ID: 900974577

View in Genome Browser
Species Human (GRCh38)
Location 1:6009048-6009070
Sequence CTGCAGCTCCTGGGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 0, 2: 5, 3: 63, 4: 554}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900974577_900974585 6 Left 900974577 1:6009048-6009070 CCCTTCTCCCCCAGGAGCTGCAG 0: 1
1: 0
2: 5
3: 63
4: 554
Right 900974585 1:6009077-6009099 CTCTGAGCCTCTGTTTGAAGTGG 0: 1
1: 0
2: 2
3: 37
4: 437
900974577_900974587 17 Left 900974577 1:6009048-6009070 CCCTTCTCCCCCAGGAGCTGCAG 0: 1
1: 0
2: 5
3: 63
4: 554
Right 900974587 1:6009088-6009110 TGTTTGAAGTGGTCCCTGACTGG 0: 1
1: 1
2: 0
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900974577 Original CRISPR CTGCAGCTCCTGGGGGAGAA GGG (reversed) Intronic
900013314 1:133657-133679 CTGAAGCTGCTGGGGCAGCATGG + Intergenic
900064816 1:724641-724663 CTGAAGCTGCTGGGGCAGCATGG + Intergenic
900385486 1:2408704-2408726 CTCCTGCTCCAGGGGGAGCAGGG + Exonic
900526353 1:3130739-3130761 ATGCAGCTCACGGGGGAAAAGGG - Intronic
900607399 1:3529996-3530018 CTCCAGCTTTTGGGGGAGAGAGG - Intronic
900952346 1:5865102-5865124 CTTCAGCTCCTGGGGATGAGAGG + Exonic
900974577 1:6009048-6009070 CTGCAGCTCCTGGGGGAGAAGGG - Intronic
901197782 1:7449891-7449913 ATGCAGCCCCCAGGGGAGAAAGG + Intronic
901276228 1:7993246-7993268 TTCCAGCTACTGGGGGTGAAGGG - Intergenic
901461102 1:9392393-9392415 AACCAGCTCCTGGGGGAGACAGG + Intergenic
902624042 1:17666639-17666661 CAGCTGTTCTTGGGGGAGAAAGG - Intronic
902824433 1:18963213-18963235 CTGAGGCTCATAGGGGAGAAAGG + Intergenic
902882281 1:19380378-19380400 CTGCTGCTCATGGGGCAGCAGGG - Intronic
903339273 1:22643887-22643909 GTGAGGCTCCTGGGGGAGGAAGG + Intronic
903795728 1:25927597-25927619 CCTCAGTTTCTGGGGGAGAAAGG + Intergenic
904799317 1:33081587-33081609 CGCAAGCTCCTGGGAGAGAACGG - Exonic
904813314 1:33178250-33178272 CATCAGCTGCTGGGAGAGAAGGG + Intronic
905199141 1:36304756-36304778 CTGGAGCTGCTGGTGGAGAACGG - Exonic
905863712 1:41365954-41365976 CCCCAGCCCCTGGGAGAGAAGGG - Intronic
906273639 1:44500635-44500657 CTGCAGCCGCTGGGGAGGAAAGG - Intronic
906753943 1:48291399-48291421 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
907523724 1:55041230-55041252 CCACAGCTCCTGGGGCAGAGGGG + Intronic
907883479 1:58572602-58572624 CTGAAGCTCATAGAGGAGAATGG - Intergenic
909358252 1:74732786-74732808 TTGCAGCCCCTGGAGGGGAATGG + Intronic
909476327 1:76085055-76085077 ATGCAGCTCCTGAGTAAGAATGG + Intronic
909924662 1:81425623-81425645 CTGTAGTGCCTGGTGGAGAATGG - Intronic
910449617 1:87331900-87331922 CAGCAGCTCCGCGGGGAGGAGGG + Intronic
910730056 1:90385319-90385341 CTGCAGCCACTGGTGGAGAATGG - Intergenic
911476272 1:98377284-98377306 CTGCAGATACTGAGGGACAATGG - Intergenic
912208987 1:107537978-107538000 CTGCTTCTCCTGGGGCTGAAGGG + Intergenic
912518339 1:110229455-110229477 CTGCAGCTCGGGGCGCAGAAGGG - Intronic
912697086 1:111849637-111849659 GTGCAGGTCCTGGCTGAGAAGGG + Intronic
912799277 1:112711115-112711137 ATGCAGCTCCTAGGGGAGAGGGG - Intronic
913322200 1:117596636-117596658 ATGCAGCTCTTGGCAGAGAATGG - Intergenic
913418234 1:118635894-118635916 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
915414648 1:155732005-155732027 CAGCAACTCCTGGGGCAGATAGG - Exonic
915487826 1:156234333-156234355 CTGTTGGTCCTGTGGGAGAAAGG + Intronic
915520519 1:156439757-156439779 CTTCAGCTCCTGGGGAGGGAGGG - Intergenic
916052093 1:161043569-161043591 CTCCAACTCCTGGTGGAGAGTGG + Intronic
916448040 1:164891931-164891953 CAGCTCCTCCTGGGGGAAAAAGG + Intronic
916633196 1:166638657-166638679 CTGCAGCTGCTGTGGCAGAGGGG - Intergenic
918013649 1:180611213-180611235 CTGCTGTTGCTGGGGAAGAAAGG - Intergenic
918154992 1:181836055-181836077 CTGCAGCTACTGGTGGGGATAGG - Intergenic
919772743 1:201173099-201173121 GTGCAGCTCTTGCTGGAGAAGGG + Intergenic
919786465 1:201261463-201261485 CTGGAGCTACTGGGGGAAGAGGG - Intergenic
920135241 1:203764116-203764138 GTGAAGCTCCTGGGAGGGAAGGG + Intergenic
920380418 1:205531756-205531778 AGGCAGGTCCTGGGGGAGGAGGG - Exonic
920563880 1:206958660-206958682 CTGCAGCTCAGGAGGCAGAAAGG - Exonic
920657600 1:207888110-207888132 TTCCAGCTCCTAGAGGAGAAAGG + Intronic
920727036 1:208445860-208445882 CTGCAGCTGCTGTGGCAGATAGG + Intergenic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
922099721 1:222470660-222470682 CTGAAGCTGCTGGGGCAGCATGG + Intergenic
922237666 1:223734089-223734111 CAGCAGCTCCTGGGAGAGGCTGG - Intronic
922240468 1:223752367-223752389 CTCCGGAACCTGGGGGAGAAAGG - Intronic
922261755 1:223950155-223950177 CTGAAGCTGCTGGGGCAGCATGG + Intergenic
922455146 1:225768329-225768351 TTGCAGCCCCAGGGGAAGAAGGG + Intergenic
922698269 1:227742902-227742924 TTGCAGCTGCTGTGGCAGAACGG + Intronic
922735325 1:227975590-227975612 CTGAAGCTGCTGGGGCAGCATGG - Intergenic
922785957 1:228282332-228282354 CTGCAGCAGCTGGGGGAGGCAGG - Intronic
923119677 1:230978651-230978673 CTGCAGCTCCTGCTTGAGCAGGG + Exonic
923453492 1:234141964-234141986 CTGCATCTAATGGGGGACAAAGG - Intronic
923536274 1:234854451-234854473 GTGAAGCTTCTGGGGCAGAAAGG - Intergenic
923992748 1:239456901-239456923 GTGCAGCTCCTGTGGAAGAAAGG - Intronic
924342920 1:243052327-243052349 CTGAAGCTGCTGGGGCAGCATGG + Intergenic
924937498 1:248784361-248784383 TTCCAGCTCCTCGGGGAGAGGGG + Intergenic
1063341704 10:5271404-5271426 CTCCAGCTCCAGAGGGAAAAGGG + Intergenic
1063566346 10:7174727-7174749 CAGCAGCTCCTGAGTAAGAAAGG - Intronic
1064954165 10:20888617-20888639 CTCCTGCTCCAGGGGGAGAGGGG + Intronic
1065350015 10:24786985-24787007 CTGCTGCTCCTGGGACAGAAAGG + Intergenic
1066733563 10:38453225-38453247 CTGAAGCTGCTGGGGCAGCATGG - Intergenic
