ID: 900965213

View in Genome Browser
Species Human (GRCh38)
Location 1:5952714-5952736
Sequence GCTGCTGGAGCTCCACGTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 224}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900965213_900965216 -1 Left 900965213 1:5952714-5952736 CCTGGACGTGGAGCTCCAGCAGC 0: 1
1: 0
2: 0
3: 29
4: 224
Right 900965216 1:5952736-5952758 CTCTTCCTCAAACTTCTCCAGGG 0: 1
1: 0
2: 2
3: 37
4: 356
900965213_900965218 3 Left 900965213 1:5952714-5952736 CCTGGACGTGGAGCTCCAGCAGC 0: 1
1: 0
2: 0
3: 29
4: 224
Right 900965218 1:5952740-5952762 TCCTCAAACTTCTCCAGGGAGGG 0: 1
1: 0
2: 3
3: 24
4: 227
900965213_900965215 -2 Left 900965213 1:5952714-5952736 CCTGGACGTGGAGCTCCAGCAGC 0: 1
1: 0
2: 0
3: 29
4: 224
Right 900965215 1:5952735-5952757 GCTCTTCCTCAAACTTCTCCAGG 0: 1
1: 0
2: 1
3: 26
4: 218
900965213_900965221 10 Left 900965213 1:5952714-5952736 CCTGGACGTGGAGCTCCAGCAGC 0: 1
1: 0
2: 0
3: 29
4: 224
Right 900965221 1:5952747-5952769 ACTTCTCCAGGGAGGGGTACAGG 0: 1
1: 0
2: 0
3: 20
4: 165
900965213_900965222 11 Left 900965213 1:5952714-5952736 CCTGGACGTGGAGCTCCAGCAGC 0: 1
1: 0
2: 0
3: 29
4: 224
Right 900965222 1:5952748-5952770 CTTCTCCAGGGAGGGGTACAGGG 0: 1
1: 0
2: 2
3: 27
4: 234
900965213_900965220 4 Left 900965213 1:5952714-5952736 CCTGGACGTGGAGCTCCAGCAGC 0: 1
1: 0
2: 0
3: 29
4: 224
Right 900965220 1:5952741-5952763 CCTCAAACTTCTCCAGGGAGGGG 0: 1
1: 0
2: 0
3: 20
4: 206
900965213_900965217 2 Left 900965213 1:5952714-5952736 CCTGGACGTGGAGCTCCAGCAGC 0: 1
1: 0
2: 0
3: 29
4: 224
Right 900965217 1:5952739-5952761 TTCCTCAAACTTCTCCAGGGAGG 0: 1
1: 0
2: 2
3: 31
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900965213 Original CRISPR GCTGCTGGAGCTCCACGTCC AGG (reversed) Exonic
900355471 1:2260142-2260164 GTTCCTGCTGCTCCACGTCCTGG + Intronic
900965213 1:5952714-5952736 GCTGCTGGAGCTCCACGTCCAGG - Exonic
902977120 1:20096994-20097016 GCTGCAGCAACTCCAGGTCCTGG + Intergenic
903213101 1:21829497-21829519 GTGGCTTGAACTCCACGTCCAGG + Exonic
905227117 1:36486383-36486405 GCTGCTGCAGCTCCATTTCCTGG - Intergenic
905410022 1:37762130-37762152 ACTGCTAGCGCTCCACCTCCTGG - Intronic
906803611 1:48758909-48758931 GCCGCAGGAGCAGCACGTCCTGG + Exonic
906996186 1:50796707-50796729 GCAGCTGGACCACCAAGTCCAGG - Intronic
909075469 1:71046945-71046967 GCTGATGAAGCACCACGTCCCGG + Exonic
910450075 1:87335300-87335322 GCGGGTGGGGCTCCAGGTCCGGG + Intronic
911533784 1:99077220-99077242 GCTTCTGGATCTCCCTGTCCAGG - Intergenic
911612361 1:99970587-99970609 GCTTCTTGAGCTCCAGGTGCTGG - Exonic
913327739 1:117641720-117641742 GCTGCTGTTGCTCCACTTGCAGG + Intergenic
919085964 1:192920187-192920209 GCTGCTGGTGCTGCTAGTCCGGG + Intergenic
