ID: 900966058

View in Genome Browser
Species Human (GRCh38)
Location 1:5959411-5959433
Sequence GGGCCAAGGGGACCACAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900966058_900966067 24 Left 900966058 1:5959411-5959433 CCATCTTGTGGTCCCCTTGGCCC 0: 1
1: 0
2: 0
3: 11
4: 175
Right 900966067 1:5959458-5959480 CAAAACCAGGCCTGTCCTCTTGG 0: 1
1: 0
2: 2
3: 30
4: 252
900966058_900966069 26 Left 900966058 1:5959411-5959433 CCATCTTGTGGTCCCCTTGGCCC 0: 1
1: 0
2: 0
3: 11
4: 175
Right 900966069 1:5959460-5959482 AAACCAGGCCTGTCCTCTTGGGG 0: 1
1: 0
2: 0
3: 13
4: 163
900966058_900966068 25 Left 900966058 1:5959411-5959433 CCATCTTGTGGTCCCCTTGGCCC 0: 1
1: 0
2: 0
3: 11
4: 175
Right 900966068 1:5959459-5959481 AAAACCAGGCCTGTCCTCTTGGG 0: 1
1: 0
2: 1
3: 13
4: 168
900966058_900966066 11 Left 900966058 1:5959411-5959433 CCATCTTGTGGTCCCCTTGGCCC 0: 1
1: 0
2: 0
3: 11
4: 175
Right 900966066 1:5959445-5959467 AAGACACTAGGAACAAAACCAGG 0: 1
1: 0
2: 5
3: 37
4: 348
900966058_900966065 -1 Left 900966058 1:5959411-5959433 CCATCTTGTGGTCCCCTTGGCCC 0: 1
1: 0
2: 0
3: 11
4: 175
Right 900966065 1:5959433-5959455 CCAGCTTGACACAAGACACTAGG 0: 1
1: 0
2: 0
3: 13
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900966058 Original CRISPR GGGCCAAGGGGACCACAAGA TGG (reversed) Intronic
900557583 1:3288036-3288058 GGGCCATGGGGGCTACAAGGAGG + Intronic
900966058 1:5959411-5959433 GGGCCAAGGGGACCACAAGATGG - Intronic
902840341 1:19070284-19070306 AGGCCAAGGGCACCAAGAGAAGG + Intergenic
903631771 1:24779673-24779695 GGGTCAAGGAAACCTCAAGATGG - Intronic
904632134 1:31850350-31850372 GGGCATAGGGGTCAACAAGAAGG - Intergenic
906479871 1:46193000-46193022 GGGCAAAGGAGATCACAGGATGG - Intronic
906495568 1:46302272-46302294 GGGCCAAGGAGGCCCCAAGCGGG - Intronic
907290273 1:53408806-53408828 GGGGCTAGGGGACCCCACGAGGG + Intergenic
911650909 1:100387150-100387172 GGGCCAGGATGACCATAAGAGGG + Intronic
916440451 1:164819699-164819721 TTGGCCAGGGGACCACAAGATGG - Intronic
916488435 1:165279868-165279890 GGGAGAGGGGGACCACGAGATGG - Intronic
917611201 1:176690711-176690733 AAGTCAAGGGGATCACAAGAGGG - Intronic
919778198 1:201207471-201207493 GGGCCCAGTGGAGGACAAGAGGG + Exonic
920216807 1:204366957-204366979 GGGGCAATGGCACCACCAGAGGG - Intronic
920319557 1:205108371-205108393 AGGACAAGGGGACAACAGGAAGG + Intronic
923516424 1:234701669-234701691 GAACCAAGGGAACCAGAAGATGG + Intergenic
924844325 1:247750064-247750086 GGGCCATGGGGACCACCCCAGGG - Intergenic
1063611490 10:7566413-7566435 AGGCCAAGGGGAAAAGAAGAAGG + Intronic
1064699658 10:18006084-18006106 GGGTAAAGGGGAACACTAGATGG + Intronic
1067046839 10:42989868-42989890 GGGTGATGGGGACCACCAGAGGG + Intergenic
1067231360 10:44413182-44413204 GGGCCATGGGGGCCAAAGGAAGG + Intergenic
1070161012 10:73866763-73866785 GTGCCAAGGGGACCAGACGGCGG - Intronic
1070323530 10:75372802-75372824 GTGCCATGGGGACCCAAAGAGGG - Intergenic
