ID: 900972074

View in Genome Browser
Species Human (GRCh38)
Location 1:5997243-5997265
Sequence GTCCCAGGAAACCACGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900972074_900972078 -1 Left 900972074 1:5997243-5997265 CCTTCTGCGTGGTTTCCTGGGAC 0: 1
1: 0
2: 1
3: 11
4: 155
Right 900972078 1:5997265-5997287 CCTCTTGGCAGTCTCTCAGCTGG 0: 1
1: 0
2: 0
3: 17
4: 197
900972074_900972081 27 Left 900972074 1:5997243-5997265 CCTTCTGCGTGGTTTCCTGGGAC 0: 1
1: 0
2: 1
3: 11
4: 155
Right 900972081 1:5997293-5997315 CCTGCTGAGTGATTTCACAGTGG 0: 1
1: 0
2: 1
3: 17
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900972074 Original CRISPR GTCCCAGGAAACCACGCAGA AGG (reversed) Intronic
900301568 1:1980584-1980606 GTCCCAGGAACCCCCAAAGAAGG - Intronic
900972074 1:5997243-5997265 GTCCCAGGAAACCACGCAGAAGG - Intronic
901225520 1:7610935-7610957 GTCCCAGGCCCCCAGGCAGAGGG + Intronic
901321427 1:8342576-8342598 GACCCAGGAAACAGCACAGATGG - Intronic
901799867 1:11701762-11701784 GCACCAGGCAACCAGGCAGAAGG - Intronic
914714436 1:150242525-150242547 GTCCCAGAAAACCACCCAACAGG + Intergenic
916550870 1:165848869-165848891 GTCATAGGAAAGCACTCAGATGG + Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
920125244 1:203689132-203689154 TCCACAGGAAACCACACAGAAGG - Intronic
920860103 1:209698938-209698960 GTAACAGGAAAGCACACAGAGGG + Intronic
922604689 1:226882206-226882228 GTCCTATGAAACCCTGCAGATGG - Intronic
1064156739 10:12909043-12909065 GTCCAAGGATACCAGGAAGATGG - Intronic
1066457509 10:35585072-35585094 GGCCCAGGCACCCAGGCAGATGG - Intergenic
1067654802 10:48183326-48183348 GTCTCAGGAAACTAGGGAGAAGG + Intronic
1068198182 10:53745687-53745709 CTCCCAAGAAGCCAAGCAGAGGG - Intergenic
1070736702 10:78867988-78868010 GTCCCAGGAAATCACGCTTCAGG + Intergenic
1071677929 10:87673953-87673975 GTCCCAAGATAACATGCAGAAGG - Intronic
1072836075 10:98713826-98713848 GACCCAGTAAACCAAGCACATGG - Intronic
1073466395 10:103696841-103696863 GTCCCAGGAAAACAGGGACATGG + Intronic
1075608795 10:123835228-123835250 TCCCCAGGAAACCCCCCAGATGG - Intronic
1075850239 10:125580848-125580870 GTCCCAGGAAAGGACTCTGATGG - Intronic
1076871964 10:133198801-133198823 GCCCCAGCAAACCAGCCAGAGGG + Exonic
1077519951 11:3027018-3027040 GTCACAGGACGCCAGGCAGAGGG - Intronic
1078090322 11:8261025-8261047 GTTCCAGGAAACCTTGAAGATGG - Intronic
1081549937 11:44101584-44101606 CTCCCAGGAAAACAGGCAGGAGG - Intronic
1082582497 11:54890020-54890042 ATCCCAGGAAAAAAAGCAGAAGG + Intergenic
1082773137 11:57224296-57224318 GTCCCAGGAAGCCAGGCAGGGGG - Intergenic
1082932436 11:58622716-58622738 GTCCCAGGAAACAAGTCAGCTGG - Exonic
1083289835 11:61683634-61683656 GTCCCAGCATCCCAAGCAGAAGG - Intronic
1084558894 11:69891673-69891695 TTTCCAGGAAGGCACGCAGAAGG + Intergenic
1085046510 11:73356717-73356739 GTCTCAGGAACCGCCGCAGAGGG - Exonic
1089630340 11:119780307-119780329 GACTCAGGAAACCACACACATGG - Intergenic
1090630676 11:128644479-128644501 GTCCCAGCAGTCCATGCAGAAGG + Intergenic
1092996950 12:13959570-13959592 ATCCAAGGAAACCATGCGGAGGG + Intronic
1095612811 12:44150376-44150398 GTCCCAGGAGATCAGGCTGAGGG - Intronic