919810063 1:201403429-201403451 GTTGCTGATGCTCCACATCCTGG - Intergenic
920348432 1:205321711-205321733 ACTGCTGTGGCTCCCCGTCCTGG - Exonic
921187011 1:212678843-212678865 GTTGCTGTAGCTCCAAGTCCTGG + Intergenic
921193673 1:212731857-212731879 GCTGCTCCAGCTCCATGTCCTGG + Intronic
921851836 1:219939847-219939869 GCGGCATGAGCTCCAAGTCCAGG - Intronic
922561179 1:226570667-226570689 GATGCTGCAGCTCCAGGTGCTGG - Intronic
922929936 1:229381217-229381239 GCTGCTGCAGCCCCAGGTCTTGG - Intergenic
923107394 1:230865239-230865261 GCCGGTGGAGCCCCATGTCCTGG - Intronic
1062795942 10:345316-345338 GCTGCTGCATCTGCACTTCCTGG + Intronic
1064552946 10:16521035-16521057 GCTGCTGGTGATCCTCATCCCGG - Exonic
1065129347 10:22604885-22604907 GCAGCTGAAGCCCCAGGTCCTGG + Intronic
1066209452 10:33222919-33222941 GCTGCTGCAGCCCCCCGCCCAGG - Intronic
1067553835 10:47254044-47254066 GCAGCTAGAGCTGCACTTCCAGG + Intergenic
1070670379 10:78373504-78373526 GGTGCTGGAGCAACACTTCCTGG + Intergenic
1073100546 10:101004103-101004125 GCTGCTGAAGCTCTGCCTCCCGG - Exonic
1074429475 10:113381565-113381587 GCTGATGCAGCTCCACGTGGAGG - Intergenic
1074578623 10:114694894-114694916 GCTGCTGCGGCTCAATGTCCGGG - Intergenic
1076878167 10:133227041-133227063 CCTGCAGGAGCTCCCCGTCCTGG - Intergenic
1077062651 11:624652-624674 GCTGGTGGACATCCACGTCCCGG - Exonic
1077386705 11:2272622-2272644 CCTGCTGGATTTCCACCTCCCGG + Intergenic
1078085206 11:8229745-8229767 GATGCTGGAGCTTCAAGACCTGG - Intronic
1079004576 11:16782823-16782845 GCTCCTGCAGCTGCAAGTCCAGG + Intronic
1081688123 11:45056766-45056788 GCAGCTGGAGCTCCTTGTTCAGG - Intergenic
1082106720 11:48229007-48229029 GCTGCTGGTGCTGCAGGCCCAGG + Intergenic
1083672166 11:64305721-64305743 GCTGCCGGAGCCCCAGGTCCGGG + Intronic
1083954651 11:65976739-65976761 GCTGCTGCTTCTCCTCGTCCAGG - Exonic
1084198388 11:67539407-67539429 GCTGCTGGCCCACCAGGTCCTGG + Intergenic
1084611115 11:70203603-70203625 GCTGCTGGAGCAGAACGACCTGG + Exonic
1085126390 11:74005392-74005414 GCCTCTGGAGCTCCACCTCTGGG + Intronic
1088920425 11:114256903-114256925 GGTGCTGAAGCACCACGTCTAGG - Intergenic
1090000629 11:122954204-122954226 GCTGCTGCAGCTCCAGCTCCAGG + Intronic
1092071302 12:5633657-5633679 GGTGCCGGGGCTCTACGTCCAGG - Intronic
1093250510 12:16797904-16797926 TTTCCTGGAGCTCCATGTCCTGG + Intergenic
1093600245 12:21012830-21012852 GCTCCTGAACCTCCACCTCCTGG - Intergenic
1094460676 12:30694654-30694676 GATGCTGAAGCTCCAGGTCCTGG + Intronic
1098084211 12:66824328-66824350 GCTGTTGAAGCTCCAGGCCCAGG + Intergenic
1099555883 12:84107818-84107840 GCTGCAGGAGTTACACGTACTGG + Intergenic
1101210304 12:102528912-102528934 GATCCTGGAGATCCACATCCTGG + Intergenic
1101773783 12:107775596-107775618 GCTGCTGGAGCGCCAGGCCTGGG + Exonic
