ID: 900966254

View in Genome Browser
Species Human (GRCh38)
Location 1:5960775-5960797
Sequence CCCAGCAGCCATGGGAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 261}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900966254 Original CRISPR CCCAGCAGCCATGGGAGTGT TGG (reversed) Intronic
900224996 1:1528844-1528866 ACGAGCAGCCATGGGGGTGGGGG - Intronic
900966254 1:5960775-5960797 CCCAGCAGCCATGGGAGTGTTGG - Intronic
901532445 1:9862036-9862058 CTCAGCAGGGATGGGAGGGTGGG - Intronic
902632046 1:17710765-17710787 CCCAGGAGCCATGGGTGTGGTGG + Intergenic
903515648 1:23909128-23909150 CCCAGCAGGCGAGGGAGTGAAGG - Intronic
903668941 1:25024302-25024324 CACAGCTGCCCTGGGAGAGTAGG - Intergenic
903864183 1:26386237-26386259 CCCAGCTGCAAGGGGAGTCTGGG - Intergenic
904125577 1:28236174-28236196 TCCAGCAGCAATGGCAGTGACGG + Exonic
904372784 1:30060783-30060805 GCCAGCAGGCATGGGAGTCTAGG - Intergenic
905926427 1:41753140-41753162 CCCAGCATTGGTGGGAGTGTAGG + Intronic
906717423 1:47980458-47980480 CCCAGCTGCCATGGGGGTGGGGG + Intronic
907781776 1:57573490-57573512 CCCAGCACCCATGCAAGAGTTGG + Intronic
907856670 1:58310592-58310614 CCTGGCAGCCATAGAAGTGTGGG - Intronic
909282136 1:73770133-73770155 CCCAGCAGCCTTGGCTGGGTGGG - Intergenic
910760942 1:90730471-90730493 CGCAGCAGCGATGGGGATGTAGG + Intergenic
913053230 1:115134958-115134980 CCCAGAAGTCCTGTGAGTGTGGG + Intergenic
915805319 1:158842524-158842546 CTCAGCAGTCATGGGGATGTTGG + Intronic
923261208 1:232269703-232269725 CCCAGCAGCACTGGGAGGGGTGG - Intergenic
1062922304 10:1289525-1289547 CCCAGCAGCCGTGGCAGACTCGG - Intronic
1065727645 10:28681370-28681392 CCAGGCAGCCATGGGTGAGTGGG - Exonic
1066471752 10:35705124-35705146 GCCAGCAGCAATGTGAGTTTAGG + Intergenic
1069568081 10:69477031-69477053 CCCAGCTGCCCTGGGGATGTGGG + Intronic
1070599613 10:77856635-77856657 CCCAGGAGCCAGGGGTGTTTGGG + Intronic
1070778208 10:79122519-79122541 CCAAGGAGAGATGGGAGTGTGGG - Intronic
1071888523 10:89977320-89977342 TCCAACAGCCATGGTAGGGTGGG - Intergenic
1072552080 10:96486836-96486858 CCCAGCAGCCCTGTGACTTTGGG - Intronic
1072692709 10:97582436-97582458 CTCACCCGCCATGGGTGTGTGGG + Intronic
1073246018 10:102090687-102090709 CCCAGCAGCCCTGGGAGATCTGG - Intergenic
1073331690 10:102674190-102674212 CCCAGCAGCCGTGGGAGCTGCGG + Exonic
1074146860 10:110724613-110724635 CCCTGCAGCCATGGGCGTGCTGG + Intronic
1075513541 10:123091726-123091748 CACAGGAGCCATGTCAGTGTTGG - Intergenic
1076255842 10:129024219-129024241 CACAGCAGCCATGGCTCTGTGGG - Intergenic
