ID: 900977910

View in Genome Browser
Species Human (GRCh38)
Location 1:6028586-6028608
Sequence GCTGGTGGCCGCTCTGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 1, 2: 4, 3: 38, 4: 318}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900977897_900977910 24 Left 900977897 1:6028539-6028561 CCCCCTCTCTCCATCCCTTCTGC 0: 1
1: 0
2: 21
3: 219
4: 1779
Right 900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG 0: 1
1: 1
2: 4
3: 38
4: 318
900977896_900977910 25 Left 900977896 1:6028538-6028560 CCCCCCTCTCTCCATCCCTTCTG 0: 1
1: 3
2: 56
3: 852
4: 7114
Right 900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG 0: 1
1: 1
2: 4
3: 38
4: 318
900977898_900977910 23 Left 900977898 1:6028540-6028562 CCCCTCTCTCCATCCCTTCTGCG 0: 1
1: 0
2: 2
3: 70
4: 693
Right 900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG 0: 1
1: 1
2: 4
3: 38
4: 318
900977904_900977910 9 Left 900977904 1:6028554-6028576 CCTTCTGCGATGTTCACTAGGCA 0: 1
1: 0
2: 0
3: 5
4: 77
Right 900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG 0: 1
1: 1
2: 4
3: 38
4: 318
900977901_900977910 14 Left 900977901 1:6028549-6028571 CCATCCCTTCTGCGATGTTCACT 0: 1
1: 0
2: 0
3: 12
4: 192
Right 900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG 0: 1
1: 1
2: 4
3: 38
4: 318
900977903_900977910 10 Left 900977903 1:6028553-6028575 CCCTTCTGCGATGTTCACTAGGC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG 0: 1
1: 1
2: 4
3: 38
4: 318
900977900_900977910 21 Left 900977900 1:6028542-6028564 CCTCTCTCCATCCCTTCTGCGAT 0: 1
1: 0
2: 2
3: 35
4: 381
Right 900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG 0: 1
1: 1
2: 4
3: 38
4: 318
900977899_900977910 22 Left 900977899 1:6028541-6028563 CCCTCTCTCCATCCCTTCTGCGA 0: 1
1: 0
2: 2
3: 52
4: 606
Right 900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG 0: 1
1: 1
2: 4
3: 38
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900977910 Original CRISPR GCTGGTGGCCGCTCTGGGTG CGG Intronic
900402463 1:2478164-2478186 GCAGGTGGCCGAGCAGGGTGGGG + Intronic
900490170 1:2944063-2944085 GCTGCTGGCGGCTCTGGGACAGG + Intergenic
900497145 1:2980912-2980934 GCTGGCGGCAGCTGGGGGTGGGG + Intergenic
900591973 1:3464179-3464201 GCTGGTGGTGGCTCTAGGTCTGG + Intronic
900610067 1:3540974-3540996 GCTGGTGGCTTCTCTGGATGTGG - Intronic
900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG + Intronic
901626020 1:10625554-10625576 GCAGGTGGCACCTCTGTGTGTGG - Intronic
902383913 1:16065607-16065629 GCTTGGGGCCACTCTGGGTGGGG - Intronic
902929928 1:19723797-19723819 GCTGGTGGCCAATCTGTGAGAGG + Intronic
902954045 1:19912411-19912433 GCTGGTGGAGGCTCTGGAAGAGG - Exonic
903233564 1:21936172-21936194 GCTAGTGGCAGATGTGGGTGGGG - Intronic
903344234 1:22674006-22674028 GCTGGTGGGAGCTAGGGGTGGGG - Intergenic
904034515 1:27551588-27551610 GCTGTTGGCCAAACTGGGTGAGG + Exonic
904346679 1:29876945-29876967 GATGCTGGCTGCCCTGGGTGCGG + Intergenic