1102150942 12:110688937-110688959 CCTGCTGGGGCTCCACGGCGAGG + Intronic
1102655739 12:114480954-114480976 GCTGCAGGAGCCTCAGGTCCTGG - Intergenic
1103901643 12:124306547-124306569 GCTGGTGCGGCTCCAGGTCCCGG - Intronic
1104970584 12:132528944-132528966 GGTGCTGGGCCTCCAGGTCCGGG - Intronic
1105603237 13:21905962-21905984 GCTTCTGCAGCTCCAGCTCCTGG - Intergenic
1111721175 13:91947003-91947025 GCTGCTGGAGTTAAACCTCCAGG - Intronic
1113200789 13:107866374-107866396 GCTGCTGGTGCTCCTTGTCCCGG + Exonic
1114672171 14:24417137-24417159 GCTGCTGGAGCTCCACTGGAGGG + Exonic
1114736749 14:25050097-25050119 GCAGCTGGAGCTCCAGCGCCCGG - Exonic
1119199050 14:72739683-72739705 GCTGGTGCTGCTCCAAGTCCAGG + Intronic
1121110565 14:91309968-91309990 GCTTCTCGAGCACCAGGTCCTGG + Exonic
1122579214 14:102761212-102761234 CCTGCTCCAGCTCCACTTCCCGG + Intergenic
1122746656 14:103901084-103901106 GATGCTGGTGCTCCAAGCCCAGG - Intergenic
1122776714 14:104120105-104120127 GCTGCTGGAGGGCCACGCCGGGG + Intergenic
1122901735 14:104784836-104784858 GCTGGTGGCCCTCCACGTCCCGG + Intronic
1125511331 15:40293986-40294008 GCAGCCGGAGCCCCAGGTCCTGG - Intronic
1125513915 15:40307545-40307567 GCTGCTGGAGCACCAGGTGGTGG - Intronic
1127766211 15:62187666-62187688 GGTGCTGGAGCTTCAGGTCAGGG + Intergenic
1128269208 15:66293806-66293828 GCCGCTGGCGCTCCGCCTCCCGG - Intronic
1128388433 15:67166650-67166672 GCTGTAGGAGCTCCAGGTCTTGG - Intronic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1130348154 15:83067410-83067432 CCTGCAGAAGCTCCACCTCCGGG - Intergenic
1131514161 15:93066343-93066365 GCTGCTGGCACTCCGAGTCCTGG - Intronic
1132588703 16:717099-717121 ACTCCTGCAGCTCCACGTCATGG - Exonic
1132703001 16:1229915-1229937 GCTGCTGGCGCTGCCCGTCCTGG - Exonic
1132705322 16:1240953-1240975 GCTGCTGGCGCTGCCCGTCCTGG + Exonic
1132708451 16:1256316-1256338 GCTGCTGGCGCTGCCCGTCCTGG + Exonic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1132847581 16:2007532-2007554 GGTGGTGGAGCCCCACGTTCTGG - Intronic
1133127285 16:3655261-3655283 GCTGGTGGAGCTCAAGGTCAGGG - Intronic
1133139071 16:3731269-3731291 GCTGGTGGAGCTGCACACCCAGG - Exonic
1133301157 16:4783735-4783757 GCTGCAGGAACTCAATGTCCAGG + Exonic
1133993409 16:10728244-10728266 GCTGCTTGAGCTCCACGGGCTGG + Intergenic
1134069977 16:11255010-11255032 GCTGCTGGAGCACTACGTGGCGG - Exonic
1135678578 16:24438172-24438194 GGTGCTGGAGCCCCAATTCCTGG - Intergenic
1138130877 16:54478927-54478949 GCTGCTGGAGCTGCAGGTGTTGG - Intergenic
1138599243 16:58045335-58045357 GCTGCTGCTGCTCTGCGTCCTGG + Exonic
1141090031 16:81123818-81123840 CCTGCAGGGGCTCCATGTCCCGG + Intergenic
1141839991 16:86568100-86568122 GCTGCCGGAGCACCACGCCGCGG + Exonic
1141967532 16:87456398-87456420 GCTGCTGGGGCTACAGGTGCCGG - Intronic