1076300841 10:129425111-129425133 TCCAGGAGCCACGGGACTGTAGG - Intergenic
1076307688 10:129476519-129476541 CCCAGGAGCCATGGGATTCCTGG - Intronic
1076483167 10:130798082-130798104 CCCAGCCTCCCTGGGAGTGAAGG - Intergenic
1077404632 11:2377540-2377562 CCGCGCCGCCATGGGAGTGGAGG + Exonic
1079111473 11:17607626-17607648 CCCAGCCGCCAGGGCAGTGAGGG + Intronic
1080148563 11:29020501-29020523 CCCAGCAGCCAGGGGGCTGATGG - Intergenic
1080331658 11:31146591-31146613 TCCAGCAGCCAAGTGAATGTGGG - Intronic
1080829273 11:35876351-35876373 CCCAGTAGCTCTGGGAGTCTGGG + Intergenic
1081776443 11:45678907-45678929 CCCATCATGCATGGGAGGGTTGG - Intergenic
1082655952 11:55857274-55857296 CCCAGGAGCCATGCGGGTGGGGG - Intergenic
1082794249 11:57368494-57368516 ACCAGCAGGCAGGGGAGTGACGG + Intronic
1083618530 11:64037750-64037772 CACAGCTGCCTTGGGGGTGTGGG - Intronic
1083726504 11:64631171-64631193 CTCTGCAGCCATGGGGGTGGAGG + Intronic
1084111320 11:67015805-67015827 GCCAGAAGCCATGTGAGTGCAGG + Intronic
1084708914 11:70831905-70831927 CCCTGCAGCCATGGGCCGGTTGG + Intronic
1085024695 11:73229623-73229645 CCCAGCTGGCCTGGGAGGGTGGG + Intronic
1085305857 11:75485844-75485866 CCCACCAGCCCTGGCACTGTTGG - Intronic
1085384607 11:76149895-76149917 CCCAGGAGCCATGGGAGGTGAGG + Intergenic
1085474483 11:76781375-76781397 CCCAGCAGGCTTGGGAGGGGAGG - Intergenic
1086954292 11:92919876-92919898 TTCAGGAGCCATGGCAGTGTGGG + Intergenic
1087139367 11:94750430-94750452 CCCTGCAGCCAGGAGAGAGTAGG - Intronic
1088582285 11:111327906-111327928 TCCAGCAGCAATGGGACTGACGG - Intergenic
1088858523 11:113778529-113778551 CCCAGCAGCAAGGGGAGCCTGGG + Intergenic
1088875915 11:113936091-113936113 CCCAGCAGCCATGGGAGGGGAGG + Intronic
1090421912 11:126581073-126581095 GACAGCAGCCATGGGAATGAAGG + Intronic
1090878506 11:130812847-130812869 CCCAGCTGACAAGGGAGTTTGGG + Intergenic
1091448370 12:557806-557828 CCCAGCAGCCCTAGGACTTTAGG - Intronic
1094493834 12:30977324-30977346 CCCAGCAGGGAAAGGAGTGTGGG - Intronic
1094526483 12:31234454-31234476 CCCATGAGACATGGGAGAGTTGG + Intergenic
1096569719 12:52515093-52515115 TCCAGCAGCAGTGGGGGTGTCGG - Exonic
1096865217 12:54558531-54558553 GCCAGAAGCCAGGGGAGTGGGGG + Intronic
1097655965 12:62363716-62363738 TCCAGCAGTCATGGGAGAGAGGG - Intronic
1098989280 12:77047121-77047143 CCTAGCTGCCTTGGGAGTGTTGG - Intronic
1100356595 12:93836857-93836879 TCCAGCAGGCATGAGTGTGTAGG + Intronic
1101708571 12:107243586-107243608 CCCAGCTGGGCTGGGAGTGTCGG - Intergenic
1101942608 12:109111154-109111176 CACCGCAGCCAGGGGAGGGTTGG - Intergenic
1102202950 12:111070142-111070164 CACAGCAGCCATGGAGGCGTAGG + Intronic