1073821765 10:107272352-107272374 GGACCCAGGGGGCCAGAAGAAGG + Intergenic
1074883065 10:117673297-117673319 GGGACATGTGGACCAAAAGAGGG + Intergenic
1075923987 10:126235885-126235907 GGGTCAAGGGGAACACACGGAGG + Intronic
1076435891 10:130441053-130441075 GGGCCAATGTCATCACAAGAAGG + Intergenic
1076544400 10:131235083-131235105 GGGCCCAGGGTACCACAGGCAGG + Intronic
1076719164 10:132385675-132385697 GGCCCAAGGGGACCCCAGCACGG - Intergenic
1078069087 11:8096660-8096682 GGGCCAAGGAGAGAAGAAGAAGG - Intronic
1079590275 11:22175212-22175234 GGGGAAAGGGGAGCACAAGTTGG - Intergenic
1080692169 11:34567194-34567216 TGGGCACGGGGACCACCAGATGG - Intergenic
1081567919 11:44271022-44271044 GGGCAATGGGGGCCCCAAGATGG - Intronic
1082767303 11:57180084-57180106 GGGGCAGGGGGACCGCAGGACGG + Intergenic
1084544923 11:69810454-69810476 GGACCACAGGGACCACGAGATGG - Exonic
1084938834 11:72601524-72601546 GGGCCCTGGGGACCCCAAAATGG + Intronic
1085127438 11:74011297-74011319 GGGCCCAGGGGACCTAAAGAGGG - Intergenic
1085461135 11:76694264-76694286 GGGACAAGAGGCCCAGAAGAAGG - Intergenic
1085474334 11:76780476-76780498 TGGCCAAGATGATCACAAGAAGG + Intergenic
1089626207 11:119752559-119752581 GAGCCAAGGGGAGCACCAGGCGG - Intergenic
1089903094 11:122009297-122009319 GGGCCAACTGGACCACAACATGG - Intergenic
1091405979 12:209857-209879 GGGCCAATGGACCAACAAGATGG - Exonic
1092012923 12:5130654-5130676 GGGACAAGGAGATCTCAAGAGGG + Intergenic
1092211339 12:6648247-6648269 GGTCCAAGGGGAAAACAAGAGGG + Intergenic
1092961605 12:13601714-13601736 AGGGGAAGGGGACCACAAAAGGG + Intronic
1094476138 12:30842077-30842099 GAACCAAGGGAACCACAAGGTGG + Intergenic
1096396581 12:51270474-51270496 GAGCCAAGGGGACCTGCAGAGGG - Exonic
1098309537 12:69134575-69134597 GGGCCCATGGGATCACTAGAGGG - Intergenic
1102923296 12:116808829-116808851 GAGCCAGGGGGAGCACAGGACGG - Intronic
1103632792 12:122275941-122275963 GGGCAGTGGGGACAACAAGATGG + Intronic
1104302333 12:127575748-127575770 GGGCCAAAGGGAACAGATGAGGG - Intergenic
1104974411 12:132546055-132546077 GGGCTGAGGGGACCGGAAGAGGG - Intronic
1108684802 13:52809485-52809507 GGCCCCAGGTGACCACAAGGTGG - Intergenic
1108749482 13:53432998-53433020 GGGGCAAGGGGACAGGAAGAAGG + Intergenic
1109814962 13:67569414-67569436 GGACCATGTGGACCACAAGGAGG + Intergenic
1113887983 13:113670922-113670944 GAGCCAGGCGGACCACAAGGCGG - Intronic
1120019411 14:79511350-79511372 GAGCCAAGGGAAGGACAAGAGGG + Intronic
1121212928 14:92222481-92222503 GGGGTAAGGGGACCACTAGTGGG + Intergenic
1121868571 14:97385929-97385951 TGGCCAAGGGGAGCAAAGGAAGG + Intergenic
1122350340 14:101085919-101085941 GGGCCAATGAGAGAACAAGAAGG - Intergenic
1202859601 14_GL000225v1_random:72948-72970 GGGAGACGGGGCCCACAAGAAGG - Intergenic
1125312646 15:38397433-38397455 GGGCCAAGGGGTCCTTGAGAAGG - Intergenic
1128258832 15:66217718-66217740 GACCCAAGGGGACCCAAAGAAGG + Intronic