1145374519 17:22335194-22335216 GTGGCTGGAGATTCACGTCCAGG - Intergenic
1146061152 17:29608008-29608030 GCTGCACCAGCTCCAGGTCCCGG - Exonic
1146833347 17:36089251-36089273 GCTGCTTCAGCTACACCTCCCGG - Exonic
1147490664 17:40863196-40863218 GCCGCTGGTGGTCCACGTTCTGG + Exonic
1148110998 17:45144579-45144601 GCTGCTCCAGCTCCGCGCCCCGG + Intergenic
1148839854 17:50488059-50488081 GATTCTGGGGCTCCACCTCCGGG - Intergenic
1149563813 17:57627922-57627944 GCTGCTCCAGCTCCAACTCCAGG + Intronic
1151537928 17:74749140-74749162 GCTGCAGAAGCTCGGCGTCCAGG + Exonic
1152520068 17:80850482-80850504 GCAGCCGGAGCTCCGCCTCCTGG + Intronic
1152649022 17:81483436-81483458 GCTGCTGGAGCTCCCAGGCAGGG - Intergenic
1153805412 18:8705696-8705718 GCGGCTGCAGCTTCGCGTCCGGG - Intronic
1157468537 18:47969363-47969385 ACTGCCTGAGCTCCACTTCCTGG + Intergenic
1157688248 18:49660373-49660395 GCAGCTGGAGCTCAGCCTCCAGG - Intergenic
1160066905 18:75583998-75584020 GCTGCTGGAGTTCCCTCTCCTGG + Intergenic
1160710351 19:548560-548582 GGTGCTGGGGCTCCACACCCTGG + Exonic
1160807930 19:1000773-1000795 GCTGCTGCAGCTGCACTTCCTGG + Exonic
1160810001 19:1009176-1009198 GCTGCTGCTGCTCCACCTCGGGG - Exonic
1161218405 19:3106205-3106227 GCGGCTGGGGCTCAACATCCAGG - Intronic
1161479765 19:4504674-4504696 GCTGCTGGAGCTCGGCGGGCAGG + Exonic
1161723511 19:5916054-5916076 GCTGCTGGAGGTCCTCGCCCGGG + Exonic
1162453611 19:10769308-10769330 GGTGCTGGAGCCGCAGGTCCTGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163235074 19:16025211-16025233 GCTGCTGGAGCTGGACAGCCTGG - Intergenic
1163375715 19:16929041-16929063 GCTGGTGGAGATCCATGACCTGG + Exonic
1163476931 19:17532080-17532102 GCTCCTGGAGCCCCCCGCCCTGG - Intronic
1165775791 19:38403603-38403625 GCTGCGGGAGCTGCACTGCCCGG + Exonic
1166092503 19:40519458-40519480 GCTGGTGGAGAACCACGTGCTGG + Exonic
1166098457 19:40556120-40556142 GCTCCTTGAGCGCCACGTACAGG - Exonic
1166120839 19:40685271-40685293 GCTGTTGGTGCTCCCAGTCCTGG - Intronic
1167203857 19:48086659-48086681 GCAGCTGGTGCTCCACCTGCTGG + Intronic
1167211114 19:48134750-48134772 GCTGATAGAGCCCCACGTGCAGG + Intronic
1167233074 19:48297503-48297525 GCTCCTGGAGCTCCACCTGCAGG + Exonic
1167326801 19:48831688-48831710 GCTGCTGGAGCTGAACCTACTGG - Exonic
1167570083 19:50281513-50281535 GCTGGTGGTGCTCCATTTCCAGG - Intronic
1168258948 19:55182096-55182118 GCTGCCGGAGCAGGACGTCCAGG + Exonic
1168269435 19:55241572-55241594 GCAGCTGGAGCTCCTGGCCCAGG - Exonic
1168713402 19:58514071-58514093 GCTGCTGGAGCGCCACCTGGCGG - Exonic
924978133 2:196411-196433 GCTGCTGGAGCTCAAAGTTGTGG + Intergenic
928548853 2:32352627-32352649 ACTGCTGGAGCTCAAAATCCAGG + Intergenic
930651678 2:53970583-53970605 GCTCTTGGAGCTGCACGGCCCGG + Exonic
931175520 2:59850648-59850670 GCAGCTGTAGATCCACGTCAAGG - Intergenic