904908619 1:33917125-33917147 TCTGGTGGAGGCCCTGGGTGCGG - Intronic
905009409 1:34737045-34737067 GCTGGTGGCCTCTGTTGGGGGGG - Intronic
906680757 1:47724162-47724184 GCTGGTGACAGCTCTGGGGATGG - Intergenic
907632947 1:56102448-56102470 GCTGTTGGCTGATCAGGGTGTGG + Intergenic
912036594 1:105324512-105324534 GTTGGTGGTGGCTATGGGTGAGG - Intergenic
912500825 1:110121022-110121044 CCTGCTGGCCGCTGTGGCTGTGG - Intergenic
914919484 1:151837975-151837997 GCTGCTGCCCCCGCTGGGTGGGG - Exonic
915070452 1:153261517-153261539 TCTGGCGGCGGCTCTGGCTGCGG + Exonic
915242334 1:154532353-154532375 GCCCGGGGCCGCTCTGAGTGCGG + Intronic
915280377 1:154818376-154818398 GCTGCTGGCCCCCCTGGGAGAGG - Intronic
918465782 1:184820284-184820306 GCAGATGGCAGATCTGGGTGGGG + Intronic
918512025 1:185321959-185321981 GCGGCTGGCTGCTCTGAGTGCGG + Intergenic
918942991 1:191026272-191026294 CCAGCTGGCCGCTCTGAGTGTGG + Intergenic
922488800 1:225999130-225999152 ACAGGTGGCAGCGCTGGGTGCGG - Intronic
922764573 1:228150404-228150426 CCAGGTGGCCGCTGAGGGTGGGG - Intronic
923087437 1:230712284-230712306 GCTGGTTACGGGTCTGGGTGAGG - Intronic
923353168 1:233129206-233129228 GCCCGGGGCCGCTCTGAGTGCGG - Intronic
923490367 1:234478737-234478759 GCTGGCGGCCGCGCTGGCTGAGG - Exonic
923669636 1:236029503-236029525 GCTAGTGGCCGGTCTGGGGCTGG + Intronic
924454400 1:244207304-244207326 GGTGGTGACTGCTCTGTGTGTGG + Intergenic
924456070 1:244219743-244219765 GCTCGTGGCAGCAATGGGTGGGG + Intergenic
1063473701 10:6309626-6309648 GCTGGTGGCCGGCGGGGGTGAGG - Intergenic
1063957530 10:11280738-11280760 GACAGAGGCCGCTCTGGGTGGGG + Intronic
1065445598 10:25795215-25795237 GATGGTGGCTTCTCTGGGTTGGG + Intergenic
1066214983 10:33277479-33277501 GCTGGTGGCAGCGCTGGTGGTGG - Intronic
1068792274 10:61040754-61040776 GCCCGGGGCCGCTCTGAGTGCGG - Intergenic
1070742901 10:78914083-78914105 GCTGGTGCCCGCTTTGTCTGAGG + Intergenic
1070825121 10:79386310-79386332 GCGGGGGGTGGCTCTGGGTGCGG + Exonic
1072487403 10:95868999-95869021 GCTTTGGGCCACTCTGGGTGGGG + Exonic
1072791424 10:98320993-98321015 GGTGGTGCTGGCTCTGGGTGAGG + Intergenic
1075211025 10:120491123-120491145 GCTGCTGGCCCTGCTGGGTGAGG + Intronic
1075734770 10:124657855-124657877 GCTGGTTGCGGCTCTAGCTGTGG - Intronic
1076798976 10:132811968-132811990 GCTGATGGCCCCACTGTGTGGGG - Intronic
1077030235 11:462215-462237 GCTCCTGGCCCCTCTGGGTCTGG - Intronic
1077526353 11:3067981-3068003 ACTGGAGACCGCCCTGGGTGGGG - Intergenic
1078369543 11:10733552-10733574 GCAGGAGGCCGCTATGGGGGTGG + Intergenic
1079394637 11:20051083-20051105 GCTGGTGTCAGCTCAGGCTGAGG + Intronic
1080643780 11:34173786-34173808 GCTGGTGGCAGCCCTGGGTTTGG - Intronic
1080926987 11:36767854-36767876 TCAGGTTGCCGCTCAGGGTGTGG + Intergenic
1081710559 11:45212960-45212982 GCTGGTGGGGGCTCTGGCAGGGG - Intronic
1083193850 11:61071404-61071426 GGTGGTGGCGGCTCTGAGGGAGG + Intergenic
1083743008 11:64721074-64721096 GGTGGCAGCCTCTCTGGGTGGGG + Intronic
