ID: 900970942

View in Genome Browser
Species Human (GRCh38)
Location 1:5992187-5992209
Sequence TCCAACCTCCCCCGCGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900970931_900970942 23 Left 900970931 1:5992141-5992163 CCGAGGCTCTGGCCAACACTGAG 0: 1
1: 0
2: 2
3: 33
4: 291
Right 900970942 1:5992187-5992209 TCCAACCTCCCCCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 101
900970936_900970942 -2 Left 900970936 1:5992166-5992188 CCCCTGTGCCTCGAGGCCGCGTC 0: 1
1: 0
2: 0
3: 7
4: 60
Right 900970942 1:5992187-5992209 TCCAACCTCCCCCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 101
900970930_900970942 24 Left 900970930 1:5992140-5992162 CCCGAGGCTCTGGCCAACACTGA 0: 1
1: 0
2: 0
3: 33
4: 257
Right 900970942 1:5992187-5992209 TCCAACCTCCCCCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 101
900970935_900970942 -1 Left 900970935 1:5992165-5992187 CCCCCTGTGCCTCGAGGCCGCGT 0: 1
1: 0
2: 1
3: 1
4: 65
Right 900970942 1:5992187-5992209 TCCAACCTCCCCCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 101
900970938_900970942 -4 Left 900970938 1:5992168-5992190 CCTGTGCCTCGAGGCCGCGTCCA 0: 1
1: 0
2: 0
3: 1
4: 62
Right 900970942 1:5992187-5992209 TCCAACCTCCCCCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 101
900970937_900970942 -3 Left 900970937 1:5992167-5992189 CCCTGTGCCTCGAGGCCGCGTCC 0: 1
1: 0
2: 0
3: 2
4: 77
Right 900970942 1:5992187-5992209 TCCAACCTCCCCCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 101
900970933_900970942 11 Left 900970933 1:5992153-5992175 CCAACACTGAGGCCCCCTGTGCC 0: 2
1: 0
2: 3
3: 26
4: 243
Right 900970942 1:5992187-5992209 TCCAACCTCCCCCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 101
900970939_900970942 -10 Left 900970939 1:5992174-5992196 CCTCGAGGCCGCGTCCAACCTCC 0: 1
1: 0
2: 0
3: 3
4: 75
Right 900970942 1:5992187-5992209 TCCAACCTCCCCCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 101
900970929_900970942 25 Left 900970929 1:5992139-5992161 CCCCGAGGCTCTGGCCAACACTG 0: 1
1: 0
2: 0
3: 17
4: 187
Right 900970942 1:5992187-5992209 TCCAACCTCCCCCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 101
900970928_900970942 30 Left 900970928 1:5992134-5992156 CCGAACCCCGAGGCTCTGGCCAA 0: 1
1: 0
2: 0
3: 12
4: 182
Right 900970942 1:5992187-5992209 TCCAACCTCCCCCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900970942 Original CRISPR TCCAACCTCCCCCGCGGCGC CGG Intronic
900970942 1:5992187-5992209 TCCAACCTCCCCCGCGGCGCCGG + Intronic
902531714 1:17094791-17094813 TCCAACCTCCCCCAAGGGGCTGG - Intronic
910288102 1:85576762-85576784 GCCAGCCTCCCACGCAGCGCAGG + Intronic
923056083 1:230426458-230426480 CCCACCCTCCTCCGCGGGGCGGG + Intergenic
1066526566 10:36285872-36285894 TCCAACCTCCCCCCAGTCTCTGG + Intergenic
1067269445 10:44776896-44776918 TGCAACCTCCCCACCGCCGCTGG + Intergenic
1068079966 10:52308389-52308411 TCCCACCTCCCCCCGGACGCCGG + Intergenic
1069992351 10:72323383-72323405 TCCAGCCTGCCCCGGGGCTCTGG - Intergenic
1070722053 10:78763787-78763809 TCCATCTTCCCCCACGGCCCTGG - Intergenic
1074747912 10:116553782-116553804 TCCAGCCTCCCCAGCAGCGTGGG - Exonic
1076947836 10:133664529-133664551 CCCAACCTGCCCCGGCGCGCGGG + Intergenic
1076948826 10:133667839-133667861 CCCAACCTGCCCCGGCGCGCGGG + Exonic
1076949810 10:133671138-133671160 CCCAACCTGCCCCGGCGCGCGGG + Intronic