1103483784 12:121268856-121268878 TCAAGCAGCCATGGGGTTGTAGG + Intronic
1103889269 12:124226499-124226521 CACAGCAGCCTCGGGAGTTTAGG + Intronic
1108987038 13:56604825-56604847 CCCAGCAGCAATTGGCTTGTGGG - Intergenic
1110456644 13:75696793-75696815 CCCTGCAGGCATGGGAGCTTGGG - Intronic
1113811162 13:113143580-113143602 CCAGGCAGCGAGGGGAGTGTTGG - Intronic
1114267525 14:21081661-21081683 CCCAGCAGCCCTGCGAGAATGGG + Exonic
1114526914 14:23372251-23372273 TCCAGCAGCCCTGTGAGGGTAGG + Intergenic
1115346816 14:32351978-32352000 TCCAGCAGGCATGGGAGTACTGG - Intronic
1115928649 14:38466377-38466399 CCCTGCAGCCAGGAGAGAGTGGG - Intergenic
1119602098 14:75983002-75983024 ACGAGCAGCCAAGGGAGGGTAGG + Intronic
1119613334 14:76082187-76082209 CACACCAGCCATGGGGCTGTGGG - Intronic
1119826363 14:77660379-77660401 CCCAGCAGCCTTCGTGGTGTGGG + Intergenic
1120997349 14:90426762-90426784 CCGAGCAGCGGTGGGAGTGTGGG - Intergenic
1121811702 14:96897050-96897072 CTCTGGAGCCATGCGAGTGTGGG - Intronic
1124391204 15:29259503-29259525 CCCAGCATCTGTGGGAGGGTAGG + Intronic
1126394444 15:48199031-48199053 CTCAGCACCCATGGAAGAGTGGG + Intronic
1128629731 15:69252404-69252426 GGCAGGAGCCAAGGGAGTGTGGG + Intronic
1129269584 15:74412252-74412274 CCGTGCAGCCTTGGGAATGTTGG - Intronic
1129702444 15:77775553-77775575 CCCAGCAGCTCTGGTAGTGTGGG + Intronic
1129868983 15:78928997-78929019 CCCAGCAGCCTTGATAGGGTAGG + Intronic
1132465389 16:75204-75226 CCCACCAGCCCCGGGAGTGCTGG - Intronic
1132602861 16:781721-781743 CCCAGCAGGCATGGGGGTCCTGG - Intronic
1132869405 16:2109065-2109087 CCCCGCGGCCACGGGCGTGTAGG + Exonic
1132988810 16:2782685-2782707 CCCAACAGCCACGGGAGTGCAGG + Intergenic
1133240225 16:4409752-4409774 CCCAGCAGCCAGGGGAGCAGAGG - Intronic
1134829720 16:17313292-17313314 CCCAGCAGCCAGGGGCCTGGAGG - Intronic
1136267949 16:29131907-29131929 CCAAGCAGCCATGGGGGTGGGGG + Intergenic
1137492662 16:48945846-48945868 CCCAGCAGCAATGGTTGTTTAGG - Intergenic
1138199311 16:55077336-55077358 CCCAGCTGCCAAGCGAGTGAGGG + Intergenic
1139611772 16:68064119-68064141 CCCAGAAACCAGGGGAGTGAAGG + Intronic
1140126242 16:72121283-72121305 CCCACCAGCACTGGGAGTGAGGG - Intronic
1140376008 16:74446040-74446062 CCCAGCTGCCATTGGGTTGTAGG - Intergenic
1141255719 16:82400685-82400707 TCTAGCAGACATGGAAGTGTGGG - Intergenic
1141712982 16:85710684-85710706 CCCAGGAGCCTAGGGAGTCTGGG - Intronic
1142071256 16:88092245-88092267 CCAAGCAGCCATGGGGGTGGGGG + Intronic
1142186288 16:88696274-88696296 CCCAGCAGCCCTGTGGGTGTGGG + Intergenic
