ID: 900968758

View in Genome Browser
Species Human (GRCh38)
Location 1:5977664-5977686
Sequence GAGCATGCCGGCCCGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900968758 Original CRISPR GAGCATGCCGGCCCGCAGGG TGG Intronic
900556989 1:3285501-3285523 GAGCATGCCTGCTCCCAGGAAGG - Intronic
900968758 1:5977664-5977686 GAGCATGCCGGCCCGCAGGGTGG + Intronic
903295800 1:22342414-22342436 GAGCAGGCAGGCAAGCAGGGCGG + Intergenic
906154508 1:43606180-43606202 GAGCATGCCGGCCAGCCCTGAGG - Intronic
908581869 1:65525405-65525427 GAGGACCCCTGCCCGCAGGGAGG - Intronic
920071796 1:203307451-203307473 GAGCACGGCGGCGCCCAGGGCGG - Exonic
920442928 1:205993462-205993484 GAGGATGCTGGCCCCCAGTGTGG + Exonic
1062843746 10:689560-689582 GAGCATGGCGGACCGCAGCCTGG - Exonic
1065331906 10:24611128-24611150 GATCATGCCCGCCCACAGGAGGG - Intronic
1065925906 10:30433887-30433909 GAGCAGAGCGGCGCGCAGGGAGG - Intergenic
1068080644 10:52314217-52314239 GAGCATTCCGGCCCCTTGGGAGG - Intergenic
1068411992 10:56667820-56667842 GAGCACGCCGGCCCGCAGGGTGG - Intergenic
1069521326 10:69124081-69124103 GTGCCTGGCGGCCAGCAGGGCGG + Exonic
1069636024 10:69925520-69925542 GAGCATTCTGGCCCTCAGGTGGG + Intronic
1070398795 10:76034929-76034951 AAGCAAGCCGGCCGGCAGAGGGG - Intronic
1076993678 11:288601-288623 GATCATTCCGCCCCCCAGGGAGG + Intergenic
1077332930 11:1991242-1991264 CAGCAAGCCGGCCTGCAGGTGGG + Intergenic
1077367480 11:2167028-2167050 GAGCCTGGCTGCCCGCAGGAAGG - Exonic
1080520998 11:33067782-33067804 CAGCATGCCTGCCAGCATGGGGG + Intronic
1084712356 11:70851873-70851895 GAGCCTCCCGGCCCCCAGGCTGG + Intronic
1202815913 11_KI270721v1_random:46418-46440 CAGCAAGCCGGCCTGCAGGTGGG + Intergenic
1092916598 12:13194859-13194881 GAGCATCCCAACCCTCAGGGAGG - Intergenic
1095954816 12:47799901-47799923 GAGCAGGCCGGCCCCATGGGAGG + Intronic
1103722121 12:122980718-122980740 GGGCTGTCCGGCCCGCAGGGCGG + Exonic
1105593810 13:21817672-21817694 GTGCTTCCCAGCCCGCAGGGAGG - Intergenic
1120864565 14:89284765-89284787 GACCTTGCCGGCCAGCAAGGTGG + Intronic
1122846541 14:104503139-104503161 GATCATGCCCTCCCTCAGGGAGG + Intronic
1124439378 15:29675371-29675393 GAGCATGTCCACCCGCAGCGAGG + Intergenic
1128527717 15:68423781-68423803 GAGGAGGCCGGCCTGCGGGGTGG - Intronic
1131074048 15:89483816-89483838 GAGCAGGAAGGCCAGCAGGGAGG + Intronic
1132734225 16:1377647-1377669 GAGGCTGCCAGCCCTCAGGGAGG - Intronic
1132903030 16:2268555-2268577 GGGCGTGGGGGCCCGCAGGGCGG + Intergenic
1132977830 16:2719470-2719492 GAGTGTCCCGGCCCGCAGGGAGG + Intronic
1136777821 16:32881091-32881113 GAACATACCTGCCCGCAAGGGGG - Intergenic
1136892802 16:33980423-33980445 GAACATACCTGCCCGCAAGGGGG + Intergenic
1140839387 16:78825095-78825117 GAGGATGCCGGCACTCGGGGAGG + Intronic
1141602491 16:85135014-85135036 GAGCAGCCCGGCCAGCAGGGTGG - Intergenic
1141754653 16:85983211-85983233 GAGGAAGCCAGCCTGCAGGGTGG + Intergenic
1203080236 16_KI270728v1_random:1143200-1143222 GAACATACCTGCCCGCAAGGGGG - Intergenic
1142606366 17:1083616-1083638 GAGCTGGCTGGCCTGCAGGGAGG + Exonic
1142941815 17:3386165-3386187 GAGCAGGCCGGCCAGCAGCCTGG - Intergenic
1143379547 17:6487501-6487523 GAGCATGCCAGGGCTCAGGGAGG - Intronic
1151576370 17:74954377-74954399 GAGCATGCCTCGCCTCAGGGAGG + Intronic
1151582362 17:74987740-74987762 GAGGATCCGGGCCCGCAGGCGGG - Exonic
1151767606 17:76140331-76140353 GAGGAGGCCGGGCCGGAGGGCGG - Exonic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1152851827 17:82641252-82641274 GAGTTTGACGGCCCGCACGGTGG - Intronic
1158527621 18:58229312-58229334 GAGCATGCCTACCTGCAGCGTGG - Intronic
1160865230 19:1253238-1253260 GGGCAGGCTGGGCCGCAGGGTGG + Intronic