1076950794 10:133674437-133674459 CCCAACCTGCCCCGGCGCGCGGG + Intergenic
1076951784 10:133677747-133677769 CCCAACCTGCCCCGGCGCGCGGG + Intergenic
1076952773 10:133681057-133681079 CCCAACCTGCCCCGGCGCGCGGG + Intergenic
1076953757 10:133684356-133684378 CCCAACCTGCCCCGGCGCGCGGG + Intergenic
1076954741 10:133740708-133740730 CCCAACCTGCCCCGGCGCGCGGG + Intergenic
1076955730 10:133744018-133744040 CCCAACCTGCCCCGGCGCGCGGG + Intergenic
1076956720 10:133747328-133747350 CCCAACCTGCCCCGGCGCGCGGG + Intergenic
1076957707 10:133750637-133750659 CCCAACCTGCCCCGGCGCGCGGG + Intergenic
1076958692 10:133753936-133753958 CCCAACCTGCCCCGGCGCGCGGG + Intergenic
1076959681 10:133757246-133757268 CCCAACCTGCCCCGGCGCGCGGG + Intergenic
1076960665 10:133760545-133760567 CCCAACCTGCCCCGGCGCGCGGG + Intergenic
1077008064 11:368553-368575 TCCAGCCTGTCCCGCGGAGCCGG + Intergenic
1077110579 11:860412-860434 TCCAACCTCCAGCCTGGCGCTGG + Intronic
1077264981 11:1644108-1644130 TCCAAACTCCCCCGGGGCAAGGG - Intergenic
1085197940 11:74683555-74683577 TCCCGCCGCCCCCGCGGCCCAGG + Intergenic
1089688037 11:120169306-120169328 TCCCACCGCCCCCACGGCCCCGG - Intronic
1091558550 12:1594072-1594094 TCCTCCCCCCTCCGCGGCGCTGG + Exonic
1093435471 12:19130201-19130223 CGCAACCTGCCCCGCGCCGCGGG + Intronic
1095810855 12:46372340-46372362 TCCACCCTGGCCCGCCGCGCGGG - Intronic
1096674922 12:53221211-53221233 TCCGCCCTCCGCCGCGGCCCGGG + Intronic
1102934038 12:116882012-116882034 TCCAGCCTCCCACCGGGCGCTGG - Intergenic
1104710297 12:130980962-130980984 TCCCTCCTCCCCCGCAGCGTGGG + Intronic
1106602675 13:31200602-31200624 TCCAGCCTCCCGCCCGGCGCGGG - Intronic
1122183529 14:99972069-99972091 TGCCACCTCCCACGAGGCGCCGG - Intronic
1132851933 16:2028734-2028756 TCCACCCTCCCCCAGGCCGCAGG + Intronic
1133021625 16:2969451-2969473 CCCAGCCTCCGCCCCGGCGCGGG + Exonic
1134134353 16:11669191-11669213 TCCACCCTGCCCGGCGGCGCCGG - Intronic
1139528245 16:67529276-67529298 CCCAGCCTCCCCTGCGGCGAAGG - Intronic
1141468633 16:84223383-84223405 TCCCTCCTCCCCTGGGGCGCTGG - Intronic
1142376879 16:89711144-89711166 TCCAACCTCCCCAGCGGGGGCGG - Intronic
1144771373 17:17761499-17761521 TCCACCATCCCCCGGGGCACTGG - Intronic
1147285734 17:39401565-39401587 TCCACCACCTCCCGCGGCGCCGG + Exonic
1147666990 17:42155087-42155109 GCCGACCTACCCAGCGGCGCCGG + Intergenic
1150217103 17:63476962-63476984 TCCAGAGTCCCCAGCGGCGCGGG - Intergenic
1152625673 17:81386990-81387012 TCCTCCCTCCCCCGCTGTGCTGG + Intergenic
1155984796 18:32218634-32218656 TCCAACCTCACCCTCTGCCCAGG - Intronic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1163027046 19:14518478-14518500 CCCGCCCGCCCCCGCGGCGCCGG + Intronic
1168688460 19:58362603-58362625 TCCAACCACTCCCGCCGCGCGGG - Intronic
931649410 2:64454515-64454537 TCCCACGTACCCCGCCGCGCCGG + Exonic
935990481 2:108714768-108714790 TGCAAGCTCCCCCTCGGTGCCGG + Intergenic
937160931 2:119760171-119760193 TGCCACCTCCCCAGCGGCGCCGG + Exonic
940775077 2:157876284-157876306 CGCAGCCTCCCCCTCGGCGCAGG - Intergenic
944811073 2:203328219-203328241 CCCACCCTCGCCCGCGCCGCCGG - Exonic
1169767698 20:9166067-9166089 TCCAACCTCCCCAGTTGGGCTGG - Intronic
1169789407 20:9393328-9393350 TCCAACCTCCCCAGTGGAGCAGG - Intronic
1171939296 20:31309166-31309188 TCCACCCTCCCTCGAGGCTCTGG + Intergenic
1174305362 20:49610985-49611007 TCCACCCTCCCCAGAGGCTCAGG - Intergenic
