ID: 900970465

View in Genome Browser
Species Human (GRCh38)
Location 1:5989877-5989899
Sequence TGCCCTCCTAGTACAGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900970465_900970475 27 Left 900970465 1:5989877-5989899 CCCCCTGCTGTACTAGGAGGGCA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 900970475 1:5989927-5989949 GAAAGCACCTGCCACCCACACGG 0: 1
1: 0
2: 0
3: 23
4: 229
900970465_900970471 -7 Left 900970465 1:5989877-5989899 CCCCCTGCTGTACTAGGAGGGCA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 900970471 1:5989893-5989915 GAGGGCAGACACTAGGCGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 143
900970465_900970472 -6 Left 900970465 1:5989877-5989899 CCCCCTGCTGTACTAGGAGGGCA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 900970472 1:5989894-5989916 AGGGCAGACACTAGGCGGAAGGG 0: 1
1: 0
2: 0
3: 11
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900970465 Original CRISPR TGCCCTCCTAGTACAGCAGG GGG (reversed) Intronic
900513864 1:3072295-3072317 CGCCCTCATAGCACAGCTGGGGG + Intronic
900599938 1:3498623-3498645 AGCCCTCCTAGGCCTGCAGGCGG + Intronic
900970465 1:5989877-5989899 TGCCCTCCTAGTACAGCAGGGGG - Intronic
901646284 1:10718487-10718509 TGCCCTCCTTGGGGAGCAGGTGG - Intronic
902436790 1:16403251-16403273 CACCCTCCTAGTGCAGCAAGAGG - Intronic
902787884 1:18745011-18745033 TGGCCTCCTAGGACAACAGGGGG - Intronic
902984401 1:20146813-20146835 TGCCCCCCTATTAAAGCAGCTGG + Intronic
904538431 1:31216594-31216616 TGCCCTGCTAGGAGAGCTGGAGG + Intronic
905563078 1:38942338-38942360 TGTCTTCCTAGTAGAGTAGGAGG - Intergenic
907324543 1:53628453-53628475 TGCCCACCTTGTACAGCACTGGG + Intronic
909185088 1:72477362-72477384 TCACCTCCTAGGACTGCAGGAGG - Intergenic
912827971 1:112923732-112923754 TGCCCTCCTGGTGCAGCTGGTGG - Intronic
918647056 1:186917335-186917357 AGCTCTCCTAGTATAGGAGGAGG + Intronic
920648452 1:207819868-207819890 TGCCTTCCTCGTACAAGAGGAGG - Intergenic
922605797 1:226889108-226889130 TGCCCTCCTTGTGCAGCACTGGG - Intronic
1067275804 10:44833120-44833142 TGTCCTCCCAGCACAGCAGTTGG - Intergenic
1070140115 10:73732694-73732716 TGCGCTCCTACTCCAGCAGCTGG - Intergenic
1071211610 10:83348255-83348277 TGCTGTCCTAATAGAGCAGGAGG + Intergenic
1071611787 10:87038554-87038576 TGCCCTGCAAGTACTGCAGCAGG - Intergenic
1071805679 10:89118169-89118191 TGCCTTCCTATTACTGCTGGAGG + Intergenic
1074522755 10:114239930-114239952 TGCCCTCCTGGCACAGTAGCGGG + Intronic
1075440244 10:122474469-122474491 TGCCCCCCTGGTGCAGGAGGAGG - Intronic
1077177093 11:1195906-1195928 AGCCCTCATAGAACAGCAGTGGG - Intronic
1077266953 11:1655566-1655588 TGCCCTGCTGGTCCAGCATGCGG - Intergenic
1077407459 11:2388997-2389019 TGTCCTCCTGGAGCAGCAGGGGG + Intronic
1092457073 12:8653391-8653413 TGCCCTGGGAGTACAGTAGGGGG + Intronic
1098134990 12:67392529-67392551 TGGCCCCCTAATAAAGCAGGGGG + Intergenic
1103133166 12:118486081-118486103 TCCCCTCCTAGTAAAGGAGTGGG + Intergenic