1084086668 11:66858116-66858138 GCTGGTTGCCGCTGAGGATGAGG - Exonic
1084387558 11:68853881-68853903 ACTGGTGGCTGCCCCGGGTGGGG - Intergenic
1084680222 11:70662498-70662520 GCCGGTGGCCGGTCGGGGAGGGG + Intronic
1085444072 11:76589181-76589203 CCTAGTGCCCGCTCAGGGTGTGG + Intergenic
1086349909 11:85935011-85935033 GCTGGCGGCCGCTTTGGGGATGG - Intergenic
1089668471 11:120035255-120035277 GCTAGTGGCCACTCTGGCTGGGG + Intergenic
1089967089 11:122662391-122662413 ACTGGTGGCTGCTCAGGGTTGGG - Intronic
1090807626 11:130212226-130212248 ACTGGTGGGCCCGCTGGGTGGGG + Intergenic
1093579136 12:20767857-20767879 GTTGGTGGCTGAGCTGGGTGAGG - Intergenic
1095638039 12:44454878-44454900 GCTGGTGGCTGAGCTTGGTGAGG - Intergenic
1096549408 12:52362441-52362463 GCTGGAGGCTGCTGTGGCTGAGG - Exonic
1097262315 12:57726639-57726661 CGTGGTGGCCGCGCTGGGCGTGG + Exonic
1100154972 12:91787738-91787760 ACTCGTGACCGCTCTGGTTGGGG - Intergenic
1101051512 12:100868646-100868668 TGTGGTGGCTGCCCTGGGTGTGG - Intronic
1102646416 12:114406698-114406720 TCTGGTGGCCCCACTGGGTGGGG - Intronic
1102870446 12:116410001-116410023 GCTGTGGGCTGCTCTGGGGGTGG + Intergenic
1103341024 12:120221273-120221295 GTTGATGGCTGCTCTGGGTGGGG - Intronic
1103564326 12:121807925-121807947 GCGGGTGGCACCTCTGGGTTTGG + Intronic
1104408054 12:128534837-128534859 GCTGGTGTCACCTCTGGATGGGG - Intronic
1106411311 13:29513492-29513514 GCTGGTGGCAGCTCAGTCTGGGG - Exonic
1107831148 13:44374323-44374345 GGTCGTGGCCCCTCTGGGAGTGG + Intronic
1108594116 13:51935771-51935793 ACTGGGGGCCGCTGAGGGTGGGG - Intronic
1109638107 13:65149851-65149873 CCAGCTGGCCGCTCTGAGTGAGG + Intergenic
1111432403 13:88161023-88161045 GCTGGAGGTCCCTTTGGGTGAGG + Intergenic
1112288451 13:98124462-98124484 GCTGGTGGCCACTGTGGCTGGGG - Intergenic
1114219350 14:20682991-20683013 GCTGTTGGCCTCACTGGGCGCGG - Intergenic
1114450398 14:22821861-22821883 TCAGGTGACCGGTCTGGGTGCGG + Intronic
1119326957 14:73765751-73765773 TCTGGTGGGAGATCTGGGTGTGG - Intronic
1119688506 14:76652479-76652501 GCTGGTGGGGGCTGGGGGTGGGG - Intergenic
1120974864 14:90239671-90239693 GCTTGTGGGTGCTCTGCGTGTGG + Intergenic
1121088799 14:91167215-91167237 GCTGGTCGGAGCTCTGGGTATGG - Exonic
1122349241 14:101078033-101078055 GCTGGGGGCTGCTCTGGGTTCGG + Intergenic
1122976319 14:105172321-105172343 GCAGGTGGCGGCACAGGGTGGGG - Intergenic
1122995496 14:105261762-105261784 GCTGGTGTCCGCTCAGGGTGGGG - Intronic
1123112245 14:105878405-105878427 GCTGCAGGCAGCTCTGGGGGTGG - Intergenic
1128112666 15:65086489-65086511 GCTGGTGCCCCCTCTGGTGGAGG + Intergenic
1129297700 15:74608952-74608974 GCTGCTAGCAGCACTGGGTGTGG - Intronic
1129316989 15:74751016-74751038 GCTGGTAGCAGCCCTGGGTATGG - Intronic
1129462792 15:75708242-75708264 GCTGGGAGCCGGCCTGGGTGTGG + Intronic
1129722082 15:77883174-77883196 GCTGGGAGCCGGCCTGGGTGTGG - Intergenic
1129734650 15:77952769-77952791 GCTGGTGGCAGGTCTGGGGGTGG - Intergenic
1129823699 15:78620796-78620818 GCTGGTGGCCGGGCTGGCCGCGG + Exonic