1067581518 10:47449575-47449597 CTGCAGCTGCTGGAGAGGAAGGG + Intergenic
1069778328 10:70939608-70939630 CAGCAGCCACTGGGGGAGAGTGG - Intergenic
1069819116 10:71216890-71216912 CTGCAGGCCCTGGGGGAGGGAGG - Intronic
1069819502 10:71218590-71218612 CTGGTGCTCCAGGGGGAGGAAGG + Intronic
1069822581 10:71236740-71236762 CTGCTTCTCCTCTGGGAGAATGG + Intronic
1069829662 10:71275018-71275040 CTCCAGGGCCTGGGAGAGAATGG + Intronic
1070520912 10:77252713-77252735 ATGGAGCTCCTGGGGCAGAATGG + Intronic
1071190750 10:83096550-83096572 TTACAGCTCCTGGGAAAGAAGGG + Intergenic
1071356171 10:84798504-84798526 ATGCAGTCCCTGGTGGAGAAGGG + Intergenic
1073641982 10:105262250-105262272 CTGGAAATCCTGGGGGATAAGGG - Intronic
1074985817 10:118658697-118658719 CTGCAGCTGCTGTGGGAGATGGG + Intergenic
1075697632 10:124448139-124448161 CCGCAGCATCTAGGGGAGAAGGG + Exonic
1075988746 10:126814242-126814264 CAACATCTCCTGGTGGAGAATGG - Intergenic
1076375829 10:129984028-129984050 CTGCAGCTGCTGTGGAAGACGGG - Intergenic
1076444159 10:130500418-130500440 ATGCAGCGCCTGGTGGGGAAGGG + Intergenic
1076586190 10:131549264-131549286 CAGCAGGTCCTGGGGCAGATGGG - Intergenic
1076587750 10:131560880-131560902 CCACATCTCCTGGGGGAGAGGGG + Intergenic
1076877642 10:133224352-133224374 CTGCAGCCCCTGCGGCAGACTGG + Intronic
1076969650 11:125861-125883 CTGAAGCTGCTGGGGCAGCATGG + Intergenic
1077197330 11:1288043-1288065 CTGCAGCTCCTGGGGGCATCAGG - Intronic
1077442207 11:2574151-2574173 CTGCAGCTGTGGGGGGAGATGGG - Intronic
1078068882 11:8095603-8095625 CGGCAGCTGGTGGGGGCGAACGG + Exonic
1078865886 11:15296867-15296889 CTGAAGCTCACTGGGGAGAATGG + Intergenic
1079251498 11:18791150-18791172 CTGAAGCCCCTGAGGGAGATTGG - Intronic
1080681979 11:34485951-34485973 CTGCAGCTGGTGGGGGATGAGGG + Intronic
1080851293 11:36072502-36072524 GTTCTGCTCCTGTGGGAGAAGGG + Intronic
1081557170 11:44175519-44175541 CTGCAGATGATGGGGAAGAAAGG - Intronic
1082794869 11:57371575-57371597 CCCCCGCTCCAGGGGGAGAAGGG + Intergenic
1082869808 11:57933764-57933786 CTGCAGCTCTTGGATAAGAAGGG + Intergenic
1083155761 11:60821966-60821988 CTGCAGGGCCTGGGGGTGGAGGG - Intergenic
1083160911 11:60853571-60853593 CTGCTGGGCCTGGTGGAGAATGG - Exonic
1083231884 11:61326885-61326907 CTGAGGGTCCTGGGGGGGAAAGG + Exonic
1083427991 11:62599164-62599186 CTGCAGCTCCTTGGGGAGGAAGG - Intronic
1083609175 11:63997027-63997049 CTGCAGCCACGGAGGGAGAAAGG - Intronic
1083654027 11:64220422-64220444 CTGCTGCTCCTGGGCGAGAGGGG - Exonic
1083784016 11:64933684-64933706 CTGCTGCTCCCTGGGGAGAGAGG - Exonic
1084180592 11:67443665-67443687 CCGCAGCTCCTCCGGAAGAAGGG + Intronic
1084459615 11:69289204-69289226 CTGCTGCTCCTGGGGCAGAGAGG - Intergenic
1084591810 11:70094676-70094698 CTTCCTCCCCTGGGGGAGAACGG - Intronic
1084667013 11:70582001-70582023 CAGCAGCTCCTAGGGGAGGCAGG - Intronic
1084870710 11:72096978-72097000 CAACAGCCCCTGGGGGTGAAGGG - Intronic
1085513781 11:77100759-77100781 CAGCAGTTCTTGGGGTAGAATGG - Intronic
1086300680 11:85423601-85423623 CTGCAGCTGCTGTGGGGGATGGG + Intronic
1087206763 11:95404545-95404567 CTGCAGCTGCTGTAGGAGATGGG + Intergenic
1087630798 11:100648090-100648112 CTGCAGCCCCTGTGGGGGATGGG - Intergenic
1088179468 11:107092705-107092727 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
1088230494 11:107669251-107669273 CTTCCTCTCCTGGGGGAGACAGG - Intergenic
1088513142 11:110598971-110598993 GTGCAGCTCCTGGGAGGGCAAGG - Intronic
1089776957 11:120844526-120844548 CTGGAGTTCTTGGGGTAGAAGGG + Intronic
1090374974 11:126282319-126282341 GTGAAGCACCTTGGGGAGAAGGG - Intergenic
1090895025 11:130964383-130964405 CTGCGGCTGCTGTGGGAGATGGG + Intergenic
1090895044 11:130964517-130964539 CTTCAGCTTCTGTGGGAGATGGG - Intergenic
1091457297 12:617555-617577 CTGAAGCTCCTGGGGATAAAAGG + Intronic
1092243651 12:6850948-6850970 CTGCAACTCCTGGTTGAGATGGG - Exonic
1092322136 12:7487500-7487522 GTGCTCCTCCTGGGGTAGAAAGG + Exonic
1094263455 12:28527770-28527792 CTGCAACTGCTGTGGGAGATGGG + Intronic
1094342670 12:29430482-29430504 CTACAGCTGCTGTGGGAGATTGG + Intronic
1094375986 12:29787692-29787714 CTGCAGCCCCAGGAGGAAAAAGG + Intergenic
1096080127 12:48827588-48827610 CAGCAGCTGCTGGGGGAGCGTGG + Exonic
1096115097 12:49050935-49050957 CGGCAGCTCCTCGGGCAGAGGGG + Exonic
1096818127 12:54214697-54214719 CTTCAACTCCTTGTGGAGAAGGG - Intergenic
1097288631 12:57896380-57896402 CTCCAGCTGCTCTGGGAGAAAGG - Intergenic
1099163620 12:79275076-79275098 CTGCCACTCCTAGGGGAAAAGGG + Intronic
1099392443 12:82097851-82097873 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1100088136 12:90936611-90936633 CTGCAGCTGCTGTTGGGGAAGGG + Intronic
1100367832 12:93937665-93937687 CTGCAGCCCCTGGTTGAGAAAGG - Intergenic
1101290378 12:103361824-103361846 CTGCAGCTGCTGTGGGGGATGGG - Intronic
1101406788 12:104435843-104435865 CTGCAGCTCCTGGGCAAGGTGGG - Intergenic
1102039771 12:109793484-109793506 CGGCAGCTTCTGGGTGAGGAAGG - Intronic
1102298186 12:111753309-111753331 CTGCAGCTCCAATGGGAGCAAGG - Intronic
1103004139 12:117408312-117408334 GAGCAGCTCCTGGGGAAGGAGGG - Intronic
1103833876 12:123803394-123803416 CTGGAGCACCATGGGGAGAAAGG - Intronic
1103840169 12:123857203-123857225 GAGCAGGTCCTGGAGGAGAACGG + Exonic
1104649823 12:130523539-130523561 CTGGAGCTCCTGATGGGGAAGGG - Intronic
1105471961 13:20703350-20703372 TTTCAGCTCCTGGAGGCGAAAGG + Exonic
1105657338 13:22455491-22455513 ATGCAGGGCCTGGGAGAGAAGGG - Intergenic
1107175578 13:37394862-37394884 CTGCAGCTGCAGTGGGAGAGAGG - Intergenic
1107671567 13:42751410-42751432 ATGCAGCTGATGGGGGAGACAGG - Intergenic