1096693642 12:53335665-53335687 GTCCCAAGGAGCCAGGCAGATGG + Exonic
1098130543 12:67345437-67345459 CTACCAGGAAGCCAGGCAGAAGG - Intergenic
1101464691 12:104936313-104936335 GGCCCAGGAAACCTTGCAGTGGG + Intronic
1101840518 12:108324495-108324517 CTCCAAGCAAGCCACGCAGACGG + Intronic
1103941625 12:124504294-124504316 GTCCCAGGAAACTGCCCAGAGGG - Intronic
1108127133 13:47256667-47256689 GACTCAGGAAAACAGGCAGAGGG + Intergenic
1110324837 13:74201937-74201959 GTCCCAGGTAACCTGGCTGAAGG - Intergenic
1112174801 13:97011527-97011549 TTCCCAGGAAACCAGCAAGAAGG - Intergenic
1116243469 14:42378677-42378699 GTCCCTGGAATCCTGGCAGAAGG + Intergenic
1116679921 14:47953991-47954013 GTCCCTGAAAACCATTCAGAGGG + Intergenic
1119654140 14:76404916-76404938 GACCCAGGAAGCCCCTCAGAAGG + Intronic
1120907157 14:89630590-89630612 GACCTAGGAGACCAAGCAGATGG + Intronic
1121016543 14:90552610-90552632 GGTCCAGGAACCCACACAGAAGG + Intronic
1121871973 14:97416442-97416464 GTCCTTGTAAACCACCCAGAGGG - Intergenic
1121945715 14:98119770-98119792 GTCTCTGGGACCCACGCAGAGGG - Intergenic
1122706270 14:103624111-103624133 GTCCCAGGGGACCGCCCAGACGG + Intronic
1123066481 14:105621884-105621906 GGCCCTGGACACCCCGCAGAGGG + Intergenic
1123075216 14:105664598-105664620 GGCCCTGGACACCCCGCAGAGGG + Intergenic
1123089865 14:105737734-105737756 GGCCCTGGACACCCCGCAGAGGG + Intergenic
1123095648 14:105765886-105765908 GGCCCTGGACACCCCGCAGAGGG + Intergenic
1123895375 15:24823687-24823709 GCCCCCGCAAACCACACAGAAGG - Exonic
1125246272 15:37644778-37644800 GTCTCAGGAAAGCATGGAGAAGG + Intergenic
1128576365 15:68778012-68778034 GTGCCAGGGTACCACCCAGAGGG + Intergenic
1135048868 16:19176362-19176384 CACCCAGGAAACCAGGGAGATGG + Intronic
1135499471 16:22981300-22981322 TTCCCAGGAGACCAGGGAGAAGG + Intergenic
1135566035 16:23511582-23511604 GTTCCAGGAAACCAGGGAGGTGG - Intronic
1136012302 16:27371797-27371819 GTCCCAGGGAAGCAGGCAGGAGG - Intergenic
1136686669 16:31999009-31999031 GTCCAAGGAAGCCCCACAGAAGG + Intergenic
1136787282 16:32942546-32942568 GTCCAAGGAAGCCCCACAGAAGG + Intergenic
1139477023 16:67207842-67207864 GTCCGATGACACCAGGCAGATGG - Intronic
1140217507 16:73020316-73020338 GCCCAAGGAAACCACGAAGAGGG + Intronic
1140460545 16:75136155-75136177 GTCCCAGGAAAAAATGCAGATGG + Intergenic
1141065934 16:80913857-80913879 GTCCAAGGAAGCCATGGAGATGG + Intergenic
1141324432 16:83042462-83042484 GTCGCAGGAAAACAAGCTGAGGG + Intronic
1142024252 16:87804102-87804124 GTGCCAGGAGACCATGGAGAAGG + Intergenic
1142053455 16:87975753-87975775 GTTCCATGACACCACGCACAGGG - Intronic
1203089515 16_KI270728v1_random:1204218-1204240 GTCCAAGGAAGCCCCACAGAAGG + Intergenic
1142969616 17:3602452-3602474 GACCCAGAAAACCACACTGATGG - Intergenic
1143102254 17:4510848-4510870 ACACCAGCAAACCACGCAGAAGG + Intronic
1143305594 17:5944127-5944149 TTGCCAGGAGACCAGGCAGAAGG - Intronic
1143907217 17:10218588-10218610 GTACAAGGAAACCCAGCAGATGG + Intergenic
1144624506 17:16837935-16837957 GTCTCAGGAAACCCCCAAGAGGG + Intergenic
1144881921 17:18434785-18434807 GTCTCAGGAAACCCCCAAGAGGG - Intergenic
1145119439 17:20244105-20244127 GTCCCAGCAAGCTACGCAGGAGG + Intronic