1129840940 15:78743222-78743244 GCTGGTGGCAGGTCTGGGGGTGG + Intergenic
1131131097 15:89901005-89901027 GCTGTTGGCCTCTCTGGGAATGG + Exonic
1131356667 15:91751168-91751190 GCTGGTGGCTGCTGTGGCAGTGG + Intergenic
1131979404 15:97980475-97980497 GCTGAAGGCCGGGCTGGGTGTGG + Intergenic
1132044202 15:98549836-98549858 CCGGCTGGCCGCTCTGAGTGCGG - Intergenic
1132143808 15:99415128-99415150 GCTGGGGGCTGCCTTGGGTGAGG - Intergenic
1132285473 15:100659068-100659090 ACTGGTGGCCGGGCAGGGTGGGG + Intergenic
1132890062 16:2199404-2199426 GCAGGTGGCCACTCTGGCTGGGG + Intergenic
1133234757 16:4382632-4382654 GCTCCTGGCCGCGCTGGCTGCGG + Exonic
1133443501 16:5840349-5840371 GGGGGTGGCCTCTCTGGGTGTGG - Intergenic
1133634715 16:7654050-7654072 GCTGGGGGCGGTTCTGGGGGTGG - Intronic
1133908219 16:10040822-10040844 GCTGGAGGCAGCTGTGGGGGAGG + Intronic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1139472877 16:67187586-67187608 GTTGGTGGCTGCTGTGCGTGTGG - Exonic
1139583434 16:67886211-67886233 GCTGGCGGCTGCTCTGGCTCTGG + Exonic
1139949917 16:70663773-70663795 GCTGGTGGCGGCTGGGGGTGGGG + Exonic
1139958846 16:70706197-70706219 GCTGTTGGCAGCTGTGGATGGGG + Intronic
1141829906 16:86504416-86504438 TGTGGTGGCAGCTCTTGGTGTGG - Intergenic
1142383642 16:89748471-89748493 GCTGGTCGCCGTCCTGGCTGTGG + Intronic
1142643827 17:1299755-1299777 GCTTTGGGCCACTCTGGGTGTGG - Exonic
1142996009 17:3760938-3760960 GCTGGTGGCCTCCAAGGGTGAGG - Intronic
1143527711 17:7482104-7482126 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1143547115 17:7604024-7604046 GCTGGTGGCTGGCCCGGGTGCGG - Exonic
1143637871 17:8176694-8176716 GCTGGGGGCCGCTCCCGGCGTGG - Intergenic
1143822436 17:9575683-9575705 GCTGGTGGCCTTTCGGGATGAGG - Intronic
1144778432 17:17796250-17796272 GCTGGAGGCAGCCTTGGGTGAGG - Exonic
1146731047 17:35194166-35194188 GCTGGTGGCCCTGCTGGGTGGGG - Exonic
1147997345 17:44367866-44367888 GCTGGAGGCAGGTGTGGGTGAGG - Intergenic
1147997868 17:44370997-44371019 GCTGAAGGCCCCTCTTGGTGGGG + Intergenic
1149576181 17:57715286-57715308 CCTGGTGGCCCCTCTCTGTGTGG - Intergenic
1151567480 17:74907319-74907341 GCTGGTGACCGCTCCGAGTGCGG + Intergenic
1151907454 17:77057744-77057766 CCTGGTGCCTGCTCTGGATGGGG - Intergenic
1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG + Intergenic
1154217175 18:12423694-12423716 GCTGGTGGGTGCAGTGGGTGGGG + Intronic
1154423317 18:14252996-14253018 GGTGGTGGTCGCTCAGGCTGTGG - Intergenic
1158559583 18:58502855-58502877 GCTGGCGGCTGCTCTGGGTGGGG - Intronic
1159028590 18:63208797-63208819 GCTGTAGGCAGCTCTGGGTTGGG + Intronic
1161001657 19:1913922-1913944 GCAGGTGGGGGCTCTGCGTGGGG + Intronic
1161270619 19:3387576-3387598 GCTGGGGGCCACTCTGGATGGGG + Intronic
1161289086 19:3483262-3483284 GCTGCTGGCCGCGCTGGTGGTGG - Intergenic
1161314056 19:3609628-3609650 GCTGGTGGGAGGTCTGGGTTAGG + Intergenic
1161967924 19:7558949-7558971 GCTGGTGGCTGCTGTGGAAGCGG + Exonic