1108134219 13:47338248-47338270 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
1108355860 13:49628340-49628362 CTGCAGGTCCTGGCAGAGCAAGG - Exonic
1111522786 13:89427657-89427679 ATGGAGCTCCTGAGGGAGAGTGG - Intergenic
1112319817 13:98395863-98395885 CTGCTGCTGCTGGGAGACAATGG - Intronic
1112738082 13:102443454-102443476 CTGCAGCTGCTGTGGGAGATGGG - Intergenic
1113399707 13:109979564-109979586 CTGTGGGTCCTGGGGGAGCATGG + Intergenic
1113844703 13:113380203-113380225 CTGCAGCTCCAGGCGGTGAGGGG - Intergenic
1113881261 13:113627935-113627957 GGGGAGCTCCTGGGGGAGGAGGG + Intronic
1114413243 14:22519758-22519780 CTGCACCTCCTGGGCGGCAAGGG - Intergenic
1114430561 14:22657015-22657037 CTGCAGCTCCTGGCCCAGCATGG + Intergenic
1118367631 14:65109228-65109250 CTGTGGCTACTGGTGGAGAATGG - Intergenic
1118532208 14:66718878-66718900 CTGCAGCTGCTGTGGGGGATGGG + Intronic
1118751894 14:68813758-68813780 CTGCTGATTCTGGAGGAGAATGG + Intergenic
1119918033 14:78420567-78420589 GTGCAGCTTCAGGGTGAGAATGG + Intronic
1120202573 14:81553806-81553828 AGGCAGCTCCTGGGGAAAAATGG + Intergenic
1120863205 14:89273520-89273542 CTGTAGCCACTGGGGAAGAAGGG + Intronic
1121104165 14:91269986-91270008 TTGCAGAGCCTCGGGGAGAACGG + Intergenic
1121469482 14:94140771-94140793 CTGGAGCGCCTTGGAGAGAAAGG + Intergenic
1122826888 14:104374914-104374936 ACACAGCTGCTGGGGGAGAAAGG - Intergenic
1122862902 14:104590415-104590437 CAGCAGCGGCTGGGGGAGATCGG - Intronic
1124155733 15:27223979-27224001 CTCCAGCTCCAGTGGGAGAAAGG - Intronic
1124380721 15:29162628-29162650 CTGCAGCTCCTGTGGGGGATGGG - Intronic
1124583163 15:30980290-30980312 CTGTAGCTCATTGGTGAGAAAGG - Intronic
1124689057 15:31806598-31806620 CTGCTGGTCCTGGGGGTCAAAGG + Intronic
1127311868 15:57759535-57759557 ATGCAGCTGCAGGTGGAGAAGGG - Intronic
1127866251 15:63035601-63035623 CTGAAGTTCCTGAGGTAGAATGG + Intergenic
1128604746 15:69028267-69028289 CTGCAGCTCCTGGAGGGTGATGG - Exonic
1128616549 15:69114918-69114940 CTGCAGCTCCTCGTGAAGACGGG - Intergenic
1129695626 15:77739267-77739289 TTGCAGCTCCAAGGGGGGAAGGG - Intronic
1131487284 15:92831902-92831924 CTGCAGCCTCTGGGGGAGGCAGG + Intergenic
1131535414 15:93233109-93233131 CTGCAGCTTCAGTGGGAGAAAGG - Intergenic
1132171309 15:99659227-99659249 ATCCAGCTCCTGGGAGACAAGGG + Intronic
1132367794 15:101270120-101270142 CTGAGGCCCCTGGGGAAGAAGGG - Intergenic
1132381660 15:101370515-101370537 GGGATGCTCCTGGGGGAGAAGGG + Exonic
1132652518 16:1028038-1028060 CTGCTGCTCCTGTGGGAGGTGGG - Intergenic
1132799968 16:1747158-1747180 CTGCAGCCCCTGGGGGACTATGG + Exonic
1133076445 16:3284090-3284112 CTGGATCTCCTGGGGCAGGATGG - Exonic
1134215150 16:12311497-12311519 CTGCATCTCCTGGAGGAAATGGG - Intronic
1134680887 16:16124707-16124729 TTACAGCTCTTGGGGGAGGAAGG - Intronic
1135395182 16:22125961-22125983 AAGCACCTCCTGGGAGAGAAGGG + Intronic
1135539355 16:23318006-23318028 CTGCAGCTCAAGGCAGAGAAAGG + Intronic
1135960610 16:26991699-26991721 CTGCAACTGCCGAGGGAGAAGGG + Intergenic
1136683338 16:31980485-31980507 CTGCAGCTGCTGCTGGAGAATGG + Intergenic
1136783968 16:32924041-32924063 CTGCAGCTGCTGCTGGAGAATGG + Intergenic
1136885814 16:33929765-33929787 CTGCAGCTGCTGCTGGAGAATGG - Intergenic
1137274897 16:46926958-46926980 ATGAAGCTCCTGGAGGAGACTGG + Exonic
1137681553 16:50350887-50350909 CAGAAGCTCTTGGGGAAGAAGGG + Intronic
1138101638 16:54256612-54256634 CTGCAGCCCCCCAGGGAGAAAGG - Intronic
1138175942 16:54898284-54898306 ATGCAGCTGCTGGGAGAGAAGGG + Intergenic
1138280243 16:55767555-55767577 CTGCATCTTCTGGGGCAGAATGG + Intergenic
1138288244 16:55826083-55826105 CCGCATCTTCTGGGGCAGAATGG - Intronic
1138514072 16:57526304-57526326 CTGCAGCTCCAGGAGGTGAAAGG - Intronic
1138797974 16:59993194-59993216 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1139351980 16:66342704-66342726 CTGCCTTTCCTGGGGGAGCACGG + Intergenic
1139436876 16:66941549-66941571 CAGCAGCTCCTGGGGGTGCCTGG - Exonic
1139449342 16:67017304-67017326 CAGCAGCTCCTGTGGCTGAAAGG - Intergenic
1140479228 16:75253519-75253541 ATGCAGCTACTGGGGGAGGAGGG - Intronic
1140695160 16:77525374-77525396 CTGCAGCTGGTGGAGGGGAAGGG + Intergenic
1140933670 16:79651481-79651503 CTGCTGCTCTTTGGGGAGAAGGG + Intergenic
1141831086 16:86510338-86510360 CAGCAGCTCCTCGGGGAGGGCGG + Intergenic
1141895151 16:86954388-86954410 CTGCAGCTCCTGTGTGAGATCGG + Intergenic
1142172005 16:88627810-88627832 GAGCAGCTCCCGGGGGAGGAGGG + Intronic
1142339245 16:89509720-89509742 CTGAAGCTTCTGCAGGAGAAAGG - Intronic
1142360029 16:89621538-89621560 CTGCAGCTCCACGGGGAGCCCGG - Intronic
1142451026 16:90173261-90173283 CTGAAGCTGCTGGGGCAGCATGG - Intergenic
1203086624 16_KI270728v1_random:1188043-1188065 CTGCAGCTGCTGCTGGAGAATGG + Intergenic
1142456537 17:60434-60456 CTGAAGCTGCTGGGGCAGCATGG + Intergenic
1142954648 17:3513384-3513406 CTGGATATCCTGGGGGAGGAGGG - Exonic
1143017237 17:3897570-3897592 CAGCCGCTCCTGGTGGGGAATGG - Exonic
1143577882 17:7805238-7805260 CTCCAGGGCCTGGGGGAAAAGGG - Exonic
1143913109 17:10268263-10268285 CTGAAGTTCCTTGGGGAAAAGGG - Intergenic
1144574826 17:16422799-16422821 GTGAAGCTCCTGGTGGAGAATGG + Exonic
1144835088 17:18152555-18152577 CTGCAGCTGCTGAGAGACAAAGG - Intronic
1145246423 17:21272817-21272839 CAGCAGCCCCTGAGGGAGATTGG + Intergenic
1145321278 17:21768846-21768868 CTTCAGCTCCTGGAGGAGCTGGG + Intergenic
1146508248 17:33424042-33424064 AGGCATCTCCTGGGGTAGAAGGG - Intronic
1147144250 17:38476196-38476218 CTGCAGCTGCTGCTGGAGAATGG + Intronic
1147728558 17:42582118-42582140 CCTCAGCCCCTGGCGGAGAACGG + Exonic
1147921401 17:43919340-43919362 CTGCTGCTACGGGGGAAGAAAGG - Intergenic