932093845 2:68829572-68829594 GCAGCTGGAGCTCCACCCTCAGG - Intergenic
933751175 2:85602752-85602774 GCTGCGCGGACTCCACGTCCCGG - Intronic
934773292 2:96921546-96921568 GCAGGCGGAGCCCCACGTCCAGG + Exonic
934966792 2:98730911-98730933 GCTGCGGGAGATCCACCTGCTGG - Intronic
935350730 2:102149970-102149992 CCTGCTGGAGGTCCACTTCTGGG - Intronic
944015158 2:195027000-195027022 GCTGCTGGAACTTCACTTCTAGG + Intergenic
946291677 2:218750125-218750147 GCTGCAGCAGCTCCACCACCAGG + Exonic
947593184 2:231396279-231396301 GCTGCGGGCGCTCCACCTGCCGG - Intronic
947913964 2:233819988-233820010 GCTGCTGGCGCACCACCACCAGG + Exonic
948355139 2:237371933-237371955 ACTGCTTGAGCTCCACCGCCGGG + Exonic
948596908 2:239085445-239085467 GCTGCAGGAGCTCAGCGTCTAGG - Intronic
1169498004 20:6133244-6133266 GCTGCTGGAGCCTCACGACCTGG + Intergenic
1170173901 20:13445744-13445766 GCTGCTAGACCTCCATCTCCAGG + Intronic
1172245640 20:33443566-33443588 GCTGCTGGAGCTGCGCGCCGGGG - Exonic
1172522725 20:35578835-35578857 GCTGCAGGAGCTCCAGGGGCAGG - Intergenic
1172871128 20:38136161-38136183 ACTCCTGGAGCTGCACGCCCTGG - Intronic
1173519998 20:43692262-43692284 GCTGCTGGAGCTCGAGGACAAGG + Exonic
1173576649 20:44116309-44116331 CCTGCTGGAGCCCCCCGACCGGG - Exonic
1173802762 20:45905052-45905074 GCAGCTGGGGCTCCACTGCCCGG + Exonic
1174347549 20:49941645-49941667 GCCGCTCGAGCTCCACGGCTCGG - Exonic
1174565678 20:51463020-51463042 GCAGCTGGAGCGCCAAGGCCAGG - Intronic
1174943647 20:54960359-54960381 GCTGCTGCAGCTGCTGGTCCAGG - Intergenic
1175630914 20:60535485-60535507 TCTGCTGGAAATCCACATCCTGG + Intergenic
1176145538 20:63563766-63563788 GCCGCTGCAACACCACGTCCAGG + Exonic
1177369644 21:20185115-20185137 TCTGGTGGAGTCCCACGTCCTGG + Intergenic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181104299 22:20564463-20564485 GCTGCTGCAGCGCCACCTGCTGG - Exonic
1183303316 22:37069181-37069203 GCTGCTGCAGCTCGACCACCCGG - Exonic
1184161570 22:42700377-42700399 GCTCCTGGAGTTCCAGTTCCTGG - Intronic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
953198199 3:40753819-40753841 ACTGCTGGATGTCCACTTCCTGG + Intergenic
953982438 3:47419454-47419476 TCTGCTGGACCTCCACGCTCAGG + Exonic
954287286 3:49627971-49627993 GCTGCTGGACCTCCTCAACCAGG - Intronic
958932095 3:100217982-100218004 GCTGCTGCAGCTCCAAGTACTGG - Intergenic
959944778 3:112115002-112115024 CCTGCTGGAGCACCAAGCCCTGG - Intronic
960057279 3:113284522-113284544 GCTGCTGGGGCTTCATGCCCGGG - Exonic
960731276 3:120730298-120730320 GCTCCTGGAGCTTCATGTCTGGG - Intronic
961351732 3:126308468-126308490 GCTGAGGGAGCTGCACGTCCCGG + Intergenic
961509244 3:127391047-127391069 GAGGTTGGAGCACCACGTCCTGG + Intergenic
963980902 3:151535928-151535950 GCAGCTGGAGCTCCATGTACAGG - Intergenic