1128426306 15:67544971-67544993 GTGCCCAGAGGACCACATGAAGG - Intronic
1129983675 15:79897186-79897208 GGACCACGGGGACCGCACGAGGG - Intronic
1131742006 15:95403092-95403114 TGTCCAAGGGGAGCAGAAGAAGG - Intergenic
1131745561 15:95443462-95443484 GGGCCAAGGAAACCACTGGAGGG - Intergenic
1132396002 15:101474858-101474880 GGGACAAGGGAACCAACAGAGGG - Intronic
1133746205 16:8688592-8688614 AGGCAAAGGGGTCCACAGGATGG - Intronic
1137573095 16:49579331-49579353 GGGCCAACTGGACCACACTAGGG + Intronic
1140480033 16:75257354-75257376 GGGCCAGTGGAATCACAAGAGGG + Intronic
1140561948 16:75993853-75993875 GGGCTAAGGAAACCACAATAAGG - Intergenic
1141055772 16:80812411-80812433 GAGCCAAGGGAAACAAAAGATGG - Intergenic
1142611304 17:1110211-1110233 GGGCCAGGGGGACCAGAATGTGG - Intronic
1142716623 17:1750645-1750667 AGGCCAAGGGGACCACATTTAGG - Intronic
1143409860 17:6702339-6702361 AGGCCATGAGGACCCCAAGAGGG - Intronic
1144965570 17:19075386-19075408 GGCCCAAGGAGAGCACATGAGGG + Intergenic
1144982397 17:19176797-19176819 GGCCCAAGGAGAGCACATGAGGG - Intergenic
1144985826 17:19201442-19201464 GGCCCAAGGAGAGCACATGAGGG + Intergenic
1145281142 17:21467914-21467936 TGACCAGGGAGACCACAAGAGGG - Intergenic
1145320894 17:21766732-21766754 GGACCAAGTGGGCCCCAAGAGGG + Intergenic
1145907397 17:28524035-28524057 GCGCCAAGGGGACCTCATGCAGG + Exonic
1146464711 17:33077134-33077156 GAGCCAAGGGGACCACAGAAGGG - Intronic
1146715154 17:35079754-35079776 TGGCCAAGGGTACAACAGGAAGG + Intronic
1148767196 17:50046309-50046331 AGCCCAAAGGGACCACAAGGTGG - Intergenic
1150549105 17:66192343-66192365 CCGCCAAGGGGCCCACAAGCTGG - Intergenic
1150993501 17:70288493-70288515 TGGACCAAGGGACCACAAGATGG + Intergenic
1158640327 18:59198035-59198057 TGGCCAAGGGGACCACCTGGAGG + Intergenic
1160678530 19:403093-403115 AGGCCATGGGCACCACAAGCGGG - Intergenic
1160887881 19:1360434-1360456 GTGCAAAGTGGACCACAAGAAGG + Exonic
1161040551 19:2108840-2108862 TGGCCAAGGGCAGCCCAAGAAGG - Intronic
1161196417 19:2989009-2989031 GGGCAAAGGGGCTCACAAGCAGG + Intronic
1161594568 19:5144540-5144562 AGGACAAGGGGACCCCATGAAGG - Intronic
1162382665 19:10340686-10340708 TGGGCAAGGGGACAACAGGATGG - Intergenic
1162527629 19:11215726-11215748 GTGTCAAGGGGACCCCATGAAGG - Intronic
1162544700 19:11321704-11321726 GGGCCCCGGGGGCCACAGGAAGG + Intronic
1162551742 19:11361896-11361918 GGGGCAAGGGCTCCAGAAGAGGG - Intronic
1163000132 19:14362074-14362096 GGGCCCTGTGGGCCACAAGAAGG + Intergenic
1164850826 19:31482785-31482807 GGGCCAAGGGCATCATAATATGG - Intergenic
1165296904 19:34934763-34934785 GGGGCTGGGGGACAACAAGAGGG + Intronic
1165434146 19:35787516-35787538 GGCCCATGGGGACCTCAAGGAGG + Exonic
1167525935 19:49983814-49983836 TAACCAAGGGGACCACAAGGGGG - Intronic
1167909368 19:52689756-52689778 GGGCCAAAGGGATCAGGAGACGG - Intronic
1167999438 19:53432660-53432682 GGGCCAAAGGGATCAGGAGACGG + Intronic