1148151070 17:45396679-45396701 CTGCAGTCGCTGCGGGAGAAGGG - Exonic
1148195708 17:45711080-45711102 CTGCAGCCCCCTGGGCAGAAAGG - Intergenic
1148534937 17:48430857-48430879 CCGCAGCTCCTGGAGGGAAAGGG - Intergenic
1148578822 17:48729227-48729249 GTCCATCTCCTGGGGGGGAAGGG + Intergenic
1148857116 17:50584817-50584839 AGGCAGCTCCTGGGGGAGAGAGG + Intronic
1148905896 17:50911907-50911929 CTCCAGCTCCTGGGGATGACCGG - Intergenic
1149541404 17:57470732-57470754 CAGCAGCTCCTGCGGGTGGAAGG + Intronic
1149593633 17:57850120-57850142 CCGCAGCCCCTGCGGGAGAGCGG + Intergenic
1151170914 17:72245540-72245562 CTGCAGCTCCCTGAGGGGAAAGG - Intergenic
1151354074 17:73548302-73548324 CTGCAGCTGTTGGGAGAGAGAGG + Intronic
1151426460 17:74033901-74033923 CTGCAGATTCAGGGTGAGAAGGG + Intergenic
1151557983 17:74856297-74856319 GTGCAGATCCTGGGGGAGGCGGG - Intronic
1151708305 17:75784524-75784546 CTGGAGCGCCTGGAGGAGAAGGG - Intronic
1152475349 17:80514207-80514229 CTGCGGTTCCTGGGAGAGGAGGG - Intergenic
1152749481 17:82056053-82056075 CTGCAGCTCCTGCCGGTCAAAGG - Exonic
1152928325 17:83098034-83098056 TTGCAGCACCTGGGGGACGATGG - Intergenic
1153079906 18:1210424-1210446 CTGCGGCTGCTGGGGGGGATGGG + Intergenic
1154024007 18:10689854-10689876 CTTGAGCTCCTGGGTGAGCAGGG - Intronic
1156326660 18:36079712-36079734 CTGCAGCCACTGTGGGAGATGGG - Intergenic
1156378477 18:36535307-36535329 TTGCAGCTCCAGGGGCAGACAGG - Intronic
1157590935 18:48836131-48836153 AAGCAGCTGCTGGGGGAGGAGGG - Intronic
1157696948 18:49730629-49730651 GGGGAGCTCCTGGGGAAGAAAGG - Intergenic
1159903292 18:74067788-74067810 CTGCAGGCCCTGGATGAGAATGG - Intergenic
1160267598 18:77353727-77353749 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1160646455 19:195787-195809 CTGAAGCTGCTGGGGCAGCATGG + Intergenic
1160801803 19:973850-973872 CTGGAGCTGCTGGAGCAGAAAGG + Exonic
1160859916 19:1233398-1233420 CTGTAGCACCTGGTGGAGAGTGG - Intronic
1160942201 19:1625591-1625613 CGGCAGCTCCCGGCGGAGAGCGG - Exonic
1160975796 19:1791856-1791878 CAGCAGCTGGTGGGGGAGGAGGG + Exonic
1161235164 19:3194012-3194034 CATCAGCTACTGGGGGAGCAGGG + Intronic
1161299693 19:3536820-3536842 CTGCAGCTCCAGGGCCAGATGGG - Intronic
1161424371 19:4194678-4194700 CTCTGGCTGCTGGGGGAGAAGGG + Intronic
1161800163 19:6412923-6412945 CTCCAGCACCTTGGGGAGCAAGG - Intergenic
1163267035 19:16227736-16227758 CTTCACCTCCTGGAGGTGAAGGG - Intronic
1163442845 19:17330243-17330265 CACCAGCTCCTGCGGGAGAAGGG + Exonic
1163723414 19:18909160-18909182 CTGCTGCTCCTGGGGGACCCAGG + Intronic
1163771133 19:19192080-19192102 ATGCAGCTCAAGGGGAAGAAAGG - Exonic
1164155721 19:22595957-22595979 CTCCTGCTCCAGGGGCAGAACGG - Intergenic
1165040096 19:33062978-33063000 CAGCAGCACCTGGGGGAAAATGG - Intronic
1165740626 19:38203294-38203316 CTGCAGCTGCAGAGGGAGATGGG - Intronic
1165857766 19:38890072-38890094 GGGTAGCTGCTGGGGGAGAAGGG + Intronic
1166047682 19:40238965-40238987 CTTCAGCGCCTGGGGGATGAAGG + Exonic
1166155613 19:40909272-40909294 CAGCACTTCCTGGGTGAGAAGGG - Intergenic
1166266682 19:41688724-41688746 CTACAGCTCCTGGGTGTGGAGGG + Intronic
1166558790 19:43718677-43718699 CAGCAGCTCCTGGAGGTGAGAGG - Exonic
1167269192 19:48498433-48498455 AGGAACCTCCTGGGGGAGAAGGG - Exonic
1168269163 19:55240292-55240314 CTGCAGCAGCTGCGGGAGAGCGG + Exonic
925441906 2:3895319-3895341 CTGCAGCTGCTGTGGGAAGATGG + Intergenic
926178064 2:10614859-10614881 CTGCATCTCCTGTGGGAAAATGG + Intronic
926383884 2:12317165-12317187 GGGCATCACCTGGGGGAGAAGGG - Intergenic
927153984 2:20211491-20211513 CTTCAGCTCCTGGGGGAGGGAGG - Intronic
927404693 2:22754060-22754082 CTGGAGCTTGTGGGGGAGAGGGG - Intergenic
928147240 2:28790060-28790082 CTCCAGCTCCTGGGGCTCAAAGG - Intronic
929226438 2:39515960-39515982 CTGCAGCTGTTGGGGCAAAAGGG + Intergenic
929246981 2:39712775-39712797 CTGAAGATCCATGGGGAGAAAGG - Intronic
929312850 2:40445698-40445720 CTGCATGTCCAGGGGAAGAAAGG + Intronic
929789111 2:45010721-45010743 GTGCTGGTCCTGTGGGAGAAGGG + Intergenic
929862334 2:45690332-45690354 CTGCTTCTCTTGGGGGATAAAGG + Intronic
929989188 2:46770590-46770612 CTGTAGCACTTGGGGAAGAATGG + Intergenic
930599146 2:53423885-53423907 CTGCAGCTCCAGTGGCAGTAGGG + Intergenic
931071659 2:58658385-58658407 CCACAGCTTCTGGGGGAGCATGG + Intergenic
931235206 2:60406956-60406978 CTGCATCTGCTGGGAGAGGAAGG - Intergenic
932052873 2:68416607-68416629 CTGCAGCTCAGTGGGCAGAAGGG + Intergenic
932304841 2:70694750-70694772 CTACAGCTCCTGGCGGGGTAGGG + Intronic
932453920 2:71834251-71834273 CTGGAGCTGCTGGAGGAGGATGG + Intergenic
932706886 2:74032781-74032803 CTGCAGCAGGTGGGGGTGAAGGG - Intronic
933531516 2:83517743-83517765 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
934640633 2:96025316-96025338 CTGCTCCTCCTGTAGGAGAAGGG + Intronic
935211963 2:100946001-100946023 CTGAAGCTCCTGTTGGAGAGAGG + Intronic
936682602 2:114791430-114791452 CAGCAGCTCCTGAGTGAGACAGG - Intronic
936861548 2:117026340-117026362 CTCCTGCTGTTGGGGGAGAAAGG + Intergenic
937236527 2:120434650-120434672 CTCCCGCTCCTGGGAGAGACAGG - Intergenic
937870451 2:126782443-126782465 CTGTTTCTCCTTGGGGAGAAAGG - Intergenic
938259453 2:129884640-129884662 CTTCAGCCCCTGGGGAAGTAAGG + Intergenic
938318356 2:130345553-130345575 CTTCAGCTCCTGGGCGTGGATGG - Exonic
941627432 2:167845062-167845084 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
941738353 2:169005368-169005390 CTGCAGCTGCTGTGGGGGATGGG + Intronic
941983390 2:171485353-171485375 CAGCAGTTCCTGGGGAAGGAAGG - Intergenic
942773989 2:179558803-179558825 CTGCCGCTCCTGGGTGAGAATGG - Intronic
943687571 2:190834908-190834930 CTGCTGCTCCTCGTGGAGCAGGG + Intergenic