964477447 3:157109774-157109796 GCTCCTGGAGCTGCAAGCCCAGG + Intergenic
967704313 3:192631914-192631936 GCTGCTGGAGCTGGACTCCCAGG - Intronic
968561350 4:1284714-1284736 GCTGCAGGGGGTCCACATCCTGG - Intergenic
969612173 4:8233492-8233514 GCTGGTGGACCTCTACATCCAGG + Exonic
973156869 4:46965998-46966020 GCTTCTGAAGCACCACATCCAGG + Intronic
974916303 4:68182633-68182655 CCTGCTGGATCTGCACGCCCTGG + Intergenic
976497778 4:85750324-85750346 CCTGCTGGAGCCCCTTGTCCTGG - Intronic
976689659 4:87855546-87855568 GCATCTGGAGCTCCAAGTCTGGG - Intergenic
980113207 4:128654341-128654363 GCTGCTGCAGCCCCACTTCTTGG + Intergenic
982257621 4:153466221-153466243 GCTGCTGCAGCTCCAGACCCGGG - Intergenic
982442006 4:155447463-155447485 GCTGCTTTAGCTCCAAGTCTGGG - Intergenic
983224903 4:165076598-165076620 GCTGTAGGAGCTCCACGTCAGGG - Exonic
985146200 4:186896433-186896455 CCTGCTGGAGCCCCGCGTGCTGG - Intergenic
985520515 5:372092-372114 GCTGGTTGAGCTCCTCCTCCAGG + Intronic
985763799 5:1765820-1765842 GCTGCTGGAGCTCCAGATGTGGG + Intergenic
985912837 5:2896782-2896804 TTTGCTGAAGCTACACGTCCAGG + Intergenic
985930804 5:3056178-3056200 GAAGCTGCAGCTCCACTTCCTGG + Intergenic
986733056 5:10649363-10649385 GCTGCTGGAGCGCCCCTGCCCGG + Exonic
990546430 5:56826630-56826652 GCTGCTGGACCTCCACAGACAGG + Intronic
992751708 5:79868517-79868539 GATGCTGGTTCTCCATGTCCTGG + Intergenic
997681842 5:135761939-135761961 GCTGCTTGAGCTCCATGGGCTGG + Intergenic
998367310 5:141639740-141639762 TCTGCCGGAGCTCCCAGTCCAGG - Exonic
1001984216 5:176060597-176060619 GCTGCGGGCGCGCCACGTCTAGG - Intronic
1002129294 5:177070182-177070204 GCTCCAGCAGCTCCACGTCTTGG + Intronic
1002233259 5:177783468-177783490 GCTGCGGGCGCGCCACGTCTAGG + Intronic
1002262719 5:178006313-178006335 GCTGCGGGCGCGCCACGTCTAGG - Intergenic
1002927636 6:1614248-1614270 CCTGCTGCAGCTCCCCTTCCGGG - Intergenic
1003284861 6:4725568-4725590 GCTGGTGGACCTGCACCTCCGGG + Intronic
1005852100 6:29829545-29829567 TCTCCACGAGCTCCACGTCCTGG - Exonic
1009248995 6:61275285-61275307 GCTGCGGGAGCTACAAGTACCGG - Intergenic
1011419393 6:87155678-87155700 GCAGCTGTAGCTCCAGCTCCTGG - Exonic
1013233497 6:108176648-108176670 GCAGCTGGAGCCGCACGGCCTGG + Exonic
1013836829 6:114343289-114343311 GCTGCGGGACCTCCGCCTCCGGG - Intergenic
1015571062 6:134621905-134621927 GCTGCTGGAGCTCCCTGACCAGG - Intergenic
1015942290 6:138464320-138464342 ACTCCTGGAGCTCCACGGCCTGG + Intronic
1019029770 6:169000218-169000240 GCTGCAGGAGCTCCACAGCCAGG - Intergenic
1019307208 7:341415-341437 GATGCTGGAGCTGCAGGCCCAGG - Intergenic
1019511078 7:1417610-1417632 TCTGCTCCAGCTCCACCTCCAGG - Intergenic
1019570082 7:1707258-1707280 GCAGCTGGAAATCCGCGTCCTGG + Intronic
1021668749 7:23013932-23013954 GCTGCCGGAGCTCCACCTGCAGG + Exonic