1145150312 17:20509601-20509623 GTCTCAGGAAACCCCCAAGAGGG + Intergenic
1147155373 17:38542130-38542152 GACCCAGGCAACCCCGGAGATGG + Intronic
1147391597 17:40112632-40112654 GTCAAAGGAAGCCATGCAGAGGG - Intergenic
1147553700 17:41463023-41463045 CTCCCTGGAAAACACGCTGACGG - Exonic
1149043686 17:52220006-52220028 GTCCCAGGTAAAGACTCAGAAGG - Intergenic
1149449163 17:56736408-56736430 GCCACAGGAAACCAGGTAGAGGG + Intergenic
1150562516 17:66305132-66305154 GTCCCAGGAAACCATCCACGGGG + Intronic
1150885784 17:69083935-69083957 CTCCCAGGAAACAAAGTAGAAGG + Intronic
1151931510 17:77234958-77234980 GTCCCAGGCAGCCACCCAGCCGG - Intergenic
1151985791 17:77542662-77542684 GTCCCAGGAAGCTTGGCAGAAGG + Intergenic
1152888041 17:82864133-82864155 GTCCCAGGCCACAACACAGATGG - Intronic
1155146579 18:23088787-23088809 ATCCCAGTAAACCTCGCTGATGG + Intergenic
1155491626 18:26406376-26406398 GTCCCTGGACACCACGCAGGGGG + Intergenic
1159443235 18:68508375-68508397 TTCCCAGGAAGCCACGTAGAGGG - Intergenic
1160298353 18:77657687-77657709 CCCCCAGGAAACCACTCAGGAGG + Intergenic
1162662455 19:12181164-12181186 GACCCAGGAGACCCCGAAGATGG + Intronic
1164742808 19:30589225-30589247 TTCCATGGAAACCATGCAGATGG - Intronic
1164957152 19:32396233-32396255 GTCCAAGGAAACAAACCAGAAGG + Intergenic
1168189847 19:54729989-54730011 GTTCCAGGCACCCAGGCAGATGG + Intronic
1168210113 19:54884100-54884122 TTCCCTGGAAAGCACCCAGATGG - Intronic
934713932 2:96532393-96532415 CTCCCAGGATACCATGCAAAGGG - Intergenic
935318594 2:101862341-101862363 GTCCCAGGAGAGCTAGCAGATGG + Intronic
935487125 2:103671753-103671775 CTCCCCAGAAACCAAGCAGATGG - Intergenic
938577986 2:132621409-132621431 GTCTCAGCAGACCACACAGAGGG + Intronic
941617642 2:167739365-167739387 GTCCAAGGAAAGAAAGCAGAGGG + Intergenic
945502412 2:210592465-210592487 GTCCCAGAGACCCACCCAGATGG - Intronic
946160019 2:217830318-217830340 GACCCATGAAGCCACGCAGCTGG - Intronic
948783445 2:240338910-240338932 CTCCCTAGAAACCAAGCAGATGG + Intergenic
1174365592 20:50054414-50054436 GTCCCAGGACACCCGGCAGCAGG + Intergenic
1178007401 21:28237087-28237109 GTCCCAGGTAACCAGGAAGGAGG + Intergenic
1179537217 21:42060422-42060444 CACCCAGGAACCCATGCAGAGGG - Intergenic
1182837329 22:33353502-33353524 GTCAGAGAAAACCACGCTGAAGG + Intronic
1183421452 22:37713940-37713962 GTCCCAGGAGACCCCCCAAAAGG + Intronic
1183746578 22:39695219-39695241 TTTCCAGGCAGCCACGCAGAGGG + Intergenic
1185088154 22:48751947-48751969 CTCCCAGGACACCACGCCCAGGG - Intronic
950024365 3:9810307-9810329 GTCCCAGGCACCCACGCCCAGGG + Exonic
951219839 3:20057404-20057426 GTCCAAGGAAACAACGTATAAGG + Intronic
951282684 3:20771987-20772009 GTCTCAGGAGACCAGGGAGAGGG + Intergenic
953006026 3:38980052-38980074 GGCCCAGGGGACCAGGCAGAAGG + Intergenic
953606343 3:44415536-44415558 GTTCAAGGAAACCACGCAGAGGG + Intergenic
953713385 3:45294457-45294479 GTCCCAGGGAAGAACCCAGATGG + Intergenic
955583057 3:60445624-60445646 TTCCCAGGAAGCCACTCACAGGG + Intronic
958152831 3:89713461-89713483 GTCTCAGGAGACCTAGCAGAGGG + Intergenic
961514740 3:127425504-127425526 GTCCCAGGAAAGCAAGCAGGTGG + Intergenic