925759669 2:7172261-7172283 TGGCCAAAGGAACCAGAAGAAGG - Intergenic
927996750 2:27492368-27492390 GGGTCAGGGGGAGCCCAAGATGG - Exonic
930116222 2:47720599-47720621 GGGCCAAGTGGATCCCCAGAAGG - Intronic
930274347 2:49294304-49294326 GGGCCAAGGGGACAACACATTGG + Intergenic
930523621 2:52498358-52498380 GGGCCAAGGGTAGAACAACATGG + Intergenic
941079539 2:161044534-161044556 AGGCTAAGGGGGGCACAAGAGGG + Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
947430630 2:230024620-230024642 GGGGCAAGGGGAGAACAACATGG - Intergenic
948329545 2:237154341-237154363 GGGCCAAGGTCTCCACATGAAGG + Intergenic
948425863 2:237886233-237886255 GCGCCAAGGAGACTACAGGAAGG - Intronic
948808143 2:240461745-240461767 GGGCCACGGGGAGCACAAGTGGG + Intronic
1172167707 20:32908994-32909016 GGGTAAGGGGGCCCACAAGAAGG + Intronic
1175476520 20:59278878-59278900 GGGGAAAGTGAACCACAAGAAGG + Intergenic
1175725058 20:61312525-61312547 GGGGCAAGGGGTCCCCAATACGG - Intronic
1180985310 22:19900855-19900877 GGGCAAAGGGCACCACACAATGG - Intronic
1181550006 22:23632471-23632493 GGGGCAGGGGGGCCACAAGGTGG - Intergenic
1182753577 22:32660637-32660659 GGGACAAGGGGAGCTCCAGAAGG - Intronic
1183237684 22:36631818-36631840 GGGCCAGCGGGACAACCAGATGG + Intronic
1183683931 22:39350803-39350825 AGCCCAAGGGGGCCTCAAGAAGG - Intronic
1183975213 22:41508042-41508064 GGGCCAAGGTGAGCAGAAGGTGG + Exonic
1184021712 22:41825839-41825861 GGGCTCAGGGGGCCACAAGGAGG + Exonic
1184577457 22:45382451-45382473 GCCCCAAGGGGTCCAGAAGAGGG + Intronic
1185055757 22:48577500-48577522 GGACCAAGGGGAGCACCAGGCGG - Intronic
1185295753 22:50053741-50053763 GGGCCAAGGGGAACTCCTGAGGG + Intronic
1185416385 22:50712588-50712610 GCAGCAAGGGGACCTCAAGAGGG - Intergenic
949238943 3:1846527-1846549 GGGGCTAGGGGACTCCAAGATGG + Intergenic
950476244 3:13216571-13216593 GGGACAGGGGGACCGCAGGAGGG + Intergenic
950707026 3:14789182-14789204 AGACCAAAGGGACCACAAGGAGG - Intergenic
950738943 3:15034284-15034306 AGGCTACGGGGACCAAAAGACGG - Intronic
953796451 3:45989700-45989722 GGGGGAAGGGGACCAAGAGAAGG - Intronic
954879657 3:53824621-53824643 GGGCCATGGGGAGCACTAGAGGG + Intronic
957432319 3:80126821-80126843 GGGCCAAGGTCACGTCAAGAGGG - Intergenic
960993170 3:123324821-123324843 GGGCAAAGGGGACCACCACCTGG + Intronic
961311653 3:126005825-126005847 GGTGCATGGGGACCAGAAGAAGG - Intergenic
966901912 3:184492706-184492728 GTGCAAAAGGGACCACAGGAAGG - Intronic
967157725 3:186708924-186708946 AGGGCAAGGGTACCCCAAGAAGG - Intergenic
968945469 4:3661302-3661324 TGTCCAAGGGGACAACCAGACGG - Intergenic
968966715 4:3772579-3772601 GGACAACGGGGACCTCAAGATGG - Intergenic
969736604 4:8995697-8995719 GGGGCAAGGGGAGCACAAAGAGG - Intergenic
970088129 4:12370819-12370841 GGGGCAAGGGGACCTCAAACAGG - Intergenic
976405189 4:84654979-84655001 GGGCTAATGGTACCACAAGCTGG - Intergenic
977224610 4:94380557-94380579 GGGTAAAGGGGACCATAAAAGGG - Intergenic