944659922 2:201912995-201913017 TGGAAGCTCCTGGGGGAAAAGGG + Intergenic
945027991 2:205637580-205637602 CTGCAGCTCTGGGTGGAGAGAGG - Intergenic
946479421 2:220040009-220040031 CAGCAGCTCATTGAGGAGAATGG + Intergenic
946690966 2:222307932-222307954 CTGTAGCTCCTTGCAGAGAAGGG + Intergenic
947231697 2:227893966-227893988 CTCCATCTGCTTGGGGAGAAAGG + Intronic
947457080 2:230265138-230265160 CTGCAGCTGCTGTGGGGGATGGG + Intronic
948364346 2:237444899-237444921 CTGGGGCACCTGGGAGAGAAGGG + Intergenic
948370676 2:237487384-237487406 GTCCAGCACCTGGGAGAGAAAGG - Exonic
948902493 2:240963602-240963624 CTGCAGCTCCTGGCGCAGTGCGG - Intronic
948987127 2:241532627-241532649 CTGCAGCTTCTGCAGGAGACGGG - Intergenic
1168771177 20:417880-417902 CTGCAGCTCCTGAGGGTTGAGGG - Exonic
1168888180 20:1274969-1274991 GTGCAGCCCCAGAGGGAGAAGGG + Intronic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1168940093 20:1702481-1702503 CTGCTGCTCCTGGGAGTGAGTGG - Intergenic
1169122155 20:3103152-3103174 GTGCAGTTCCTGGGAGAGAAGGG - Intergenic
1169977176 20:11342812-11342834 AGGCTGCTCCTGGGGGAGGAGGG + Intergenic
1170086256 20:12535573-12535595 CTGCAGCTGCTGTGGCAGATGGG - Intergenic
1170863158 20:20127862-20127884 CTGCAGCTGCTGTGGGAGATGGG + Intronic
1172260820 20:33563812-33563834 CTTCAGCTCCTGGGCAAGAATGG + Intronic
1172408669 20:34706931-34706953 CTTCAGGTACTGGGGGAGTATGG + Intronic
1172812819 20:37661963-37661985 CTGAAGGTCCTAGGGGAGAATGG + Intergenic
1172882384 20:38210566-38210588 CTGCATCCCCTGGGGAAGAAGGG - Exonic
1173021518 20:39271491-39271513 CTGCACTGCCTGGGGGAGCAGGG + Intergenic
1173095479 20:40023759-40023781 CTGCAGCTCCTTCAGGAGATGGG + Intergenic
1173909210 20:46651539-46651561 CTGCTCCTCCTGGAGGAAAAGGG + Intronic
1174210716 20:48875913-48875935 CTCAGGCTCCTGGAGGAGAAAGG + Intergenic
1174293226 20:49524113-49524135 CTGCTGCACCTGGAGGAGATGGG - Exonic
1175327548 20:58140237-58140259 CCTCAGCTCCTGGGGGAGGTCGG + Intergenic
1175400927 20:58699445-58699467 CAGCCGTCCCTGGGGGAGAAGGG + Intronic
1175474415 20:59260760-59260782 CTGCAGCACCTGGGAAAGAGTGG + Intergenic
1175626269 20:60490590-60490612 CTGCAGCTGGAGGGGAAGAAGGG - Intergenic
1176279054 20:64290429-64290451 CTGAAGCTCCTGGGTCAGCATGG - Intergenic
1176428560 21:6563002-6563024 CTGCATCTCCTGGCGGAGCCGGG + Intergenic
1177195588 21:17900863-17900885 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1178059372 21:28834963-28834985 CTGCAGCTACTGTGGGGGATGGG - Intergenic
1179567794 21:42260077-42260099 CAGCAGCTCATGGGGCAGGAAGG + Intronic
1179704050 21:43171318-43171340 CTGCATCTCCTGGCGGAGCCGGG + Intronic
1179717502 21:43297454-43297476 CTGGAGCTCCTGGGGGCAACAGG - Intergenic
1180357567 22:11855190-11855212 CTCCAGCCGCTGGGGGAAAAAGG + Intergenic
1180380698 22:12137143-12137165 CTCCAGCCGCTGGGGGAAAAAGG - Intergenic
1180631433 22:17232841-17232863 CTGGAGCCCCAGGGAGAGAAGGG - Intergenic
1181001634 22:19990456-19990478 CTGGGGCTCCTGGGGAGGAAAGG - Intronic
1181175386 22:21032133-21032155 GAGCAGCTCCAGGGGGAGCAGGG + Intronic
1181492559 22:23269617-23269639 CAGCAGCACCTGGCGGAGCAGGG - Intronic
1181786599 22:25231638-25231660 CTGCAGTACCTGCTGGAGAAGGG + Exonic
1181818765 22:25459450-25459472 CTGCAGTACCTGCTGGAGAAGGG + Intergenic
1182510108 22:30813589-30813611 CTGCAGCAGCTGGGTGAGGATGG - Intronic
1182994325 22:34798856-34798878 CTGCAGTAGCTGGGGGAGGAGGG + Intergenic
1183086267 22:35489212-35489234 CAGCAGCCCGTGGGGGAGAAGGG - Intergenic
1183343236 22:37293670-37293692 CTGCAGATCCTGGGGAGAAAGGG + Intronic
1184112967 22:42405930-42405952 CTGGGGCTCCCGGGGGTGAAAGG + Intronic
1184600345 22:45539578-45539600 CGGCAGGTCCTGGGGCAGGAAGG + Intronic
1184660606 22:45963940-45963962 CTGCAGCTCCTGGAGGTGCGGGG - Intronic
1185226736 22:49657737-49657759 CTGGAGCTCCTGCAGGAGACTGG - Intergenic
1185333150 22:50260629-50260651 CAGGAGCCCCTGGGGGTGAAGGG - Intronic
950101381 3:10358917-10358939 TTGCAGCACCTAGGGGAGGATGG + Exonic
951208414 3:19947623-19947645 CTGCTGCGCGTGAGGGAGAAGGG - Intronic
951269613 3:20608335-20608357 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
952233652 3:31456629-31456651 CCGAAGCTGCTGGTGGAGAATGG - Intergenic
953030663 3:39177825-39177847 CAGAAGCTTGTGGGGGAGAAAGG - Intergenic
953185298 3:40631789-40631811 CTGCAGCTGCTGTGGGAGATGGG - Intergenic
953854366 3:46489494-46489516 CTGCAGCACCTTGGGGACCAAGG + Intergenic
954316831 3:49805989-49806011 GTGCTGCTCCTAGAGGAGAAAGG + Exonic
954364649 3:50139485-50139507 AGACAGCTCCTGGGGGAGATTGG + Intergenic
954413883 3:50383501-50383523 CTGAAGCTCCTGGGAGGTAAAGG - Intronic
954427366 3:50450383-50450405 TAGCAGCTCCTGGGAGAGAGTGG - Intronic
955155085 3:56408821-56408843 CTGCTGCTCCTGGGGGACAGCGG - Intronic
956386458 3:68724976-68724998 CTGCGGCTCCCAGGGGAGAGGGG - Intergenic
958151543 3:89699710-89699732 GTGCAGCTCCTGTTGGAGATAGG - Intergenic
958775947 3:98483144-98483166 CTGCAGCTGCTGTGGGTGATGGG + Intergenic
959997268 3:112693444-112693466 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
960516539 3:118608302-118608324 CTGCAGCTCCTGTGGGGGGTGGG - Intergenic
960639550 3:119812803-119812825 CTGCAGCTGCGGGGGGAGGATGG + Exonic
961081659 3:124033405-124033427 CTGCCGCTGCTGGGGGACAGCGG + Intergenic
961213133 3:125141042-125141064 CTGCAGCTGCTGCGTGTGAATGG + Intronic
961604322 3:128082501-128082523 CTGAACCACCTGGGGGAGATTGG - Exonic
962034448 3:131636462-131636484 CTGCAGCTGCTGTGGGTGATGGG - Intronic
962253909 3:133857532-133857554 CCCCAGCACCTGGGGGAGATGGG - Intronic
963618669 3:147576341-147576363 CTGCATCTGCAGGGGTAGAAGGG + Intergenic
