ID: 900965063

View in Genome Browser
Species Human (GRCh38)
Location 1:5952141-5952163
Sequence CTGTGACACGGGCAGGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900965057_900965063 -8 Left 900965057 1:5952126-5952148 CCAGAACACAATGACCTGTGACA 0: 1
1: 0
2: 0
3: 9
4: 121
Right 900965063 1:5952141-5952163 CTGTGACACGGGCAGGCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900965063 Original CRISPR CTGTGACACGGGCAGGCCGA GGG Intronic
900965063 1:5952141-5952163 CTGTGACACGGGCAGGCCGAGGG + Intronic
904626943 1:31811722-31811744 CTGTGACAGGGACAGGCGGGTGG - Intronic
905733277 1:40310786-40310808 CTGTCAGACAGGCAGGCAGATGG + Intronic
912467037 1:109881451-109881473 CTGTGACTCGGGCAGGTGGCAGG - Intergenic
916701664 1:167302102-167302124 CTGTCACCCAGGCAGGCCGGAGG + Intronic
920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG + Intronic
924939876 1:248805633-248805655 TTGTGGCAGGGGCAGGCCAAGGG + Intergenic
1064098876 10:12446082-12446104 CTGTAACACTAGCAGGCTGAAGG - Intronic
1069646251 10:70000251-70000273 CTGAGAAACGGGCAGGTCAATGG + Intergenic
1070831293 10:79419566-79419588 ATGTGAGAGGGGCAGGCCAAGGG + Intronic
1076051599 10:127337996-127338018 CTGTGACATGGCCAGGGCGTGGG + Intronic
1076343718 10:129766655-129766677 CTGTGCCAGGGGCAGGCTGTTGG - Intronic
1083292140 11:61696232-61696254 CTGAGGCACAGCCAGGCCGAGGG - Intronic
1084033754 11:66495607-66495629 CTGTGAGAGGGGCAGGCAGGTGG - Intronic
1089711057 11:120315067-120315089 CTTTGACACTGCCAAGCCGAAGG - Intronic
1090477541 11:127037212-127037234 CTGTGACACAGGCAGGAGGCTGG - Intergenic
1093679203 12:21981583-21981605 CTGTGAAAAGTGCAGGCCAAAGG - Intergenic
1096195467 12:49646595-49646617 CTGGGAGACGGGCATGCAGAGGG + Intronic
1096385607 12:51193023-51193045 CTGTGACACAGGCAGGCGAGAGG + Intronic
1099601494 12:84745092-84745114 ATGTGTCACAGCCAGGCCGAAGG + Intergenic
1104966192 12:132509730-132509752 CAGTGACACGGGCTGGCCCACGG - Intronic
1111442426 13:88297436-88297458 TTGTGACACGGGCATGCTAAAGG + Intergenic
1112157718 13:96835586-96835608 GTGTCACAGGGGCAGGCAGAAGG - Exonic
1117889315 14:60400813-60400835 CTTTGACACGGGAATGCTGAAGG - Intronic
1122153771 14:99738367-99738389 CAGCGACACAGGCAGGCAGAAGG + Intronic
1131462127 15:92624827-92624849 CTGTGACAGGCGCAGCCCAAAGG - Intronic
1134077648 16:11303290-11303312 CTGTAACAAGGGCAGACAGAGGG - Intronic
1135989698 16:27210489-27210511 CTGTGACATGGGCCTGCTGATGG + Exonic
1136172755 16:28498339-28498361 CTGGGACACGGGTAGGCACAGGG + Exonic
1137598896 16:49743074-49743096 CTGTGCCAGGGGCAGGCCTGAGG + Intronic
1137625356 16:49904309-49904331 CTGTGACCCAGGGAGGCTGAAGG - Intergenic
1137752919 16:50880045-50880067 CTGTGACAAGGGGCGGGCGAGGG + Intergenic
1138429736 16:56961040-56961062 CTGTGCCCCGGGCAGGGCCAAGG - Intergenic
1139327869 16:66165979-66166001 ATGTGACCCGGGCATGCGGATGG - Intergenic
1146077469 17:29744326-29744348 CTCTGGCAGGGCCAGGCCGAGGG + Intronic
1151550264 17:74818574-74818596 CAGTCACAGGGGCTGGCCGAGGG + Intronic
1151660786 17:75516909-75516931 CTGTGAGAGGGGCGGGCCCAGGG + Exonic
1157385173 18:47254235-47254257 CTGGGACACTGGCAGGCTCAGGG + Intergenic
1157855053 18:51097878-51097900 CTGTGAGACCTGCAGGCCCAAGG - Intergenic
1158851190 18:61496643-61496665 CTGTGATCCCGGCAGGCCGCAGG - Intronic
1160436987 18:78859285-78859307 CTGTGACTCGGGCTGGCTGCAGG + Intergenic
1160796344 19:947462-947484 CTGTGAAACGGGCTGGCGGCCGG + Intronic
1161459573 19:4388822-4388844 CTGTGACACAGTCAGGCCCTCGG + Intronic
1164212779 19:23114888-23114910 CTGTGACTAGGGCAGGAGGATGG - Intronic
1166833003 19:45649296-45649318 CTTTGACAGGCCCAGGCCGAAGG - Intergenic