1105437062 13:20388563-20388585 TGCCCTTCAAGTTCAGCTGGTGG - Intergenic
1105611705 13:21974686-21974708 TGCCCACCTAGCCCCGCAGGGGG + Intergenic
1106409508 13:29501431-29501453 TCCCCTCCCAGTGCTGCAGGAGG - Intronic
1109473304 13:62841522-62841544 TGCCCACCTAACATAGCAGGAGG - Intergenic
1111758938 13:92437058-92437080 TGCAATCCCAGAACAGCAGGTGG + Intronic
1112575170 13:100628890-100628912 TGTAATCCTAGTACTGCAGGAGG + Intronic
1113767779 13:112891709-112891731 TCCCCTGCGAGCACAGCAGGAGG - Intergenic
1118275021 14:64378626-64378648 TGCAATCCTAGTACTTCAGGAGG + Intergenic
1120791884 14:88591637-88591659 TTCCCTCCGAGCAAAGCAGGGGG - Intronic
1122242479 14:100378019-100378041 GGCACTCCTAGGACAGCAGAGGG - Intronic
1123026133 14:105425128-105425150 AGCACTCCAAGTTCAGCAGGAGG - Intronic
1123113353 14:105883007-105883029 CAGCCTCCTAGGACAGCAGGAGG + Intergenic
1123121918 14:105920647-105920669 CAGCCTCCTAGGACAGCAGGAGG + Intronic
1123404609 15:20012296-20012318 CAGCCTCCTAGGACAGCAGGAGG + Intergenic
1123513942 15:21018943-21018965 CAGCCTCCTAGGACAGCAGGAGG + Intergenic
1124955821 15:34359691-34359713 AGCCGTCTTTGTACAGCAGGCGG + Exonic
1127248640 15:57206672-57206694 AGCCTTCCGAGTACAGGAGGTGG - Intronic
1129739222 15:77981904-77981926 TGCTTTCCTAGAACAGCAGCTGG - Intergenic
1129846733 15:78771285-78771307 TGCTCTCCTGGAACAGCAGCTGG + Exonic
1130255165 15:82322606-82322628 TGCTCTCCTGGAACAGCAGCTGG - Intergenic
1130599809 15:85267400-85267422 TGCTCTCCTGGAACAGCAGCTGG + Intergenic
1130601902 15:85281248-85281270 GGCCCTCCTAGGAGAGGAGGCGG + Intergenic
1130767006 15:86880919-86880941 GGCCCTCCTAGGAGAGGAGGCGG - Intronic
1130960754 15:88657313-88657335 TGCCATCCTAGGACAGCTGAGGG - Intergenic
1132303290 15:100789591-100789613 TGCCCTCCTGGCACAGGGGGAGG - Intergenic
1136538315 16:30913471-30913493 TGCCATGGTAGTAGAGCAGGGGG + Intergenic
1137553951 16:49458534-49458556 TGCCATCCTTGGGCAGCAGGTGG - Intergenic
1138453196 16:57105974-57105996 TCCCCTCCTACCCCAGCAGGAGG - Intronic
1139551477 16:67675394-67675416 TGCCCTTCAGGTACAGCAGCGGG + Exonic
1140113263 16:72021296-72021318 TGCCCACCTTGGTCAGCAGGCGG - Exonic
1141669740 16:85485510-85485532 TGCCCTCCCAGAACGGCAGGCGG - Intergenic
1143062670 17:4215511-4215533 TTCCTTCCAAGGACAGCAGGGGG + Intronic
1144490572 17:15704840-15704862 TCACCTCCTTGTACACCAGGCGG + Intronic
1145810814 17:27762985-27763007 AGCCCTCAGAGTACAGCAAGTGG - Exonic
1147460508 17:40565215-40565237 ACCCCTCCTGGGACAGCAGGGGG + Intronic
1147604620 17:41767510-41767532 CGCCCTCCTGGTACAGGAGCAGG + Exonic
1147949355 17:44098345-44098367 AGCCTTCCTAGTCCACCAGGAGG - Intronic
1150529297 17:65959761-65959783 TGCCCACCCACTGCAGCAGGTGG + Intronic
1152597571 17:81245501-81245523 TGCCCTCCTCGGCCAGCAGCAGG - Exonic
1153732472 18:8028746-8028768 TGCCTTGCTAGTACATCAGCTGG + Intronic
1155925523 18:31651553-31651575 TGTTTTCCTAGTAAAGCAGGAGG - Intronic