982576308 4:157114627-157114649 CGGCCAAGAGAAGCACAAGAAGG - Intronic
992161990 5:74013135-74013157 GGGCAGAGGGGACAACAGGAGGG - Intergenic
994945408 5:106381470-106381492 GGGGCAAGATGACAACAAGATGG - Intergenic
1000697919 5:164412051-164412073 GTGCCATGGGGACCACTATATGG - Intergenic
1001605751 5:172958784-172958806 GGGCCAAGAGGGCCACAGGTGGG + Intronic
1002942727 6:1732476-1732498 GGGTCAAGGGGAGAAGAAGAGGG + Intronic
1005385148 6:25278936-25278958 GGGCCAGGGGACCCAGAAGACGG - Intergenic
1012499752 6:99875437-99875459 GGGCCTGGGGGTCAACAAGAGGG + Intergenic
1012948160 6:105489734-105489756 CTGCCCAGGGGACCCCAAGATGG - Intergenic
1013473491 6:110486842-110486864 GGGCCAAGGGGAGGACAGGGTGG - Intergenic
1016665667 6:146637134-146637156 GGGAAAAGGGAACCACAACAAGG + Intronic
1017239036 6:152147077-152147099 AGGCCCTGAGGACCACAAGAGGG - Intronic
1017391078 6:153940217-153940239 GGGCCAAGTGGAAGTCAAGAGGG - Intergenic
1019702289 7:2479884-2479906 GGGCCGAGGGGAGCACCAGACGG - Intergenic
1022632182 7:32095547-32095569 GGGCCAAGGGAATGCCAAGAGGG + Intronic
1029362908 7:100100428-100100450 GGGCTAAGGGGACCCAAAGAAGG - Intronic
1029418030 7:100455928-100455950 GGGCAACGGAGACAACAAGAAGG - Intergenic
1031399478 7:121314440-121314462 GTTCCAAGGGGACCACCAGATGG - Intergenic
1033638751 7:143239407-143239429 GGGTGAAGAGGACCACAAGCTGG + Intergenic
1035759940 8:2061799-2061821 GGGCCAAGGAGCCCGCCAGAAGG - Intronic
1035980246 8:4362291-4362313 GGGCCAAGGAGTCCACCTGAAGG - Intronic
1036236197 8:7041755-7041777 GGGCCAAGGTGGCAGCAAGACGG + Intergenic
1039242015 8:35567537-35567559 AAGCCAATGGGACCAAAAGAAGG - Intronic
1041217194 8:55612290-55612312 GTGCCAAGGTGCCCTCAAGAAGG - Intergenic
1043172832 8:76986757-76986779 GTGCCAAGGGAACAACTAGATGG - Intronic
1048238104 8:132712504-132712526 GAGCCAGGGGGAGCACAAGGAGG - Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049382920 8:142326265-142326287 GGGCCCCGGAGACCACGAGACGG + Intronic
1049483630 8:142839956-142839978 GGGCCAAGGTGACTACAGAAGGG - Intronic
1049586003 8:143432632-143432654 AGGCCAAGGAGACCAGGAGAGGG + Intergenic
1051106640 9:13587897-13587919 GGGGCAAGGAGACCAGAAGTGGG - Intergenic
1052698421 9:31908673-31908695 GGGCCAGGGGAAGCAGAAGAGGG - Intergenic
1059427329 9:114229376-114229398 GGGCCAAGGGGACTATGTGATGG - Intronic
1060801364 9:126547760-126547782 GGGCCAAGGGGAGGACAGGAGGG - Intergenic
1062061913 9:134501554-134501576 GGGCCAGGGGGATCCCCAGAAGG - Intergenic
1189608303 X:42703723-42703745 AGGTCAAGGGGACCCCATGATGG + Intergenic
1189957368 X:46289010-46289032 GTGCCACGGGCACCACATGATGG + Intergenic
1190789072 X:53683099-53683121 GCGCCAAGGGGACCAATGGAAGG + Intronic
1190830998 X:54059368-54059390 TGGCCAAGGTGACCCTAAGATGG - Intergenic
1192370603 X:70509777-70509799 GTGCCAAAAGTACCACAAGATGG + Intergenic
1198174188 X:134138969-134138991 GGGGCAGGGGGTCCCCAAGAGGG + Intergenic