963712169 3:148758678-148758700 CTGCAGCTCCCAGTGAAGAATGG + Intergenic
963803665 3:149701448-149701470 CTGGAGCTGCCGGTGGAGAATGG - Intronic
963827522 3:149970995-149971017 CCGCAGCTCCTCGGGGAGGGGGG - Exonic
966705239 3:182906564-182906586 TTCCAGCTACTGGGGGAGAGGGG - Intronic
966840509 3:184083628-184083650 CTGGGGCTCCTGAGGCAGAAGGG + Intergenic
968371226 3:198223739-198223761 CTGAAGCTGCTGGGGCAGCATGG - Intergenic
968518115 4:1023360-1023382 CTGCAGGCCCCGGGGGAGGAGGG - Intronic
968525789 4:1056110-1056132 CTGCAGCTCGCGGGGGAGACAGG - Intergenic
968729888 4:2264684-2264706 CTGGAGCCCCTGGGGGATAGGGG + Intergenic
968871891 4:3246576-3246598 CAGCAGCACCTGAGGGAGAAGGG - Intronic
968954450 4:3711066-3711088 CTGCAGCTCCTGGGGTGGCCAGG + Intergenic
969203292 4:5622696-5622718 CAGCAGATCCTGGAGGAGCACGG - Exonic
971470856 4:27024973-27024995 CTGCTGCTCCTGGGTGAGAAGGG + Intronic
971554954 4:28002128-28002150 CTGCAGCTCCTGTGGGAGATGGG + Intergenic
973339260 4:48986876-48986898 CTACAGCTCCTGGGGAAAACGGG - Intronic
973343053 4:49026020-49026042 CTGTAGCTGCTGTGGGAGATGGG + Intronic
974354959 4:60799810-60799832 CTCCAGCTCCACGGAGAGAATGG + Intergenic
974364345 4:60926961-60926983 CAGCTGCTTCTGGGGCAGAAAGG - Intergenic
975033974 4:69658517-69658539 CTGCAGCTGCTGTTGGAGATGGG - Intergenic
975203096 4:71614808-71614830 CTGCAGCTGCTGTGGGACATGGG - Intergenic
975666329 4:76738821-76738843 GTGCAGCTCCCAGGGGAGCATGG + Exonic
975754485 4:77559229-77559251 CTCCAACACCTGGGGAAGAAAGG + Intronic
976760091 4:88539350-88539372 CTGCAGCCTCGGGGGGAGAGGGG + Intronic
977777531 4:100938941-100938963 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
978761839 4:112361537-112361559 CTGCAGCTGCTGTGGGGGATGGG - Intronic
979328472 4:119404413-119404435 CTGAAGCTGCTGGGGCAGCATGG + Intergenic
982952037 4:161711128-161711150 CTAAAGGTCCTGGGGGACAAGGG + Intronic
983935513 4:173500299-173500321 CCGCAGCTCTTGGGGGAGCAGGG - Intergenic
985229333 4:187798522-187798544 CTGCAGCTGCTGCTGGAGGATGG - Intergenic
985509549 5:305081-305103 CTGCAGCTCCAGGGGCAGGCAGG + Intronic
985528478 5:420129-420151 GTGCAGTTCCTGGAGGAGAAGGG + Intronic
985561905 5:592242-592264 CTGCAGCTGCTGTAGGAGATGGG + Intergenic
985655228 5:1128223-1128245 CTCCAGCTCCTGTGGGACCAGGG + Intergenic
985738726 5:1601810-1601832 CTGCAGCTCCAGGGGCAGGCAGG - Intergenic
986195843 5:5535824-5535846 CTGCAGCTCCAGGTGCAGATGGG + Intergenic
987633941 5:20514284-20514306 CTGCAGCTCCTGGAGGTAAGCGG + Intronic
990309552 5:54524913-54524935 GTGCAACTCCTGGGGCAGACTGG - Intronic
990767594 5:59203839-59203861 GAGCAGGGCCTGGGGGAGAATGG + Intronic
991295515 5:65076104-65076126 CTGCAGCTCCTGGGGAGGAAAGG + Intergenic
991310086 5:65229007-65229029 CTACAGCAGTTGGGGGAGAATGG - Intronic
991772912 5:70056626-70056648 CTGCAGCTGCACGGAGAGAAAGG + Intronic
991852205 5:70932050-70932072 CTGCAGCTGCACGGAGAGAAAGG + Intronic
993011973 5:82493035-82493057 CTGTGGCTCCTGGAGGTGAATGG - Intergenic
993090375 5:83418638-83418660 CTGTGGCTCCTGTGAGAGAAAGG + Intergenic
993691345 5:91004746-91004768 CTGGGGCTTCAGGGGGAGAATGG + Intronic
993854025 5:93050051-93050073 CTGCAACTCTTTGGGGAGTAAGG - Intergenic
994034035 5:95178168-95178190 CTGCAGCTGCTGTGGGGGATGGG - Intronic
994304049 5:98180720-98180742 CTGCAGCTGCTTTGGGAGATGGG - Intergenic
996537438 5:124593153-124593175 CTGGGGCTCCTGGGGTAGAAGGG + Intergenic
996779822 5:127172871-127172893 CAGCAGCTCCTGGGGTGGAGGGG - Intergenic
997231097 5:132243682-132243704 CTGCAGCTGCTGTGGGGGATAGG + Intronic
997400494 5:133598265-133598287 CTTCAGATCCTGGGGGACACTGG - Intronic
997568091 5:134904941-134904963 CTGAAGCTCCTGGGGGTGTTCGG + Intronic
997629997 5:135360238-135360260 AGGCAGCTCCTGTGGGAGATGGG - Intronic
997831720 5:137156134-137156156 CCTCAGGTCCTGGGGGAGCAGGG + Intronic
998746088 5:145261137-145261159 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
998783522 5:145684415-145684437 CTGTAGGTCGTGGGAGAGAAAGG + Intronic
998944887 5:147327837-147327859 CTGCAGCTCTGAGGGGAGCACGG + Intronic
999089925 5:148927097-148927119 CTACAGCTCTTGGGAGAGAATGG - Intronic
999119132 5:149195505-149195527 CTTCAGCTCCTTGGGGGCAATGG + Intronic
999717443 5:154372741-154372763 CGGCAGCCCCTGGGGCAGAATGG + Intronic
999818509 5:155200995-155201017 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
1000511618 5:162190187-162190209 CTGCAGCTGCTGTGGGGGATAGG + Intergenic
1001085470 5:168697181-168697203 CTCCAGCTTCTGGGGGATGAAGG + Intronic
1001287661 5:170435556-170435578 CTTCTCCTCCTGGGAGAGAATGG - Intronic
1001693770 5:173654080-173654102 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1002055925 5:176597870-176597892 CTGCAGCACCAGGGGAAGCAGGG - Exonic
1002058976 5:176615220-176615242 CCGCAGCTGCTGGGGGTGAGGGG - Intergenic
1002433752 5:179219203-179219225 CTGCTGCTCCTGGGGGAAGGAGG - Intronic
1002637340 5:180614878-180614900 GTTCCGCGCCTGGGGGAGAAAGG - Intronic
1003058113 6:2841402-2841424 CTGCAGCTGCAGGGAGAGAGAGG - Intronic
1003123627 6:3337991-3338013 CTCTTGCTCCTGTGGGAGAAGGG - Intronic
1003427475 6:6007282-6007304 CCCCAGCTCCTGGCGGGGAAGGG - Intronic
1003450876 6:6230411-6230433 CTGCAGCTGCTGTGGGGGATGGG - Intronic
1003581946 6:7347888-7347910 CTGCAGCTGCTGTGGGGGATGGG - Intronic
1005246126 6:23887386-23887408 CGGCTGCTGCTGGGGCAGAAGGG - Intergenic
1005671183 6:28107848-28107870 CAGGAGCTCCTCGGGCAGAATGG - Intergenic
1005683250 6:28227389-28227411 CTGGAGCTCCTTGGGCAGAATGG - Exonic
1005689043 6:28284094-28284116 CTGGAGCTCCTTGGGCAGGATGG - Exonic
1005994416 6:30922692-30922714 CTGCAGCACCTGGGGATGGAAGG - Exonic
1006389727 6:33751295-33751317 CTGAAGATACTGGGGTAGAAGGG + Intergenic