1160913179 19:1484047-1484069 GATCATGCCGGCCGCCAGTGGGG + Exonic
1163354313 19:16799948-16799970 GAGCCTGCTGGCCCGCGGCGGGG + Exonic
1166069486 19:40378732-40378754 GTCCATGCCGGGCCACAGGGTGG - Intronic
1167411527 19:49347002-49347024 GAGGAGGCCAGCCCCCAGGGTGG - Intronic
926083477 2:10006799-10006821 GAGCGTGGCAGCCAGCAGGGTGG + Intergenic
929777905 2:44939822-44939844 GAGGATTCCGGGCGGCAGGGAGG - Intergenic
932684172 2:73853816-73853838 GAGCATGCATGCCCTAAGGGAGG + Intronic
937955190 2:127418273-127418295 AAGGATGCCGTCCAGCAGGGAGG - Intergenic
1182122947 22:27798754-27798776 GTGCATGGCGGCCCGGTGGGCGG - Exonic
1184857659 22:47155318-47155340 GAGCTGGCCAGCCCGCCGGGAGG - Intronic
954956057 3:54519061-54519083 GTGCATGTCTGCCTGCAGGGAGG + Intronic
955161511 3:56468566-56468588 GAGCGTGCCGGCCGGCCGGGTGG - Intergenic
958100519 3:89003125-89003147 GAGCATGGCTGCCTGCCGGGAGG - Intergenic
961182488 3:124887391-124887413 GAGCCTGGCGGGCCGGAGGGAGG - Intronic
964571060 3:158107200-158107222 GAGCTTCCCGGCTCGCAGGCAGG + Intronic
968074865 3:195810683-195810705 GGGCAGGCCGGCCGGGAGGGTGG - Intronic
974800570 4:66812325-66812347 GATCATGCCTGCCCACAGTGAGG + Intergenic
975666919 4:76741608-76741630 CAGCCTGCAGCCCCGCAGGGAGG + Exonic
994107278 5:95961550-95961572 GAGCGGGCCGGCCGGCAGGCTGG - Intronic
998296857 5:140978983-140979005 GTGCATGCCTGCTCTCAGGGAGG - Exonic
1001577082 5:172771419-172771441 GAGCAGGCCGGACAGCAGGGCGG - Intergenic
1002926603 6:1609116-1609138 AAGCAGGGCGGCCCGCAGCGGGG + Intergenic
1003260681 6:4512761-4512783 GAGCATGCATGTCCGCAGCGTGG + Intergenic
1004025143 6:11810914-11810936 AAGCATTCGGGCCAGCAGGGAGG + Intergenic
1006861875 6:37177232-37177254 GAGCATGATGACCCCCAGGGAGG - Intergenic
1007966029 6:46004481-46004503 GAGTTGGCCGTCCCGCAGGGTGG + Intronic
1008629288 6:53348414-53348436 GCGCGCTCCGGCCCGCAGGGCGG + Intronic
1015935756 6:138404580-138404602 GAGGACGCCGGCCCCCAGGTAGG + Exonic
1017696588 6:157021722-157021744 GAGCCTGCGGGCGCGCGGGGCGG - Intronic
1020244002 7:6416686-6416708 GAGCATGGTGGCCAGCAGGGCGG + Exonic
1020509556 7:9036431-9036453 CAGCATGCAGGCCAGCAGTGTGG - Intergenic
1021796005 7:24255040-24255062 GAGCATGATGGGCAGCAGGGTGG + Intergenic
1022903986 7:34838125-34838147 CAGCATGCCTCCCCCCAGGGAGG + Intronic
1026846179 7:73700276-73700298 GAGCATGGGGGCCGGGAGGGAGG + Exonic
1030354389 7:108526310-108526332 GAGCATGACGGAGCGCAAGGCGG + Intronic
1032794782 7:135268832-135268854 GCGCATCCCGGCTCTCAGGGAGG - Intergenic
1035122267 7:156578682-156578704 CTGCATGCTGGCCAGCAGGGCGG + Intergenic
1037862044 8:22412234-22412256 GAGCATGCCGGCGGGCACAGTGG + Intronic
1038344394 8:26718799-26718821 GAGCCTGCCAGCCCCCAGGCTGG - Intergenic
1039751142 8:40479866-40479888 GATCATGCCTGCCCACAGTGGGG + Intergenic
1041044708 8:53879418-53879440 GAGCCGGGCGGCCGGCAGGGCGG - Exonic
1043116158 8:76255693-76255715 AAGCATGCCTGTCCCCAGGGAGG - Intergenic
1049383338 8:142328681-142328703 GATCGTGACGGCCCCCAGGGTGG + Intronic
1049664665 8:143837595-143837617 CAGCAGGCCGGCCCGGGGGGTGG - Intronic
1052857891 9:33418336-33418358 GGGCGTGTCGGCCCGCAGGATGG - Intergenic
1056908071 9:90671798-90671820 GAACTTGCTGGCCCACAGGGAGG - Intergenic
1059657396 9:116368941-116368963 GAGCATGCCGGGGCGCACAGAGG - Intronic
1060106788 9:120877449-120877471 GAGGATGCGCGCCCGCGGGGCGG - Intronic
1061585876 9:131568063-131568085 GAACCTGCTGGCCAGCAGGGTGG + Intergenic
1062612370 9:137380704-137380726 GGGGATGCCAGCCAGCAGGGAGG - Intronic
1198767165 X:140091580-140091602 GCGCCCGCCCGCCCGCAGGGCGG + Intergenic
1200102016 X:153692946-153692968 GAACATACCTGCCCGCAAGGGGG + Intronic