1162794579 19:13079841-13079863 GCTGGGGCCTGCTCTGGGTTGGG + Intronic
1163020673 19:14479482-14479504 GCGGGTGGCCGCCCTGGCTCTGG - Exonic
1163158769 19:15452776-15452798 CGAGGTGGCCGCTCTGCGTGAGG - Exonic
1163695353 19:18760930-18760952 GCTGGTGGCTGTTCTAGGTGGGG - Intronic
1165804439 19:38572088-38572110 TCTGGTGGCAGCTCTGGCTGGGG + Exonic
1165936415 19:39391542-39391564 GCAGGAGGCCGCTCTGGGCAGGG - Exonic
1165994331 19:39833549-39833571 GCTGGTGGTCACTCAGGGTGGGG - Exonic
1166214980 19:41328936-41328958 GCTGTTGGCAGCACTGGGTCTGG - Intronic
1166831927 19:45644508-45644530 GCAGCTGGCCTCTCTGGGTGGGG - Intronic
1166994500 19:46713834-46713856 GGTGGTGGCCGGCCTGGGGGCGG - Intronic
1168319038 19:55498047-55498069 GCTGCTGGCCGCTTTGGCTGGGG + Exonic
1168543695 19:57232727-57232749 GCTGGTGGGAGCTCTGTTTGTGG + Intronic
925172615 2:1759573-1759595 GCTGCTGGCCGCTCCGAGTAAGG + Intergenic
925325075 2:3012441-3012463 GGTGGTGGCAGCAATGGGTGGGG - Intergenic
925436676 2:3844310-3844332 TCAGGTGGCCGCTCTGGGTGTGG - Intronic
925436689 2:3844370-3844392 TCAGGTGGCTGCTCTCGGTGTGG - Intronic
927848529 2:26484669-26484691 ACTGGGAGACGCTCTGGGTGGGG - Intronic
928490561 2:31778535-31778557 AGTGGTGGCCGCTTAGGGTGGGG - Intergenic
931035723 2:58241019-58241041 GGTGGTCGCCGCGCTGGATGGGG - Intronic
932285642 2:70529614-70529636 GCAGGTGGCTGCTGTGGCTGGGG + Intronic
932549243 2:72750614-72750636 TCTGGTGTTAGCTCTGGGTGAGG + Intronic
933531618 2:83518253-83518275 CCAGCTGGCCGCTCTGAGTGCGG - Intergenic
934522719 2:95030108-95030130 GAGGGTGGCAGCTCAGGGTGGGG + Intronic
934966773 2:98730840-98730862 GCTGTTGGCGCCTCTGGGCGCGG - Intronic
935708505 2:105877138-105877160 GCAGGTGGCCTTTCTGTGTGAGG - Intronic
936514768 2:113174542-113174564 GGTGGGGGTGGCTCTGGGTGTGG + Intronic
937229886 2:120392023-120392045 GCAGGTGGCCGCTCTGTGGGGGG - Intergenic
937911778 2:127079075-127079097 CCTGGTGGCCAGTGTGGGTGGGG - Intronic
938500040 2:131827595-131827617 CCTGGTGGCCGCCCCTGGTGCGG - Intergenic
938931223 2:136088300-136088322 CCGGCTGGCCGCTCGGGGTGCGG + Intergenic
939008934 2:136822239-136822261 GGTGGAGGCCGGTCTGGATGGGG - Intronic
939541410 2:143498659-143498681 GGGGGTGGGAGCTCTGGGTGAGG - Intronic
942386962 2:175452665-175452687 TCTGGTGGCAGCTCTTGGTGAGG + Intergenic
942640969 2:178059902-178059924 GCTGGGGCCCACTCTGGGTCAGG + Intronic
942641607 2:178066730-178066752 GCTGCTGCCAGCTCTGGGTGAGG - Intronic
943689948 2:190859537-190859559 GCTGTTGGCTGCTCTGGGTATGG + Intergenic
943718056 2:191173748-191173770 GATGGTGGCAGTTCTGAGTGAGG + Intergenic
946374136 2:219297983-219298005 GCTGCTGGTGGCTCTGGCTGTGG - Exonic
947806706 2:232973696-232973718 GCTGGTGGCTCTTCTGGGTTTGG - Intronic
948950432 2:241247516-241247538 GCTGATGGCTGCCCTGGGAGAGG - Intronic
949017829 2:241723431-241723453 GCTGGTGGCTGCTCTGGGTGTGG + Intronic
1170627918 20:18043539-18043561 GCTGGTGGCAGCCCTGAGTTGGG - Intronic
1170678934 20:18507936-18507958 GCTTGTTGCAGCTGTGGGTGAGG + Exonic