962978055 3:140463463-140463485 TACCCAGAAAACCACTCAGAAGG + Intronic
968750102 4:2384414-2384436 GTCCTGGGAAACCAGGCAGCTGG - Intronic
969684449 4:8662926-8662948 CTCCTAGGGATCCACGCAGAAGG + Intergenic
973824467 4:54691474-54691496 GTCCCAGGGACACAGGCAGAAGG + Intronic
978384116 4:108163686-108163708 TTCCCAGGAAAGCATCCAGATGG - Exonic
984177044 4:176432033-176432055 TTCCCAGGCTACCATGCAGATGG - Intergenic
985947471 5:3197662-3197684 GTCCCAGGAAATCACGCCACAGG - Intergenic
986820577 5:11462169-11462191 GCCCCAGCATACCAAGCAGAGGG + Intronic
995078461 5:108016294-108016316 GTCTGTGGAAACCACACAGAAGG + Intronic
996116880 5:119629810-119629832 GTCCCAGGAAACCGCTGAGAAGG + Exonic
997853916 5:137356462-137356484 TTGCCAGGAACCCAAGCAGATGG + Intronic
1000897208 5:166869405-166869427 GTCCAAGTTAAACACGCAGAGGG + Intergenic
1001126888 5:169027741-169027763 GTCTCAGGAAACAAGGCAGGAGG - Intronic
1006169945 6:32086990-32087012 GTCCCGGGAAACCCCAAAGAAGG + Intronic
1006743019 6:36322715-36322737 GACCCAGAAAACCTGGCAGAGGG - Intronic
1015414454 6:132932886-132932908 GTCAGAGGTGACCACGCAGAGGG + Intergenic
1015490642 6:133821566-133821588 GTTCCAGGAAACCAGACAGAGGG + Intergenic
1016393821 6:143601695-143601717 GACCCAGGAGTCCACACAGATGG - Intronic
1019273524 7:163979-164001 GTCCCAGGCAGCCACGAGGACGG + Intergenic
1019489469 7:1305167-1305189 GTCCCAGGACCCCACGCCGCAGG - Intergenic
1024194910 7:47049328-47049350 GGCCCAGAAAGCCACGCTGATGG + Intergenic
1025174240 7:56789307-56789329 GTACCAGGAAGCCACGTGGATGG - Intergenic
1025697563 7:63787118-63787140 GTACCAGGAAGCCACGTGGATGG + Intergenic
1026222758 7:68414944-68414966 ATCCCAGGAATCCAGGCAGTTGG - Intergenic
1029574656 7:101395521-101395543 TTCCCAGGAACCCCTGCAGACGG - Intronic
1029727789 7:102419071-102419093 GTCCCAGGATGGAACGCAGAAGG - Intronic
1030616847 7:111746247-111746269 GATGCAGGAAACCATGCAGAGGG + Intronic
1034644494 7:152633245-152633267 ATCCCATGAGACCACGCAGTCGG - Intergenic
1035404466 7:158588397-158588419 GTCCCAGGAAAGCTCCCGGAGGG + Intergenic
1041132698 8:54719013-54719035 ATCTCAGGAAACAACACAGATGG + Intergenic
1041145421 8:54870975-54870997 ATCCCATGAAATCAGGCAGAGGG + Intergenic
1042547917 8:69967055-69967077 CTGCCATGAAAACACGCAGATGG + Intergenic
1042956612 8:74257807-74257829 GTCCAAGGCAACCACTGAGAAGG - Intronic
1048729768 8:137425439-137425461 GTACCAGGAATCCAGGCACATGG - Intergenic
1051835728 9:21335392-21335414 GTCCCAGGATACCACGGGGTGGG + Intergenic
1055861606 9:80756930-80756952 CTCCCCGGAAGCCAAGCAGATGG - Intergenic
1056676146 9:88678653-88678675 TTCCCAGGAAACCTGGCAGCAGG + Intergenic
1057937384 9:99252332-99252354 GACCCCGGAAAGCAGGCAGAAGG + Intergenic
1060814542 9:126627656-126627678 GTCACTGGAGGCCACGCAGAAGG - Intronic
1062592886 9:137281888-137281910 GTCCCAGGAGCCCACACAGAGGG + Exonic
1186367103 X:8907108-8907130 GTCCCATGAAACCAGGAAGTAGG + Intergenic
1189234950 X:39479569-39479591 GGCCCAGGAAGCCACACATAGGG - Intergenic
1190630371 X:52380361-52380383 GTCCCAGGATCCCTTGCAGAGGG - Intergenic
1198205416 X:134460440-134460462 GGCCCAGGGAACCCCGCAGGCGG + Intronic
1200048910 X:153418119-153418141 GCCCCAGGAAGCCATACAGAAGG + Intergenic