1176055109 20:63141157-63141179 TCCCACCTCCCACCCGGCTCAGG - Intergenic
1177783025 21:25639943-25639965 TCCAGCCCCCCACGGGGCGCTGG + Intronic
1177835139 21:26179441-26179463 TGCAGCCTCCCCCGCTGCCCCGG + Intergenic
1181632405 22:24158058-24158080 TCCAGCATCCCCCGTGGCACGGG - Intronic
1183020788 22:35024275-35024297 TCCAGCCACCTCCGCCGCGCAGG - Intergenic
1183702476 22:39457924-39457946 CACAACCTCCGGCGCGGCGCGGG + Intronic
1184691008 22:46117232-46117254 TCCAGCCTCCCCCCAGGCTCTGG - Intergenic
950260924 3:11543084-11543106 TCCAACCGACCCCACGGTGCAGG + Intronic
950292315 3:11795300-11795322 CCCAACCTCCCCCTCTGCTCAGG + Intronic
953352951 3:42229815-42229837 ACCAGCCTCCCCCGCAGCTCTGG + Intergenic
953837758 3:46362017-46362039 TCCAACCTCCCCAGCTGCTGGGG - Intergenic
961446316 3:126983299-126983321 CGCAACTTTCCCCGCGGCGCGGG + Intergenic
969438314 4:7201173-7201195 TCCAACCTCCTCCTCAGCCCGGG - Intronic
975689581 4:76950298-76950320 TCCAGTCTCCCCCGCGCCGAGGG + Intronic
978152457 4:105453231-105453253 TCCTCCCTCCCCCGAGGCCCTGG - Intronic
985446092 4:190021955-190021977 CCCAACCTGCCCCGGCGCGCGGG - Intergenic
985451289 4:190065328-190065350 CCCAACCTGCCCCGGCGCGCGGG + Intergenic
985452280 4:190068623-190068645 CCCAACCTGCCCCGGCGCGCGGG + Intergenic
985453265 4:190071920-190071942 CCCAACCTGCCCCGGCGCGCGGG + Exonic
985454255 4:190075213-190075235 CCCAACCTGCCCCGGCGCGCGGG + Exonic
985455243 4:190078506-190078528 CCCAACCTGCCCCGGCGCGCGGG + Exonic
985456231 4:190081806-190081828 CCCAACCTGCCCCGGCGCGCGGG + Exonic
985457215 4:190085100-190085122 CCCAACCTGCCCCGGCGCGCGGG + Intergenic
985458202 4:190088393-190088415 CCCAACCTGCCCCGGCGCGCGGG + Exonic
985459191 4:190091693-190091715 CCCAACCTGCCCCGGCGCGCGGG + Exonic
985463443 4:190174462-190174484 CCCAACCTGCCCCGGCGCGCGGG + Exonic
988726951 5:33936052-33936074 TCAACTCTCCCTCGCGGCGCGGG + Intergenic
990946172 5:61252164-61252186 TCCTCCCTTCCCAGCGGCGCTGG + Intergenic
992460236 5:76953724-76953746 TCCCACCTTCCCCGCGTCCCGGG - Intronic
996088067 5:119324338-119324360 CCCAACTTCCCCCTCGGGGCTGG + Intronic
1006057400 6:31395702-31395724 TCCAGCCTCTCCCTCAGCGCTGG - Intergenic
1019168731 6:170116810-170116832 TGCAACGTCCCCATCGGCGCTGG + Intergenic
1032279763 7:130491393-130491415 TCCAGCCACCGCCGCTGCGCGGG - Intronic
1034139576 7:148803266-148803288 TCCACCCTGCCCTGTGGCGCCGG + Intergenic
1034197846 7:149262006-149262028 CCCACCCTCACCCGGGGCGCGGG - Intergenic
1035312601 7:157979093-157979115 TCCCATCGCCCCCGCGGCCCTGG + Intronic
1035571998 8:678884-678906 TCCAACGTCCCTCACGGCTCTGG + Intronic
1038304043 8:26383295-26383317 TCCCGCCTCCCGCGCCGCGCCGG - Intronic
1045489096 8:102655758-102655780 CCCACCCCCGCCCGCGGCGCGGG - Exonic
1057040341 9:91843330-91843352 TCCACGCTCCCCCGTGGGGCAGG + Intronic
1057900529 9:98944444-98944466 TCCAACCGCCCCAGCTGCCCAGG - Intronic
1059803381 9:117773271-117773293 TCCAGCCTCCCCAGCGACCCTGG + Intergenic
1060780636 9:126409700-126409722 GGCAACCTCCCCTGCGGAGCTGG + Intronic
1061329658 9:129884633-129884655 TGCAGCCTCCCCCACGGTGCAGG - Intergenic
1062423978 9:136497646-136497668 TACAACCTCCTCCGCGGGGTGGG + Intronic
1187441894 X:19328153-19328175 TCCATCCTCTCCCGTGGCCCGGG - Intergenic
1188331695 X:28880310-28880332 TCCAACCTCCCACACAGTGCAGG + Intronic
1200121817 X:153794733-153794755 TCCAGCCTCTCCCGCTGCTCAGG + Exonic