTTACAGCTTCCACCACGCAGG 0: 1
1: 0
2: 0
3: 5
4: 95
900963872_900963879 28 Left 900963872 1:5944171-5944193 CCGGGGAAGCTCCGTGGGGCCCA 0: 1
1: 0
2: 2
3: 15
4: 206
Right 900963879 1:5944222-5944244 GCTTACAGCTTCCACCACGCAGG 0: 1
1: 0
2: 0
3: 5
4: 95
900963875_900963879 8 Left 900963875 1:5944191-5944213 CCATCGCACCAGCCAGCCTGTTT 0: 1
1: 0
2: 1
3: 15
4: 161
Right 900963879 1:5944222-5944244 GCTTACAGCTTCCACCACGCAGG 0: 1
1: 0
2: 0
3: 5
4: 95
900963873_900963879 17 Left 900963873 1:5944182-5944204 CCGTGGGGCCCATCGCACCAGCC 0: 1
1: 0
2: 0
3: 13
4: 167
Right 900963879 1:5944222-5944244 GCTTACAGCTTCCACCACGCAGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900963879 Original CRISPR GCTTACAGCTTCCACCACGC AGG Intronic
900788414 1:4664271-4664293 GAATACAGCATCCACCAGGCTGG + Intronic
900963879 1:5944222-5944244 GCTTACAGCTTCCACCACGCAGG + Intronic
901469261 1:9444278-9444300 GCTTACAGCTCCCTCCGGGCAGG - Intergenic
905207198 1:36349742-36349764 CCTTACACCTTACACCACACTGG + Intronic
911132190 1:94400265-94400287 GGTTGCAGCTGCCACCAAGCTGG - Intergenic
916595202 1:166236307-166236329 CCTTACTGCTGCCACCACGGGGG - Intergenic
1066063508 10:31745129-31745151 GATTACAGCTCCCACCTCACAGG + Intergenic
1075477114 10:122745528-122745550 TCTGTCAGCTTCCACCACCCCGG + Intergenic
1076475891 10:130751250-130751272 CCTCTCAGCTTCCACCACGTGGG - Intergenic
1083303593 11:61751714-61751736 GATTACAGGCGCCACCACGCTGG - Intergenic
1083826148 11:65205177-65205199 GCTCACAGCTTCCAAGACGGAGG - Intronic
1084734365 11:71094807-71094829 GTTTACAGCTCCCACCACCTGGG + Intronic
1085397652 11:76215024-76215046 GCGTACTGCTTCCACCACCAGGG + Intergenic
1088567117 11:111184057-111184079 GCTTACAGCTTGCACTCTGCAGG - Intergenic
1089099929 11:115954100-115954122 GGATTCAGATTCCACCACGCAGG + Intergenic
1099366244 12:81767981-81768003 GCCTACAGCTTCTCCCATGCTGG + Intergenic
1099898753 12:88681521-88681543 GCTTACAGCTTCCACCCTCTGGG - Intergenic
1105006671 12:132725223-132725245 CCTCACAGCTGCCACCACGCTGG + Intergenic
1109692738 13:65914230-65914252 GCCTACATCTTTCTCCACGCTGG + Intergenic
1113358882 13:109610134-109610156 GCCACCAGCTTCCACGACGCTGG - Intergenic
1113729928 13:112634079-112634101 GCTGACAGCTTACAGCACTCAGG + Intergenic
1114815690 14:25955225-25955247 TCTTACAGCTGCAACCACTCAGG + Intergenic
1116258844 14:42595312-42595334 CCTTACAGCTTCTAGCACGCAGG - Intergenic
1123914691 15:25012181-25012203 GCTCACAGCCTCCACCTCCCAGG + Intergenic
1128706711 15:69842192-69842214 GCTTTCAGCTTCCAGCACTGTGG + Intergenic
1129785886 15:78309780-78309802 GCTTACAGCCTCCTCCTGGCAGG - Intergenic