1143105911 17:4530518-4530540 CCCAGGAGCCAGGGGAGAGAAGG - Intronic
1143147965 17:4789002-4789024 AGCAGCAGGCATGGGAGTGGCGG + Exonic
1143582721 17:7835978-7836000 CCCAGCCCACCTGGGAGTGTGGG - Intergenic
1145085912 17:19939357-19939379 CCCAGAAGCCATGGAAACGTAGG - Intronic
1150135529 17:62693009-62693031 CCCAGCAGGCACAGGAGTGATGG - Exonic
1150512126 17:65765540-65765562 GCAAGCAGCCATAGCAGTGTTGG - Intronic
1152200062 17:78940021-78940043 CCCAGCAGAAATGGGGTTGTTGG + Intergenic
1152570006 17:81117588-81117610 CCCAGCTGCCAAAGGAGAGTGGG - Exonic
1152638207 17:81438825-81438847 CCCAGCAGCCCGGGGATGGTGGG + Intronic
1152865534 17:82720441-82720463 TGCAGCAGCCGTGGGAGGGTCGG + Intronic
1153971465 18:10230777-10230799 CTAAGCAGCCATGTGATTGTGGG + Intergenic
1158687636 18:59629038-59629060 GCCAGCAGCCAGGGTAGTCTGGG + Intronic
1160345073 18:78125480-78125502 GCCATCAGCTGTGGGAGTGTGGG + Intergenic
1160505479 18:79424024-79424046 CCCAGCAGGCCGGGGAGTGGAGG - Intronic
1160551103 18:79694234-79694256 CCCGGCTGGGATGGGAGTGTGGG + Intronic
1160551132 18:79694330-79694352 CCCAGCTGGGACGGGAGTGTGGG + Intronic
1160551157 18:79694422-79694444 CCCGGCTGGGATGGGAGTGTGGG + Intronic
1160771057 19:831436-831458 CCCAGCAGGCATGGTAGAGCCGG + Intronic
1161624527 19:5318541-5318563 CACAGCAGCCATGTGAGGGGAGG - Intronic
1162931671 19:13960711-13960733 CTCAGCAGCCCTGAAAGTGTGGG + Intronic
1163328969 19:16623979-16624001 CCCAACAGCCTTGTGAGTGGGGG - Intronic
1164445656 19:28315701-28315723 CCCAGCAGAAAGGGGAGTCTAGG + Intergenic
1164832347 19:31332355-31332377 CCCTTCTGCCATGGCAGTGTGGG - Intronic
1165350278 19:35271511-35271533 CCAGGCAGGCATGGGAGTGCGGG - Intronic
1165803809 19:38568290-38568312 CACAGCAGCACTGGGAGTGGTGG - Intronic
1168605991 19:57760253-57760275 GCCAGCAGCAATGGCAGTGGTGG - Intergenic
1168712982 19:58512293-58512315 CCCAGCAGGGATGGGAGGGGAGG - Intronic
925341646 2:3142176-3142198 CCCAGAAACCACAGGAGTGTGGG - Intergenic
925614841 2:5735206-5735228 TCTGCCAGCCATGGGAGTGTCGG + Intergenic
926371778 2:12185936-12185958 CCCAGCCCCCATGGGAAAGTGGG - Intergenic
928317678 2:30258598-30258620 CCCAGCAGCCATGGGTACATGGG + Exonic
928534072 2:32222640-32222662 CCCAGTAGTCAAGGTAGTGTAGG - Intronic
928677825 2:33667011-33667033 CACAGCAGCCATGGGAGCCGTGG + Intergenic
929576532 2:43056065-43056087 CCCAGCTGCTATGGGAGAGTTGG - Intergenic
931178570 2:59877366-59877388 CCCACCAGTCCTGGGAGTGCTGG + Intergenic
933943540 2:87265191-87265213 CCCAGCAGCCATGGCAAAGAAGG - Intergenic
936059758 2:109286721-109286743 CCCAGTACCTTTGGGAGTGTTGG + Intronic