1022505959 7:30908750-30908772 GCCGCTGGAGCCCCAGGCCCAGG - Intergenic
1027232990 7:76282764-76282786 GCGGCTGGAGCTCCAGGAGCGGG - Exonic
1027258146 7:76444430-76444452 GCTTCTGGATCACCACCTCCAGG - Intergenic
1029506486 7:100966497-100966519 GCTGCTGGCGCTGGGCGTCCGGG + Exonic
1032083068 7:128869670-128869692 GCTGCTGGAGCTGCACAGCGCGG - Intronic
1034355121 7:150445258-150445280 CCTGCAGGAGCTCCAGGCCCAGG - Intergenic
1035125466 7:156605570-156605592 GCTGCAGAAGCCCCACGTCTAGG + Intergenic
1035712710 8:1730759-1730781 GCTCCTGGAGCTGTACCTCCTGG + Intergenic
1036091310 8:5668680-5668702 GCTGCTGGAGCTAAACCTGCAGG + Intergenic
1036453944 8:8892482-8892504 GCTGGTTGTGATCCACGTCCAGG + Exonic
1039457088 8:37714659-37714681 ACTGCTAGAGCTCAGCGTCCAGG - Intergenic
1041780354 8:61572320-61572342 GCTGTTGGAGCTTTACTTCCTGG + Intronic
1044613119 8:94113971-94113993 GCTACTGGAGATTCTCGTCCTGG + Intergenic
1046904601 8:119558936-119558958 GCTGCTGCAGTTCCCTGTCCAGG - Intronic
1047051397 8:121117225-121117247 GCTGCAGGAGGTCCTCTTCCAGG - Intergenic
1047807236 8:128373210-128373232 GCTGCTGGAGATGCAGGTGCTGG + Intergenic
1049147824 8:141014640-141014662 GCTGGTGTAGTTCCACGCCCTGG + Intergenic
1049282955 8:141759796-141759818 GCTGCTGGAGGCCCACGTGTGGG - Intergenic
1049566590 8:143343433-143343455 GCTGCTGGTGACCCACGTGCTGG + Intronic
1049623834 8:143611368-143611390 TCTCCTGGAGCTCGAGGTCCTGG + Intergenic
1051894223 9:21971154-21971176 GCTGCTGCTGCTCCACGGCGCGG - Exonic
1051897761 9:22006193-22006215 GCTGCTGCTGCTCCACGGCGCGG - Exonic
1053157405 9:35791080-35791102 GCTGCTGGAGGGGCCCGTCCAGG + Intergenic
1054148938 9:61585527-61585549 GTGGCTGGAGATTCACGTCCAGG - Intergenic
1059593820 9:115694128-115694150 GGTACTGGAGCACCACCTCCTGG - Intergenic
1060477476 9:123997321-123997343 GCTTCTGGGGCTCCTCCTCCTGG - Intergenic
1060838745 9:126777920-126777942 GCTGCAGCAGCACCACCTCCAGG + Intergenic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061238910 9:129357992-129358014 GCTGCTGGAGCTGCACCACAAGG - Intergenic
1061570455 9:131474888-131474910 GCTGCTGGAGCTCCGGGGCTCGG - Exonic
1061625818 9:131840134-131840156 GCTGTTGCAGCCCAACGTCCTGG - Intergenic
1062366218 9:136210402-136210424 GCAGCAGGGGCTCCAGGTCCAGG + Intronic
1186372086 X:8957186-8957208 GCGGCTGGAGAACCACGTCTGGG + Intergenic
1186723116 X:12327033-12327055 GCTGATGGAGCTGCAGGTCCTGG - Intronic
1188822994 X:34797773-34797795 GCTGCGGGAGCTTCAAGTACTGG - Intergenic
1195111626 X:101656630-101656652 GCTGCTGCAGCCCCATCTCCAGG + Exonic
1196117579 X:112014135-112014157 GCTGCTGGTGCTGCTGGTCCAGG + Intronic
1197728645 X:129792812-129792834 GCTGCTGGAGCGCATCGGCCTGG + Exonic
1200146184 X:153927545-153927567 GCTGCTGGAAGTCCAGGTCCTGG - Intronic