1156781387 18:40854577-40854599 TTCCCTCCCATCACAGCAGGTGG + Intergenic
1161947136 19:7444436-7444458 CGACCTCCTGGTTCAGCAGGTGG + Exonic
1165930791 19:39357058-39357080 TGGCCTCCGACTCCAGCAGGTGG - Exonic
1168301321 19:55406905-55406927 TCACCTCCTTGTACACCAGGCGG + Exonic
925898160 2:8488914-8488936 TGCCTCCCTAGCACAGCAGGTGG - Intergenic
926063877 2:9821983-9822005 CGGCCTCCTAACACAGCAGGGGG - Intergenic
932239296 2:70144437-70144459 TGCTCGCTTGGTACAGCAGGTGG + Intergenic
932775843 2:74527936-74527958 TGCACTCCGTGTACAACAGGTGG - Exonic
934895336 2:98114560-98114582 TGCCTTCCTAGTAAGGCAGAGGG + Intronic
937000935 2:118466886-118466908 GGCCCTGCTAGGACAGTAGGAGG - Intergenic
937438443 2:121897739-121897761 TGCTCTCCTTGGCCAGCAGGTGG + Intergenic
938924648 2:136028129-136028151 CACCCTCCTAGTACTGCAGTCGG - Intergenic
939362762 2:141195202-141195224 TGCCCTCATAGCATGGCAGGTGG - Intronic
940907201 2:159179970-159179992 AGCCCTGTTACTACAGCAGGGGG - Intronic
944936123 2:204570395-204570417 TGCCTTGCTAATACAGAAGGCGG - Intronic
946403069 2:219478961-219478983 TGCCCTCAGAGGACAGGAGGTGG + Intronic
1169357220 20:4917415-4917437 TGCCATCACAGCACAGCAGGGGG + Intronic
1169514834 20:6304259-6304281 TGGCCTCCTACTAAAGGAGGGGG - Intergenic
1170398837 20:15958297-15958319 TGCCATCCTAGGACACCAGCAGG + Intronic
1170959963 20:21016480-21016502 TGCCTTCCAAGTAAAGCAAGTGG + Intergenic
1172357006 20:34287250-34287272 TACCCTCCTGGTACAACAGTGGG + Intronic
1174282856 20:49452075-49452097 TGCCCTCCCGTTACAGCTGGGGG + Intronic
1178060084 21:28843351-28843373 TGCTATCCTAGAACAGCATGGGG + Intergenic
1180499653 22:15920780-15920802 TGCCCACCTAGGACTTCAGGGGG + Intergenic
1183552187 22:38495886-38495908 TGCCCAGCAAGTACAGCAGGTGG - Exonic
1184183992 22:42851649-42851671 TAGCCTCCTGGTATAGCAGGAGG - Intronic
1185340798 22:50290173-50290195 TGCCGTCCTCGTAGAACAGGCGG + Exonic
949110157 3:250539-250561 TGTCCTCCTGGTACAGCAGTGGG + Intronic
949118997 3:362810-362832 TGTTCTCCCAGGACAGCAGGAGG + Intronic
950641009 3:14348175-14348197 TGCAATCCTAGTACTTCAGGAGG + Intergenic
952653196 3:35751037-35751059 TGCCTTCCTAATAGACCAGGAGG + Intronic
955082667 3:55672545-55672567 TGCCCTCCTCGTAGAGCTGATGG + Intronic
956574711 3:70739466-70739488 TGACCTCCTAGTACAGAGGAGGG + Intergenic
958421107 3:93932812-93932834 TGCCCTCCTTGAACAGAGGGTGG - Intronic
959066324 3:101660878-101660900 TCTCCTCCCAGTACAGCTGGGGG - Intronic
966988303 3:185202564-185202586 TGACCTGTTAGCACAGCAGGAGG + Intronic
968541797 4:1171808-1171830 AGCCCTCCTGGTGGAGCAGGAGG + Intronic
968892335 4:3376068-3376090 TGTCCTCCTGGGACAGCAGTAGG - Intronic
974187158 4:58459583-58459605 AGCCCTCCTAGACCACCAGGAGG - Intergenic
976741323 4:88360443-88360465 AGCCCTCATAGTGCAGCAGCGGG - Intergenic
982028586 4:151276934-151276956 TGCTCTCCCAGGACAGCAGGGGG + Intronic
987923648 5:24314229-24314251 GGCCCTCCTAGCACAGCTGCTGG - Intergenic