1006634159 6:35450388-35450410 CTGCAGTTCATGGGGGTGGAGGG - Intergenic
1006645628 6:35512497-35512519 CTGGAGATCTGGGGGGAGAAAGG - Intronic
1006670104 6:35725068-35725090 CCCATGCTCCTGGGGGAGAAAGG + Intronic
1006725488 6:36196778-36196800 CCGCCGCTCCCGGGGGAGGAGGG - Exonic
1007073907 6:39054765-39054787 CAGCAGCTGCTGGGGGTGGAGGG - Intronic
1007165659 6:39827348-39827370 CTGCAGATCATGTCGGAGAAAGG + Intronic
1007181805 6:39934213-39934235 CGGGAGCTACTGGGGGAAAAGGG + Intronic
1007821364 6:44562800-44562822 CTGCAAGTCCAGGTGGAGAATGG - Intergenic
1011133147 6:84072747-84072769 CTGCAGCTGCTGTGGGAGATGGG + Intronic
1011375515 6:86682178-86682200 CTGCAGCTGCTGTGGGAGATGGG + Intergenic
1012203778 6:96436806-96436828 CTGCGGCTCCTATGGGAGATGGG - Intergenic
1012221723 6:96657478-96657500 CTGCACCTCCTGGAGGGGAATGG - Intergenic
1012793744 6:103734370-103734392 CTGCAGCTGCTGTGGGGGACAGG - Intergenic
1012922680 6:105235441-105235463 CTGCAGCTGCTGTGGGTGATGGG - Intergenic
1013721042 6:113028374-113028396 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1014009272 6:116458247-116458269 CGGGAGCACCTGGGGAAGAAGGG - Intergenic
1014300464 6:119675499-119675521 CTACAGCTATGGGGGGAGAATGG + Intergenic
1014638575 6:123880054-123880076 TTACAGATCCTGGGCGAGAAGGG + Intronic
1016351750 6:143176518-143176540 CTCCAGCTGCTGTGGGAGATTGG + Intronic
1016585027 6:145674391-145674413 CTGCAGTTCCTTGGGGGCAATGG + Intronic
1016840519 6:148520083-148520105 CTGCAGCTGCTCCGGCAGAAAGG + Intronic
1019051665 6:169188366-169188388 CTCCAGCTGCTGGTAGAGAATGG + Intergenic
1019351734 7:557166-557188 CTGCTGATCCTGGTGGAGATGGG - Intronic
1019504278 7:1383022-1383044 CTGCAGGGCCTGGGGGTGCACGG - Intergenic
1019606656 7:1913514-1913536 CTCCAGGACCTGGGGGAGCAAGG - Intronic
1020004400 7:4774704-4774726 GGGAAGCTCCTGAGGGAGAAAGG - Intronic
1020361293 7:7329525-7329547 CAGCAGTGCCTGGGGGACAAAGG - Intergenic
1022536216 7:31100274-31100296 CTGCCGCTGCTGGAGGAGAGTGG + Intronic
1023401630 7:39795836-39795858 CTGAAGCTGCTGGGGCAGTATGG - Intergenic
1023720526 7:43089001-43089023 CTGCTGCTCCAGGGTAAGAAGGG + Intergenic
1024647988 7:51384839-51384861 CTGAAGCTGCTGGGGCAGCATGG + Intergenic
1024659117 7:51476253-51476275 TTCCATCTCCTGGGGGAGCAGGG - Intergenic
1024799622 7:53061062-53061084 CAGGAGCTCCAAGGGGAGAAAGG + Intergenic
1025177181 7:56807884-56807906 CTGAAGCTGCTGGGGCAGCATGG + Intergenic
1025638858 7:63349284-63349306 CTGCAGATCCTGAGGAAGGAGGG - Intergenic
1025643841 7:63398808-63398830 CTGCAGATCCTGAGGAAGGAGGG + Intergenic
1025694611 7:63768502-63768524 CTGAAGCTGCTGGGGCAGCATGG - Intergenic
1025739704 7:64184513-64184535 CTGGACCTCCTGGGCGGGAAAGG + Intronic
1026359741 7:69591983-69592005 CTGCAGCTCTTGGGGGAGCCGGG - Intergenic
1026824704 7:73574151-73574173 TAGGAGCTCCTGGGGGAGATGGG + Intronic
1026877737 7:73889255-73889277 CTGCAGCTCCTTGCAGAGCAGGG - Intergenic
1026992405 7:74594592-74594614 CTGCTGCTGCTGGGGGAGCCTGG - Intronic
1027963860 7:84981016-84981038 CTGCAGCTGCTGTGGGATATGGG + Intergenic
1029260812 7:99301587-99301609 CTGCAGGTCCTGGGGGGCACAGG - Intergenic
1029352441 7:100023823-100023845 CTGGAGCTCCTTGGGCAGGATGG - Exonic
1029356680 7:100057290-100057312 CTGGAGCTCCTGGGGCAGGATGG - Exonic
1030935992 7:115585367-115585389 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
1031274370 7:119699976-119699998 CTGTAATTCCTTGGGGAGAAAGG - Intergenic
1031827967 7:126589444-126589466 CTGCAGCTGCTGTGGGGGATGGG - Intronic
1031905627 7:127457422-127457444 CTGCAGCTTGAGGTGGAGAAGGG - Intergenic
1032052136 7:128656205-128656227 CTGAAGCTGCTGGGGCAGCATGG - Intergenic
1032458981 7:132095354-132095376 CTGCAGCTGCTGGGAGTGCAGGG + Intergenic
1033416059 7:141162129-141162151 CTGCAGTTCCTGTGGGGAAACGG - Intronic
1033816728 7:145082799-145082821 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1033887148 7:145963052-145963074 CTGCTGCTGCTGGGGAATAAGGG - Intergenic
1034061876 7:148099568-148099590 CTGCAGCCATTGGGGGAAAAGGG - Intronic
1034731175 7:153388775-153388797 CTGCTGCTCCTGGTGGAGGGTGG - Intergenic
1035163398 7:156967921-156967943 CTGGAGCGCCTGGGGGGCAAAGG + Intronic
1035221025 7:157406648-157406670 CTGGAGTGACTGGGGGAGAAAGG - Intronic
1036184761 8:6613588-6613610 CTGCAGTTCCCCGGGGAGACAGG + Intronic
1036216024 8:6880493-6880515 CTGTAGATCCTGGGAGTGAAAGG + Intergenic
1036454216 8:8893454-8893476 CTCGAGCTCCTGGGGGAGGGCGG + Exonic
1036627383 8:10483309-10483331 CTGAAGGTCCCGGGGGAGAATGG + Intergenic
1036660759 8:10706970-10706992 CTGCACATCCTGGGGGTGCAGGG + Intronic
1036786941 8:11694046-11694068 CGGCACCTCCTTGGGGAAAAGGG - Intronic
1037627299 8:20619222-20619244 CTGGGAATCCTGGGGGAGAATGG + Intergenic
1038317940 8:26503375-26503397 GTGCAGCCCCTGGAGGGGAAGGG - Intronic
1038455157 8:27668053-27668075 CTGCAGCTCCTGGGCAATGAAGG + Intronic
1038578929 8:28730094-28730116 CTGGACCTCCAGGGGGAGGATGG + Intronic
1039095552 8:33880897-33880919 CTGCAGCTGCTGTGGGGGACGGG + Intergenic
1039251025 8:35664249-35664271 CTACAGATCCTGGGGTAAAATGG + Intronic
1040882482 8:52221785-52221807 CTGTAGTTCCTGGGGAAAAATGG + Exonic
1040891409 8:52320812-52320834 CTGCGTCTCCTGTGGGTGAATGG - Intronic
1041047120 8:53898106-53898128 CAGCAGCTCCTGGTGGTGCAAGG - Intronic
1041424640 8:57706610-57706632 CTGCAGCTTCTGGAAGTGAAAGG - Intergenic
1043545116 8:81306658-81306680 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
1044496763 8:92896246-92896268 CTGCAGCTCCGGGGACACAAGGG + Intronic
1047555470 8:125924612-125924634 CTACAGCTACTGGGGGAAATGGG - Intergenic
1048875700 8:138835581-138835603 CTGCAGGTCCTGAGGGGGATAGG - Intronic