1171494907 20:25548744-25548766 GCTGGGGTCAGCCCTGGGTGAGG - Intronic
1171495089 20:25549294-25549316 GCTGGGGTCAGCCCTGGGTGAGG - Intronic
1172038636 20:32028489-32028511 GCAGGTGGCCACTGTGGCTGTGG + Intronic
1172130340 20:32650773-32650795 GCTGGTGGCTGGGCTGGGGGTGG + Intergenic
1172446515 20:34996285-34996307 TGTGGTGGCCGCTCAGAGTGCGG + Intronic
1173656664 20:44704395-44704417 CTTGGGGGCTGCTCTGGGTGAGG + Intergenic
1174317553 20:49714068-49714090 GGCGGTGGCCGCACTGGGAGAGG - Intergenic
1174402686 20:50284356-50284378 GCAGGTGGAGGCCCTGGGTGGGG - Intergenic
1174579939 20:51564177-51564199 GCTGGAGGCCACCCTGGTTGAGG - Intergenic
1175696327 20:61105784-61105806 CCTGGTGCCCGCCATGGGTGTGG - Intergenic
1177795891 21:25778449-25778471 GCGGCAGGCCGCTCTGAGTGCGG - Intergenic
1180056022 21:45359625-45359647 GATGGGGGCTGCTCTAGGTGGGG + Intergenic
1180171901 21:46063939-46063961 ACTTCTGGCCTCTCTGGGTGGGG - Intergenic
1181115988 22:20632835-20632857 GCTCCTGGCTGCTGTGGGTGGGG - Intergenic
1181116619 22:20635710-20635732 GCTGCTTGGGGCTCTGGGTGAGG + Intergenic
1181167473 22:20991443-20991465 GCTGGTGCCCGTGCTGGATGGGG + Intronic
1181670608 22:24424033-24424055 GCTGGTGGCCGGGCGGCGTGGGG + Intronic
1181829222 22:25546088-25546110 GCTGCTGGCCCCTCTGTGTCTGG + Intergenic
1182865928 22:33604461-33604483 GATGGTGCCCGCTGTGCGTGTGG - Exonic
1182933181 22:34194432-34194454 GGTGGTGGATGCTCTCGGTGTGG - Intergenic
1183021777 22:35033303-35033325 CCTGGTGGCAGCTGTGTGTGGGG + Intergenic
1183599138 22:38829948-38829970 GCTGGTGGCTGCTGTGACTGAGG + Intronic
1184037038 22:41923172-41923194 TCTGGTGGCAGCTCAGGGGGAGG + Intergenic
1184421897 22:44386956-44386978 GCTGGTGACTGCTCGGGGTCTGG + Intergenic
1185069070 22:48646502-48646524 GCTGGGGGCCCCTCTGTGGGTGG + Intronic
1185123058 22:48984913-48984935 GCTGGGGGACGCTCTGGGCCGGG - Intergenic
1185244532 22:49765993-49766015 GCTGGTGGCCCCTGTGGGGAGGG + Intergenic
1185272324 22:49935170-49935192 GCTGGTGGTCGCGGTGGGGGTGG + Intergenic
949871500 3:8593473-8593495 GCTGGAGGAGGCTCAGGGTGGGG - Intergenic
950522377 3:13504859-13504881 GCTTGAGGCCTCTATGGGTGGGG + Exonic
950887503 3:16374385-16374407 GCAGGTGGCAGATCTGGGAGGGG + Intronic
951927213 3:27921611-27921633 GCTGCTGGCAGCTCTGCATGGGG + Intergenic
953055112 3:39381733-39381755 GCTCTTGGCCACTCTGGGTGTGG - Intergenic
954213538 3:49111644-49111666 GCTGGTGACCCCTATGGCTGAGG - Exonic
954239818 3:49284792-49284814 GCTGGTTTCTGCTCTGGATGTGG - Intronic
954327042 3:49869419-49869441 GCTGGAGGCGGCTCTGGGAACGG + Intronic
956583947 3:70844296-70844318 GCTGGTGGAAGCTGGGGGTGGGG - Intergenic
957661641 3:83163291-83163313 GCTTGTGTCCCCTCTGGTTGGGG - Intergenic
960955413 3:123027547-123027569 GCTGGCGGCCGGTCTGGGAATGG + Intronic
961118001 3:124348324-124348346 GCTGGGAGCCTCCCTGGGTGAGG - Intronic
961180915 3:124876733-124876755 GCTGTAGGCCTCCCTGGGTGAGG - Intronic
962463782 3:135638458-135638480 GCTGGTGGTTGCTCAGGGTGGGG - Intergenic