936336681 2:111596386-111596408 CCCAGCAGCCATGGCAAAGAAGG + Intergenic
936795338 2:116196493-116196515 CGAAGCAGCCAAGGGAGTGCTGG - Intergenic
937340220 2:121086471-121086493 ACCACCAGCCATCGGAGGGTCGG - Intergenic
937914165 2:127090713-127090735 CCCAGCAGCCAGGGCAGGGGAGG + Intronic
938134211 2:128740544-128740566 CCCAGCAGGCCCGTGAGTGTGGG + Intergenic
940259284 2:151763860-151763882 CCCAGCTGCCATGAGGGGGTGGG + Intergenic
942936190 2:181559507-181559529 CCCAGCAGGAATGGAAGAGTAGG + Intronic
945935005 2:215894850-215894872 TCTAGCAGGCATGGGAGTGTAGG - Intergenic
946226594 2:218267146-218267168 CCCAGCAGACATGGGAGTATTGG - Intronic
946542438 2:220699370-220699392 CCCAGAGCACATGGGAGTGTGGG - Intergenic
947313998 2:228835221-228835243 CCCATCAGACAAGGGAGTGAGGG - Intergenic
947713599 2:232329277-232329299 CCCAGCACTCCTGGGACTGTGGG + Intronic
947866167 2:233399448-233399470 CCCAGCAGCCACGGCAGGGCTGG + Intronic
948747641 2:240107865-240107887 CCCATCAGCCTGGGGAGTGTAGG + Intergenic
948756675 2:240163440-240163462 CCCAGCTGCCCTGGGGGTATGGG - Intergenic
948795107 2:240398715-240398737 CCCAGCAGCCCAGGGAGGGAGGG - Intergenic
949010720 2:241676853-241676875 CCCAGGAGCCACAGGAGCGTGGG - Intronic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1169010051 20:2243016-2243038 CCCAGCAGAGTTGGGAGTATTGG + Intergenic
1169313430 20:4567982-4568004 ACCAGAAGCCAAGGGAGTGGTGG + Intergenic
1170112432 20:12820299-12820321 GCCAGCAGCTAGGGGAGTGGAGG + Intergenic
1170671178 20:18435057-18435079 CCCATCAGCCAGGGCGGTGTGGG - Intronic
1172502784 20:35438726-35438748 CCCAGAAGCATGGGGAGTGTGGG + Intronic
1173659373 20:44722841-44722863 ACCAGAAGGGATGGGAGTGTCGG - Intronic
1173684125 20:44910623-44910645 CCCAGCAGCCGTGTGACTCTGGG + Intronic
1173843536 20:46174382-46174404 TCCAGCCGCCAAGGGAGGGTTGG + Exonic
1173903307 20:46606877-46606899 CCCAGGGGCCATGTGAGTGATGG - Intronic
1174581433 20:51574475-51574497 CCCACGGGCCATGGGACTGTAGG + Intergenic
1174763104 20:53226198-53226220 CCCAGTGGCCATGGGAGCTTTGG + Intronic
1175184033 20:57167759-57167781 CAGAGCAGCCATGTGTGTGTGGG + Intergenic
1175284887 20:57831377-57831399 CCCAGAAGCCATGGCAGTCTGGG + Intergenic
1175862991 20:62160088-62160110 GCCACCAGAAATGGGAGTGTGGG + Intronic
1175993447 20:62801401-62801423 CCCTGCAGCCAGGGAAGGGTGGG + Exonic
1176201482 20:63862798-63862820 CCCACCAGCCATGGGAAGGCGGG - Exonic
1178717116 21:34975573-34975595 CCCAGTATCCATGGGGGTATTGG - Intronic
1178882357 21:36459663-36459685 CCCAGCAGCCCAGGGAGCCTGGG - Intergenic
1179682658 21:43035240-43035262 AGCAGAAGCCATGAGAGTGTGGG - Intergenic