1049307243 8:141910605-141910627 CAGCAGCTCCTGAGGCACAAGGG + Intergenic
1049798407 8:144506764-144506786 CTGCGCCTCCTGGAGGAGACCGG + Exonic
1049865762 8:144934456-144934478 CTGAAGCTCATGGGGGACATTGG - Intronic
1049994002 9:1017539-1017561 CTGCAAGTCCTGGGGAAGACTGG - Intergenic
1050898707 9:10916623-10916645 TTACAGCTACTGTGGGAGAATGG + Intergenic
1051709686 9:19918973-19918995 CTTCAGATCCTGGGGAAGAGAGG - Intergenic
1052253491 9:26426971-26426993 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
1053593384 9:39534591-39534613 CTGGAGCTGCTGGAGCAGAAAGG - Intergenic
1053851118 9:42289299-42289321 CTGGAGCTGCTGGAGCAGAAAGG - Intergenic
1054572922 9:66830686-66830708 CTGGAGCTGCTGGAGCAGAAAGG + Intergenic
1055346990 9:75350041-75350063 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1055683287 9:78741472-78741494 CTCCCGCCACTGGGGGAGAAAGG - Intergenic
1055912053 9:81364205-81364227 CTGCAGCTGCTGTGGGGGTAGGG - Intergenic
1056771959 9:89484103-89484125 CTCCAGTTCCTGGGGGAGCCCGG - Intronic
1057208749 9:93188170-93188192 CTGCAGGTGCTGCGGGAGTAGGG - Intronic
1057475711 9:95399448-95399470 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
1057887381 9:98840192-98840214 CTGCAAATCCTGGGCAAGAAAGG + Intronic
1057888112 9:98846387-98846409 CTGCAGCTCATGGGGGTGCAAGG - Intronic
1060482117 9:124022775-124022797 CTGCAGCTGCGGGGGGAGCCGGG + Intronic
1060765827 9:126294513-126294535 CTCCAGCCCCGGGGGCAGAAAGG + Intergenic
1060785884 9:126451386-126451408 CTGCACCTCCAGGTGGAGGAGGG + Intronic
1061239528 9:129361538-129361560 CTGGAGATCCTGGGGAAGTATGG - Intergenic
1061788234 9:133043827-133043849 CGGCAGCTCCTGGTGGAAAAAGG - Exonic
1062151799 9:135023275-135023297 CTGTAGCTGCTGGGGATGAAGGG - Intergenic
1062301913 9:135878340-135878362 CTGCAGCATCTGTGGGGGAATGG - Intronic
1062304142 9:135893052-135893074 CTGCAGCTTCTTGAGGAGCAGGG - Intronic
1062307825 9:135919675-135919697 TTGCAGAACCTGGGGGAGAAGGG - Intergenic
1062379754 9:136281550-136281572 CCGCAGCTCCGGGGGGTGCAGGG + Exonic
1062499954 9:136848057-136848079 CTGCAGCGGCTGGAGGCGAAGGG - Exonic
1062754875 9:138281795-138281817 CTGAAGCTGCTGGGGCAGCATGG - Intergenic
1203787136 EBV:134334-134356 CTGCATTGCCTGGGGGAGCAGGG - Intergenic
1203578783 Un_KI270745v1:25964-25986 CTGAAGCTGCTGGGGCAGCATGG - Intergenic
1185734852 X:2488902-2488924 CTGCAGCACCTTGGGCAGCAGGG + Exonic
1186257893 X:7742378-7742400 CTGCAGTCCCAGGGGAAGAAGGG + Intergenic
1186371380 X:8950871-8950893 ATACAGCCCCTGGGGTAGAACGG + Intergenic
1187219197 X:17307744-17307766 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1187588846 X:20693497-20693519 CTGCAGCTGCTGTGGGGGACAGG - Intergenic
1188045906 X:25426116-25426138 CTGCGGCTGCTGGGGGGGATGGG + Intergenic
1188545555 X:31301851-31301873 CTGCAGCTCCAGGAAGGGAATGG + Intronic
1188823838 X:34805772-34805794 CAGCAGCACATGGTGGAGAAGGG - Intergenic
1189407100 X:40735304-40735326 CGGCGGCTCCCGGGGGAGGAGGG + Exonic
1190118515 X:47641386-47641408 CTGCAGCTGCTGAGAGAGCAAGG - Exonic
1190152644 X:47960662-47960684 ATGGAACTCCTGGTGGAGAAGGG + Intronic
1190448929 X:50558074-50558096 CTGCAGCTGCTGTGGGTGATGGG - Intergenic
1190732070 X:53233054-53233076 CTGCAGCCCATGGTGGAGAGGGG + Exonic
1191067624 X:56367161-56367183 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1191080362 X:56504302-56504324 CTACAGCTGCTGTGGGAGATGGG - Intergenic
1191266794 X:58403650-58403672 CTGAAGCCATTGGGGGAGAAAGG + Intergenic
1192207048 X:69103231-69103253 CTGGTGAACCTGGGGGAGAAGGG - Intergenic
1192214650 X:69150135-69150157 CTGCAGCTCCGGGGGCAGGAAGG + Intergenic
1192224931 X:69221628-69221650 CTGCAGCTCTGGGGGCAGGATGG - Intergenic
1192914525 X:75638253-75638275 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1193404253 X:81082631-81082653 CTGCAGCTGCTGTGGGGGACTGG - Intergenic
1193578508 X:83232811-83232833 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
1193779648 X:85686233-85686255 CTGCAGCTGCTGTGGGAGATGGG + Intergenic
1193937119 X:87636795-87636817 CTGCAGCTGCTGTGGGGGATGGG - Intronic
1193937620 X:87641860-87641882 CTGCAGCTGCTGTGGGAGATTGG - Intronic
1194515970 X:94854650-94854672 CTGCAGCTGCTGTGGGGGATAGG - Intergenic
1194932147 X:99901364-99901386 CTGCAGCTGCTGAGGGGGATGGG + Intergenic
1195075869 X:101326694-101326716 CTGCAGCTGCTGTGGGGGATGGG - Intergenic
1195177377 X:102323774-102323796 CTGCTGCTCCTGGGAGAGGGAGG - Exonic
1195181487 X:102363319-102363341 CTGCTGCTCCTGGGAGAGGGAGG + Exonic
1195231977 X:102859416-102859438 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1196106641 X:111903597-111903619 CTGCATCTCCTCCAGGAGAATGG + Intronic
1196231892 X:113233648-113233670 CTGCAGCTGCTGTGGGTGATGGG + Intergenic
1196737484 X:118992489-118992511 CTGCAGCTGCTGTGGGGGATGGG - Intronic
1197055490 X:122113773-122113795 CTGCAGCTGCTGTGGGGGATGGG + Intergenic
1197107335 X:122731978-122732000 CTGGAGGTCCTGGGGGGAAAGGG + Intergenic
1198433122 X:136587820-136587842 CTACAGGTGTTGGGGGAGAAGGG + Intergenic
1198797280 X:140410610-140410632 CTGCAGCTGCTGTGGGAGATGGG + Intergenic
1198843240 X:140881017-140881039 CTGCAGCTGCTGTGGGGGGATGG - Intergenic
1200179844 X:154143646-154143668 CTACAGCTCATGGGGGGCAAGGG + Intergenic
1201549136 Y:15200913-15200935 CTGCAGCTCATGGTGGATGATGG - Intergenic
1202125515 Y:21565873-21565895 CAGCAGCTCCTGAGGCTGAATGG - Intergenic
1202153493 Y:21863519-21863541 CAGCAGCTCCTGAGGCTGAATGG + Intergenic
1202381405 Y:24278582-24278604 CTGAAGCTGCTGGGGCAGCAAGG - Intergenic
1202489380 Y:25391544-25391566 CTGAAGCTGCTGGGGCAGCAAGG + Intergenic