962610517 3:137072517-137072539 GCTGGTGGCAGCTCAGCGTGGGG + Intergenic
966232522 3:177667026-177667048 GCTGGTGGCTGAGCTTGGTGAGG + Intergenic
968472466 4:788321-788343 GCTGCAGGTGGCTCTGGGTGTGG + Intronic
968830492 4:2931055-2931077 CCTGGTGGCCGCTTCAGGTGAGG - Exonic
970533127 4:17002712-17002734 GTTGGTGGCTGAGCTGGGTGAGG - Intergenic
978285514 4:107073181-107073203 GCTGGCCGCCGCTCAGAGTGCGG - Intronic
985369517 4:189270756-189270778 GCTGCTGACTGCTCAGGGTGGGG - Intergenic
985369523 4:189270779-189270801 GCTGCTGACTGCTCAGGGTGGGG - Intergenic
985579644 5:689927-689949 GGTGGGGGCTGCCCTGGGTGGGG + Intronic
985594490 5:781986-782008 GGTGGGGGCTGCCCTGGGTGGGG + Intergenic
985778326 5:1856948-1856970 AGTGGCGGCCCCTCTGGGTGGGG - Intergenic
986370711 5:7077651-7077673 GCTGGTGGCAGTTCTCAGTGGGG + Intergenic
988928860 5:36015956-36015978 CCTGGTGGGCACTCTGTGTGGGG - Intergenic
990986049 5:61641970-61641992 GCTGGTGGCAGGTCTGGATGGGG + Intronic
990992828 5:61701881-61701903 GCTGCTGGCCTCTGGGGGTGGGG - Intronic
996530379 5:124521705-124521727 GCGGCCGGCCGCTCTGAGTGTGG - Intergenic
997784958 5:136701883-136701905 ACTGGTGATTGCTCTGGGTGTGG - Intergenic
998733510 5:145108092-145108114 GTTGGAGGCTGCTCTTGGTGTGG + Intergenic
999053792 5:148551944-148551966 GCTAGTGGCTGGTCTGGGAGAGG + Intronic
1000276989 5:159746738-159746760 GCTCCTGGCCCCTCTGGGAGTGG + Intergenic
1001225347 5:169940064-169940086 CCTGGTGACGGCTGTGGGTGGGG + Intronic
1001819458 5:174698618-174698640 TCTGCTGGCCTCTCTAGGTGGGG + Intergenic
1003097916 6:3156880-3156902 GCAGGTGACTGCGCTGGGTGGGG - Intronic
1003176858 6:3758248-3758270 CCTGCTGGCCGCTCCGAGTGCGG - Intergenic
1003243535 6:4365187-4365209 GCTGATGGCGCCTGTGGGTGGGG + Intergenic
1003265912 6:4564987-4565009 GCAGGTGGCCTCTCTGTTTGAGG - Intergenic
1003324419 6:5081929-5081951 GCTGGTGGGGCTTCTGGGTGGGG + Intergenic
1003613345 6:7632689-7632711 GCTGGAGGCTGGTCTGGGTCTGG - Intergenic
1003882065 6:10488011-10488033 GCCGGCGGCCGCTCCGAGTGCGG + Intergenic
1004069910 6:12288545-12288567 GGTGGAGGCATCTCTGGGTGTGG + Intergenic
1004858283 6:19774061-19774083 GCTGGTGGCAGCTGTGGGCATGG - Intergenic
1005114294 6:22318681-22318703 GCTGGCAGCTGCTCTGAGTGCGG + Intergenic
1005893665 6:30160579-30160601 GCTGGTGTCCACACTGGGTTTGG - Exonic
1006314679 6:33283290-33283312 GCTGGTGGCCAAGCTGGATGTGG + Intronic
1008605296 6:53133849-53133871 GATGGTGGGTGCTCTGGGTATGG + Intronic
1009505051 6:64467778-64467800 GCAGGTGCCAGCTGTGGGTGGGG - Intronic
1010254868 6:73746279-73746301 AGTGGTGGCAGCCCTGGGTGAGG + Intronic
1011685379 6:89819618-89819640 GCAGGTGGCCGCTCGGGGTGAGG - Exonic
1012979787 6:105817419-105817441 GCTGGGAGCCCCTCTGGGCGTGG - Intergenic
1013486827 6:110605268-110605290 GGTGGTTGCCTCTGTGGGTGAGG + Intergenic
1013607310 6:111762214-111762236 GCTGGGGGCCACCCTGGGAGAGG + Intronic
1015252597 6:131142656-131142678 CCTGGTGGAGACTCTGGGTGGGG - Intronic
1017041303 6:150310342-150310364 GCTGGTGGGGGCTGTGAGTGGGG + Intergenic