1180100316 21:45580881-45580903 CCCAGCAGCGCTGGGAGGGTGGG + Intergenic
1180190537 21:46160649-46160671 CCCAGAGACCGTGGGAGTGTTGG - Intergenic
1181843133 22:25682365-25682387 CCGAGCCTCCATGGGAGGGTAGG - Intronic
1182482029 22:30615302-30615324 CACAGCAGCCATGGCAGGCTTGG + Exonic
1184921712 22:47609957-47609979 CCGCGCAGCCAGGGGAGTGCTGG - Intergenic
949500571 3:4676692-4676714 GGCAGCAGCCATGGGAGTCATGG - Exonic
950726715 3:14921667-14921689 CACAGCAGCCCTGGGAGTTAGGG + Intronic
951375913 3:21916947-21916969 ACCAGCAGCAGTGGGAGTGTGGG - Intronic
951638117 3:24802956-24802978 AACAGCAGCCATTGGAGAGTGGG - Intergenic
952878240 3:37966078-37966100 CCAAGCAACTGTGGGAGTGTAGG + Intronic
953565185 3:44026447-44026469 CCCAGCAGCCAGGAAAGTGGTGG + Intergenic
954194089 3:48985887-48985909 CAAAGCAGACATGGGAATGTAGG + Exonic
954305144 3:49721695-49721717 CCCATCAGCAAGGGGAGTGCTGG - Exonic
954690345 3:52392338-52392360 CCCAGCATCCTTGCCAGTGTTGG - Intronic
954797331 3:53168258-53168280 CCCAGCTGCCATGGGTGTAGGGG - Intronic
956119786 3:65954785-65954807 CCCAGCAGCCCTGGGGGTTGGGG - Intronic
961379489 3:126487763-126487785 CCCAGCTGCCCTGGGAGCCTTGG + Intronic
961548428 3:127652378-127652400 CCCAGCAGTTCTGGGAGGGTCGG + Intronic
963778513 3:149464102-149464124 CGCAGCCGCCATGGGAGTGCAGG - Intergenic
968522217 4:1039251-1039273 CCCAGCTGCCCCAGGAGTGTGGG + Intergenic
969259265 4:6023270-6023292 CCCAGGGGCGATGGGAGTGTGGG - Intergenic
973980596 4:56305415-56305437 CCCTGCAGCCTTGGGAGAGGGGG - Intronic
975487896 4:74954730-74954752 CCCATCAGCAATGAGAATGTTGG + Intronic
976207745 4:82638580-82638602 CCAAGCAGACCTGGAAGTGTGGG - Intronic
978019002 4:103785661-103785683 CCCAGCACCCATGGGTGGCTGGG + Intergenic
983219894 4:165033908-165033930 CCCAGCATCTATGGGAGAGTTGG - Intronic
985504335 5:270531-270553 CCCAGCAGGCAGGGGTGTGAAGG + Intergenic
985864910 5:2507034-2507056 ACCAGCAGCCAGGGCAGTTTCGG + Intergenic
986671535 5:10146958-10146980 ACCAGCAGCCATGGGGCTTTGGG + Intergenic
986729189 5:10622971-10622993 CCCAGCAGCCTGGGGCGTGGTGG + Intronic
987159934 5:15132037-15132059 GCCAGTAGCCATGGCAGTGGTGG + Intergenic
989427815 5:41316516-41316538 TCTAGCAACCATGGCAGTGTTGG - Intronic
990592812 5:57283201-57283223 CTGGGCAGCCAAGGGAGTGTTGG + Intergenic
990987698 5:61655906-61655928 GCCAGCAGCCAAGGGTGTTTGGG + Intronic
991207794 5:64069359-64069381 CCCAGCAGCCATGACAGGCTGGG + Intergenic
993582235 5:89677253-89677275 TGGAGCAGCCAAGGGAGTGTTGG + Intergenic
994907220 5:105856612-105856634 CCCTAAAGCCATGGCAGTGTGGG + Intergenic