988025010 5:25674202-25674224 TCCCCTGCTATTACAGCATGGGG + Intergenic
991922205 5:71668122-71668144 TACTCTCCTAGTACAGCCGTGGG - Intergenic
992049192 5:72927730-72927752 TGTCCTCCTAGTCCACAAGGAGG - Intergenic
992293216 5:75302427-75302449 TGCCAGCCTAGGAGAGCAGGTGG - Intergenic
992509225 5:77416804-77416826 TGCTCTCCTAGGCCTGCAGGAGG - Intronic
995208387 5:109508602-109508624 TGCCCACCTGCTACAGCAGCAGG - Intergenic
995544730 5:113218444-113218466 TGCCCTCCTGGTTGAGCGGGCGG - Intronic
996679915 5:126220839-126220861 GGCCCTCATAGCACAGCAGTAGG - Intergenic
997433179 5:133855510-133855532 TTCCCTCCTAGCCCAGGAGGAGG + Intergenic
998639974 5:143998256-143998278 TGGGCTCCTACTAGAGCAGGTGG - Intergenic
999032901 5:148314335-148314357 TTCCCACCCAGAACAGCAGGTGG + Intronic
1005221611 6:23594523-23594545 TGCCCTCATTGTGCAGCAGCAGG + Intergenic
1006025670 6:31145187-31145209 TGCCCGCCTCATCCAGCAGGAGG - Exonic
1006516052 6:34546356-34546378 TGCCCTACTGGGACAGCAGGAGG + Intronic
1006833166 6:36981200-36981222 GGCCCTGCTACTCCAGCAGGAGG - Intronic
1019754677 7:2760334-2760356 TGCCTTACCAGTACACCAGGGGG + Intronic
1022965381 7:35467015-35467037 TGCCCTCCAAGTCCGGCTGGTGG + Intergenic
1025041331 7:55648579-55648601 TGCTCTCCTAGGGCAGGAGGAGG - Intergenic
1026265906 7:68795924-68795946 ATCCCTCCTAGTGCAGCAGAAGG + Intergenic
1026619240 7:71935752-71935774 TGCCCTGGCAGTACAGGAGGAGG - Intronic
1032085160 7:128879959-128879981 TGCCCTGGAAGTGCAGCAGGCGG + Exonic
1033905498 7:146196863-146196885 TGCACTCCTAGTACTCTAGGAGG + Intronic
1035083439 7:156236352-156236374 TATCCTCCTTGAACAGCAGGCGG - Intergenic
1036517470 8:9458158-9458180 TGGCCCCCTACTACAACAGGTGG - Intergenic
1039444375 8:37619316-37619338 TCCCCTCAAAGGACAGCAGGGGG - Intergenic
1041209412 8:55533540-55533562 TTCCCTCCTCTTACAGCAGGAGG - Exonic
1041977399 8:63815781-63815803 AGCCCTCCCAGGACAGCAGCAGG - Intergenic
1047283123 8:123462993-123463015 TGCTCTCTTGGTACACCAGGGGG + Intronic
1053426361 9:38012729-38012751 TGCCCTCCGTGTGCCGCAGGTGG - Intronic
1053557224 9:39149858-39149880 TCCCATCTTAGTACAGCAGGGGG - Exonic
1053749303 9:41236443-41236465 TGCTCTCCTTCTGCAGCAGGAGG - Intergenic
1053821332 9:41970126-41970148 TCCCATCTTAGTACAGCAGGGGG - Exonic
1054090209 9:60838278-60838300 TCCCATCTTAGTACAGCAGGGGG - Intergenic
1054111620 9:61113835-61113857 TCCCATCTTAGTACAGCAGGGGG - Intergenic
1054254744 9:62801294-62801316 TGCTCTCCTTCTGCAGCAGGAGG - Intergenic
1054609237 9:67217290-67217312 TCCCATCTTAGTACAGCAGGGGG + Intergenic
1056082158 9:83106638-83106660 AGCCATCCTAGTGGAGCAGGTGG - Intergenic
1057255681 9:93545255-93545277 GGCCCTCCCAGTGCAGCATGAGG + Intronic
1059801121 9:117750492-117750514 TCCTCTCCAAGTACAGGAGGAGG + Intergenic
1060134171 9:121135826-121135848 TGCCCTCCAAGAGCAGCATGAGG + Exonic
1192900070 X:75487013-75487035 TACCCTTCTACTACAGCAGAAGG + Intronic
1195328515 X:103777343-103777365 TGCCCTCCTGGTTCTGCTGGAGG + Intronic