925947555 2:8879810-8879832 CAGTGACAGGGGCAGGGAGAGGG + Intronic
930085559 2:47494725-47494747 CAGTGATACAGGCAGCCCGAGGG + Intronic
935332679 2:101988637-101988659 CTGAGCCACCGGCAGGCAGAGGG + Intergenic
948884573 2:240876292-240876314 CTGGGAGAAGGGGAGGCCGAAGG + Intronic
1169117439 20:3074903-3074925 CAGTGACATGGGCAGGGGGATGG - Intergenic
1170306545 20:14944855-14944877 TTGTGGGACGGGCAGGCAGAAGG - Intronic
1172590336 20:36113198-36113220 CTGTGATTCTGGCAGGGCGAGGG + Intronic
1174207858 20:48854118-48854140 CTGAGTCACACGCAGGCCGAGGG + Intergenic
1175917802 20:62435040-62435062 CTGGGACACGGGCACACCCAGGG + Intergenic
1176294293 21:5062794-5062816 CTGTGGCACGAGCAGGTAGACGG - Intergenic
1179302695 21:40126715-40126737 CTGTGACACAGGCATGCTCACGG - Intronic
1179543816 21:42101173-42101195 CTGTGACACCGGGAGGCAGCAGG + Intronic
1179862967 21:44200854-44200876 CTGTGGCACGAGCAGGTAGACGG + Intergenic
1182300170 22:29332761-29332783 CTGTGTCCCAGGCAGGCTGATGG - Intronic
1184418738 22:44367042-44367064 CGGTCACATGGGCAGGCCCAGGG - Intergenic
954631003 3:52047565-52047587 CTGTGCCAGGGGCAGGCAAAGGG - Intergenic
961305975 3:125959301-125959323 CAGTGACACGGGCTGGCCCACGG - Intergenic
961691234 3:128671304-128671326 CTCTGACATGGGCAGGCAGAAGG - Intronic
968634691 4:1671974-1671996 CTGTGTCACAGGCAGGCTGCTGG - Intronic
968874352 4:3257501-3257523 CCTTCACACAGGCAGGCCGAGGG - Intronic
990381095 5:55222628-55222650 CTGTGTGACGTGCAGGCCCAGGG - Intronic
990595836 5:57311478-57311500 CTATGGCAGGGGCAGGCAGAGGG + Intergenic
994028581 5:95114388-95114410 CTGTCCCAAGGGCAGGTCGAAGG - Intronic
1001905605 5:175470250-175470272 CTGAGACATGGGGAGGCTGAGGG - Intergenic
1004278206 6:14256729-14256751 CTGTGACATGAGCAGGCCTCTGG + Intergenic
1016947186 6:149546046-149546068 GGGTGACAGGCGCAGGCCGACGG + Intergenic
1017616765 6:156254295-156254317 CTGTGTCAGGGGCAGGCTGCAGG - Intergenic
1018843018 6:167532080-167532102 CTGAGACACTGGCACGCCGCAGG + Intergenic
1019419856 7:945894-945916 CTGGGGCACGGGCAGGGGGAAGG + Intronic
1020125560 7:5530924-5530946 CCGAGAGACGGGCAGGCCGGGGG - Intronic
1022487564 7:30791401-30791423 ATGGGACAGGGCCAGGCCGAGGG + Exonic
1022884074 7:34623471-34623493 CAGTGACACTGGCAGGACGCTGG + Intergenic
1023120393 7:36903082-36903104 CTGTGAGATGGGCAGGTAGACGG - Intronic
1024472301 7:49775952-49775974 CACAGGCACGGGCAGGCCGAGGG - Exonic
1040304955 8:46207229-46207251 AGGTGACATGGGCAGGCCGCAGG + Intergenic
1040305779 8:46211055-46211077 GTGTGGCATGGGCAGGCCGCAGG + Intergenic
1040436881 8:47399525-47399547 CTGTGACACGGGCATGTAGTGGG + Intronic
1047309815 8:123682703-123682725 CTGGGACACGGGCAGGAAGGTGG + Intronic
1053569336 9:39288085-39288107 CTGAGACCCGGGCACGGCGACGG + Exonic
1053785948 9:41653072-41653094 CTGGGACTCCGGCAGGCCCAGGG - Intergenic
1053835293 9:42129115-42129137 CTGAGACCCGGGCACGGCGACGG + Exonic
1054090968 9:60847069-60847091 CTGAGACCCGGGCACGGCGACGG + Intergenic
1054112379 9:61122625-61122647 CTGAGACCCGGGCACGGCGACGG + Intergenic
1054127806 9:61330925-61330947 CTGAGACCCGGGCACGGCGACGG - Intergenic
1054595331 9:67059516-67059538 CTGAGACCCGGGCAAGGCGACGG - Intergenic
1055587401 9:77769515-77769537 CTGTAACACAGGCAGGAAGAAGG + Intronic
1062347288 9:136120830-136120852 TTGTGACAGGGACAGGCTGAGGG + Intergenic
1185504415 X:620518-620540 CTGGGGCACGGGCAGGAGGAAGG + Intergenic
1189178400 X:38980835-38980857 CAGTGACACAGGCAGGAGGAGGG - Intergenic
1189240201 X:39518994-39519016 CTGTGTCACGGGCAGGAGGTCGG - Intergenic
1200876954 Y:8166683-8166705 CTATGACATGAGCAGGACGAAGG - Intergenic