995268593 5:110194725-110194747 CCCACATGCCATGGGAGTGGAGG - Intergenic
998395264 5:141814212-141814234 CCCAGCATCCATGGGGTTGAGGG - Intergenic
1000151190 5:158502804-158502826 CCCAGCAGTCCTGGTGGTGTAGG + Intergenic
1002061413 5:176628048-176628070 GCCAGGAGCCATGGGTGTGGTGG + Intronic
1003498004 6:6681295-6681317 CACAGCTGCGATGGGAGTATGGG + Intergenic
1003967535 6:11267399-11267421 CCCTGCAGCCAAGGAAGTGGTGG - Intronic
1004921343 6:20379007-20379029 CACAGCATCCCTGGGAGTGGAGG - Intergenic
1006327876 6:33367467-33367489 CCCAGCTGCTGTGAGAGTGTAGG - Intergenic
1007249791 6:40487941-40487963 CCCACCAGCCAGAGGAGTCTGGG - Intronic
1007289719 6:40776261-40776283 CCCAGCATCCATGGTCTTGTGGG + Intergenic
1012264566 6:97125797-97125819 CCCAGCCTCTATGGGAATGTAGG - Intronic
1013012669 6:106134386-106134408 CACAGCAGCCATGGAAGTGTTGG + Intergenic
1013041507 6:106438485-106438507 GCCAGCAGCCATGGGAAGCTAGG - Intergenic
1013773668 6:113654572-113654594 GCCTCCAGCCATGGGACTGTGGG - Intergenic
1014109824 6:117608107-117608129 AGCAGCAGCCATGCTAGTGTTGG + Intergenic
1018167259 6:161109920-161109942 CACAGCAGCCAGGCGGGTGTGGG - Intronic
1019488899 7:1301928-1301950 CCCAGCAGCCCTCCGTGTGTGGG - Intergenic
1019699661 7:2468525-2468547 CCCGGCCGCGATGGGGGTGTGGG + Intergenic
1019871787 7:3770642-3770664 CCCAGCTGCCTTGTGTGTGTTGG + Intronic
1021446153 7:20735807-20735829 CCCAGAAGACATGAGATTGTAGG - Intronic
1022532478 7:31075713-31075735 CCCAGAAAGCATGGGATTGTTGG + Intronic
1022537641 7:31107730-31107752 CTCATCATCCATGGGAGTGGGGG - Exonic
1023061738 7:36334109-36334131 TCCAGCAGCCATGGAACAGTTGG - Exonic
1027279140 7:76592976-76592998 CCCACCAGACATGGGATTATGGG + Intergenic
1030722860 7:112890100-112890122 CCCATCAGCCATGGCTTTGTGGG - Intronic
1032878294 7:136061592-136061614 CCCAGCAGCCAGGAGACAGTTGG - Intergenic
1034346045 7:150385839-150385861 CCCAGTCTCCATGGGAGGGTAGG - Intronic
1034443573 7:151100453-151100475 CCCAGCAGCTACGCCAGTGTCGG + Intronic
1034491550 7:151395732-151395754 CCCAGCAGCCAGGGGAGCCCAGG - Intronic
1034558789 7:151866695-151866717 GCCAGCAGCCATGGGGTGGTGGG - Intronic
1035257109 7:157637456-157637478 TCCAGCAGCCTGGGGAGTGGCGG + Intronic
1035640287 8:1179496-1179518 CCCAGCAGCCAGGTGCCTGTGGG - Intergenic
1036181062 8:6585789-6585811 CCCTGCAGTCATGGGATGGTGGG - Intronic
1036827884 8:11992772-11992794 CCCAGCAGCCATGTGTGGTTGGG + Intergenic
1037451747 8:19022483-19022505 CTCAGCAACTCTGGGAGTGTGGG + Intronic
1038477070 8:27876023-27876045 CCCAGCAGCCATGAGAAGGAAGG + Intronic
1039007000 8:33050577-33050599 CCCAGGACCCTTGGGAGTGGTGG + Intergenic