1132018179 15:98337579-98337601 GCCTACACCTTCCACCACTGGGG + Intergenic
1132046242 15:98564969-98564991 GCTTACAACCTCCACCTCCCTGG - Intergenic
1132726065 16:1338859-1338881 GCTCACAGCTCTCAGCACGCTGG - Intronic
1134445470 16:14327904-14327926 GCTCACAGCTTCCAGCACTTTGG - Intergenic
1135688990 16:24521220-24521242 AGTTACAGCTTCAGCCACGCAGG - Intergenic
1136180360 16:28547676-28547698 GATTACAGGTGCCACCATGCTGG - Intergenic
1136346570 16:29679640-29679662 GCATACAGCTCCCTCCAGGCAGG - Intronic
1141634714 16:85308035-85308057 GTGGACAGCTTCCACCAGGCAGG + Intergenic
1144714760 17:17426193-17426215 GATTACAGGCACCACCACGCTGG - Intergenic
1147935009 17:44006249-44006271 TCTTTCACCTTCCCCCACGCCGG + Intronic
1148495482 17:48051216-48051238 CCTCACAGCTTCCCCCACTCCGG + Exonic
1148839485 17:50485602-50485624 GCTTCCAGCCTCTACCATGCAGG + Exonic
1155412385 18:25561037-25561059 TCTTACAGCTTTCACCTCTCTGG + Intergenic
1155803981 18:30142890-30142912 GCTTACATCTTCCCCCTGGCTGG + Intergenic
1159944940 18:74437458-74437480 TCCTACAGCTTCCCCCACGCTGG + Intronic
1161059131 19:2206071-2206093 ACTTGCAGCTTCCACCTCCCAGG + Intronic
1161440336 19:4287975-4287997 GCTCACAACTTCCACCTCCCTGG + Intronic
1163146100 19:15380077-15380099 GTTTCCAGCTTCGGCCACGCGGG + Exonic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
926453414 2:13035599-13035621 GCCTACATCTTTCTCCACGCTGG - Intergenic
926986186 2:18626907-18626929 ACTCACAGATTCCACCATGCAGG - Intergenic
934091240 2:88552498-88552520 GCTTTCAGCTTCCACTGCCCTGG + Intergenic
934907873 2:98221559-98221581 GCTGCCTGCTTCCACCACGTAGG - Intronic
935710176 2:105891619-105891641 GCTTACAACTTCCACCTCCCAGG + Intronic
936016171 2:108960556-108960578 GACAACAACTTCCACCACGCTGG + Intronic
937142138 2:119611075-119611097 CCTGTCAGCTTCCACCACCCAGG + Intronic
942248300 2:174026629-174026651 GAATAAAGCTTCCACCAGGCTGG - Intergenic
945137283 2:206642148-206642170 GCTTCCCGCTCCCACCTCGCGGG - Intergenic
1170914424 20:20609069-20609091 GCTTACAGCCTCAACCTCCCGGG + Intronic
1177353297 21:19973688-19973710 TCTTACAGCTTCCATCAACCAGG + Intergenic
1181270516 22:21655923-21655945 GCTTACAGCTCCCAGCACTTTGG - Intronic
1184257734 22:43296661-43296683 CCTTCCAGCCTCAACCACGCCGG - Intronic
950368656 3:12508121-12508143 GCCTACAGCTGCCACCTCCCAGG - Intronic
951055818 3:18145372-18145394 GCTTACTTCTCCCACCATGCTGG + Intronic
951057302 3:18162479-18162501 GATTACAGCTTCTACCAAGGTGG + Intronic
959525122 3:107368063-107368085 GCTCATAGCTTGCACCAAGCTGG + Intergenic
966949958 3:184807444-184807466 GATTGCAGGTGCCACCACGCCGG + Intergenic
979844391 4:125490127-125490149 GCTCACAGCTGCCACCATTCTGG - Exonic