1039047285 8:33461564-33461586 CCCAGCAGGAATGGCAGTGCAGG - Exonic
1041934887 8:63323525-63323547 CCCAGCAGCCATGGAGGGATGGG + Intergenic
1042180182 8:66079913-66079935 ACCAGCAGGAATGTGAGTGTAGG + Intronic
1043097436 8:75993714-75993736 CCCAGCATTCTTGGGAGTCTGGG - Intergenic
1043192799 8:77248076-77248098 CCAGGCAGCCATGGCAGGGTTGG - Intergenic
1048201771 8:132380605-132380627 TCCTGCAGCCACGGGTGTGTGGG - Intronic
1048440939 8:134458539-134458561 CCCAGCAGCCAGGGGGGTCCTGG - Intergenic
1048574078 8:135677501-135677523 CCCAGCATCCCTGGGTGTGCTGG + Intergenic
1049290595 8:141799702-141799724 ACCAGCTGACATGGGAGTGTGGG + Intergenic
1049731243 8:144179660-144179682 CCCAGCAGCCTTGAGAGTATAGG + Intronic
1050461996 9:5885069-5885091 CCCAGCAGCCAGGAGGGTGGAGG - Intronic
1053185603 9:36013595-36013617 GCCAACAGCCATGGGCATGTAGG - Intergenic
1053247188 9:36544172-36544194 CCCAGCTGCAATGGATGTGTTGG + Intergenic
1056796864 9:89664583-89664605 CCCAGAAATCTTGGGAGTGTGGG + Intergenic
1058293253 9:103271926-103271948 CCCAGGAGCCATTTGAGGGTGGG - Intergenic
1058894885 9:109390993-109391015 CACAACAGCCATGGGAGGGCAGG - Intronic
1059449211 9:114359751-114359773 CCCAGAAGCCATGAGAATGGAGG - Exonic
1060198825 9:121640134-121640156 CCCAGGAGCCCTGGGAGTCCTGG + Intronic
1060493276 9:124100359-124100381 CCCAGCAGCCTGGGGAGTGGTGG - Intergenic
1061169081 9:128941598-128941620 CCCAGCCTCCAGGGGACTGTCGG - Intronic
1061388277 9:130303175-130303197 CCCAGCAGTGGTGGGAGTCTCGG - Intronic
1062146771 9:134993901-134993923 CCCAGCAGCCACAAGAGTGGAGG + Intergenic
1062274884 9:135725987-135726009 CCCAGGAGCCATGGCTGTGGGGG + Intronic
1062408920 9:136411560-136411582 ACCAGGACCTATGGGAGTGTGGG + Intronic
1062512392 9:136914011-136914033 CCCAGAAGCCTTGGCAGTGACGG + Intronic
1187260252 X:17678954-17678976 TCCAGCAGCTCTGGGAGTCTGGG - Intronic
1189415473 X:40809076-40809098 CCCAGCTGCCAAGGGAGTCTGGG + Intergenic
1190000806 X:46684865-46684887 GCCAGCAGCCATGTCATTGTAGG - Intronic
1192149032 X:68700427-68700449 CCCAGCAGCCATGGCAGCCGGGG + Intronic
1193077458 X:77370198-77370220 CTAATCAGCCTTGGGAGTGTTGG - Intergenic
1193789691 X:85802385-85802407 GCCAGCAGCAATGGTAGTCTAGG - Intergenic
1195300318 X:103523993-103524015 CCCACCAGGGATGGAAGTGTTGG + Intergenic
1195303313 X:103554163-103554185 CCCACCAGGGATGGAAGTGTTGG + Intergenic
1197061828 X:122190502-122190524 CCCAGCAGGGACGGGAGGGTGGG - Intergenic
1200089130 X:153626217-153626239 CCCAGCAGCCAGGGCTGGGTGGG - Intergenic
1201574837 Y:15451795-15451817 CCCAGTACCGATGGGATTGTGGG - Intergenic