980187751 4:129483187-129483209 GCCTGCAGCAACCACCACGCTGG - Intergenic
985999638 5:3620367-3620389 GCTTTCACCTTCCAACACGGTGG - Intergenic
986710760 5:10486529-10486551 TCTTCCAGCTTCCACGACTCAGG - Intergenic
988346136 5:30040346-30040368 GCTTACAGCTTAAAACAGGCTGG - Intergenic
994941982 5:106335658-106335680 GATTACAGGTGCCACCATGCTGG - Intergenic
995269236 5:110202580-110202602 GCTTTCAGCTTCCTCCACTTTGG + Intergenic
995495726 5:112740599-112740621 ACTTGCAGCTTCAACCTCGCAGG + Intronic
1001045184 5:168365911-168365933 GCTTCCAGCCTCCACAACTCGGG - Intronic
1005478554 6:26233421-26233443 GCTTACAACTTCCGCCTCCCGGG + Intergenic
1005922006 6:30410142-30410164 GCTTGCTCCTTCCACCACGTGGG - Intergenic
1006687809 6:35852040-35852062 GCTTTCAGCTTTCACCAGCCAGG - Intronic
1008483015 6:52006310-52006332 GATTACAGGCACCACCACGCTGG + Intronic
1013975512 6:116073920-116073942 GCTCACAGCTTCCTTCACCCTGG - Intergenic
1017943802 6:159077342-159077364 GCTTCCAGCTGCCAGCACGGTGG + Intergenic
1019451764 7:1102446-1102468 GCTCACAGCTCCGGCCACGCTGG + Intronic
1019689254 7:2401167-2401189 GCTTCCAGCCTCCACCTCTCAGG + Intergenic
1024329217 7:48139737-48139759 GCTTACATCTTCCTCCTGGCTGG + Intergenic
1024971467 7:55075277-55075299 GCCTCCAGCTTCCTCCACACCGG + Intronic
1026623098 7:71968566-71968588 GATTACAGGTTTCACCATGCTGG + Intronic
1029600746 7:101562073-101562095 GCTTCCACCTTGCACCACGGGGG - Intergenic
1032595582 7:133236400-133236422 CCTTGCAGCTTCCACCTCCCAGG + Intergenic
1033619695 7:143051176-143051198 GCTTACACTTTGCACCACGGCGG + Intergenic
1040552534 8:48449630-48449652 GCTTCCACCTTCCACCCTGCTGG + Intergenic
1041135558 8:54754166-54754188 GCCTACACCTTCCAACATGCAGG - Intergenic
1041394406 8:57376505-57376527 GCTGACAGCTTCCAACATGCAGG - Intergenic
1043284390 8:78511607-78511629 GCTGACAGCTCCCAGCACACAGG + Intergenic
1043375651 8:79646622-79646644 GCTCTCAGCTTCAGCCACGCTGG - Intronic
1044271352 8:90248058-90248080 GGCTACAGCTTCCTCCAAGCTGG - Intergenic
1046029123 8:108762267-108762289 GATTCCAGCTTCCAACATGCTGG + Intronic
1047630172 8:126698326-126698348 GCTGTCAGCCACCACCACGCTGG - Intergenic
1049845514 8:144798992-144799014 GGCTACAGCCTCCACCAGGCCGG - Intronic
1056242152 9:84658620-84658642 GCTCACTGCTTCCACCTCCCAGG + Intergenic
1059119174 9:111626826-111626848 GCTAACAGCTGCCACCAACCTGG + Intergenic
1059994144 9:119892864-119892886 TCTGACAGCTTCCACCTCTCTGG + Intergenic
1062154660 9:135040048-135040070 TCTGTCAGCCTCCACCACGCAGG + Intergenic
1186505232 X:10086346-10086368 TCTCACAGCTTCCACCACCACGG + Intronic
1192672390 X:73159267-73159289 GCTTACCTCTTCCTCCAGGCTGG + Intergenic