1017906434 6:158760159-158760181 GGGGGTGGCCCCTCAGGGTGTGG - Intronic
1018899821 6:168045437-168045459 GGAGGTGGCAGCTCTGTGTGAGG - Intergenic
1019154754 6:170031445-170031467 GCTGGTGGCCGCTCCTGGCTGGG + Intergenic
1019210075 6:170397803-170397825 GCTGTTGGCCCCTCTAGGTGAGG + Intronic
1019383153 7:738855-738877 ACAGGTGGCCGTCCTGGGTGGGG + Intronic
1019579325 7:1752277-1752299 CATGGTGGCCCCTCTGGGTGGGG - Intergenic
1019735844 7:2649404-2649426 GCTGTGGGCAGCTCTGGCTGAGG + Intronic
1019762037 7:2820203-2820225 GCTGGTGGCCGCCCGGGGCTGGG + Intronic
1020022740 7:4878797-4878819 GCTGGGGCCGGCTCCGGGTGGGG - Intronic
1020584833 7:10053309-10053331 ACTGGGGGCTGCTCGGGGTGGGG + Intergenic
1024269445 7:47631456-47631478 ACTGAAGGCTGCTCTGGGTGAGG - Intergenic
1024903716 7:54352219-54352241 GGTGGTGGGCACACTGGGTGGGG + Intergenic
1026098359 7:67364800-67364822 CCTGCTGGCCGCTTTGAGTGCGG + Intergenic
1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG + Intronic
1027173292 7:75888016-75888038 GAGGGTGGCAGCTCTGTGTGGGG - Exonic
1027319431 7:77002815-77002837 GCTGGGGGTCGGTCTGGGCGTGG - Intergenic
1029409530 7:100399828-100399850 GCTGGGAGGTGCTCTGGGTGAGG - Exonic
1029809639 7:103034479-103034501 CCGGCTGGCCGCTCTGAGTGCGG + Intronic
1030522195 7:110611707-110611729 GCTGGTGGTTGCTGAGGGTGAGG + Intergenic
1031963016 7:128006661-128006683 CCTGGTGACCACACTGGGTGTGG - Intronic
1032421679 7:131785105-131785127 ATTGGTACCCGCTCTGGGTGAGG + Intergenic
1032436359 7:131904182-131904204 GATGGTGGCTGCCTTGGGTGGGG + Intergenic
1032819313 7:135510057-135510079 GATGGTGGCCCGTCTGGCTGTGG - Exonic
1033275302 7:139967196-139967218 GAAGGTGGCCACTGTGGGTGTGG - Intronic
1034274304 7:149817372-149817394 CCTGCTGGGCGCTCTGTGTGGGG + Intergenic
1034279735 7:149844720-149844742 GCTGGTGGCACCACTGGGTATGG + Exonic
1034757934 7:153640511-153640533 GCAGGTGGAAGCTCTGGCTGTGG + Intergenic
1035271365 7:157722031-157722053 GTTGGTGGCTGCTCCGGGGGTGG - Intronic
1035272686 7:157729781-157729803 GCAGGTGGCCCTTATGGGTGTGG - Intronic
1035413294 7:158663447-158663469 GCTGGTGGCCCATCACGGTGTGG + Intronic
1035741249 8:1930057-1930079 GCTTGTGGGAGCTCTGGGTACGG + Intronic
1035761240 8:2070357-2070379 GCTGCTGGCCGCTGTGGGCGTGG + Intronic
1036573370 8:10001664-10001686 GGTGCAGGCAGCTCTGGGTGTGG + Intergenic
1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1037904081 8:22705153-22705175 GCCTGTGGCCGCTCTGGGCTCGG + Intergenic
1037906638 8:22719384-22719406 GCTTGTGACACCTCTGGGTGAGG + Intronic
1037987287 8:23297927-23297949 GGTGGGGGCCGGGCTGGGTGAGG + Exonic
1038346909 8:26741282-26741304 GGTGGTGGCTCCTCTGGGAGGGG + Intergenic
1039517177 8:38143936-38143958 GCTAGTGGCTGATATGGGTGTGG - Exonic
1040791008 8:51230741-51230763 GCTGCTGGCCGCTCCAAGTGCGG - Intergenic
1043472620 8:80578110-80578132 ACTGAGGGCTGCTCTGGGTGAGG + Intergenic
1046103921 8:109644761-109644783 GCGGGCGGCGGCTCTTGGTGAGG + Intronic
1047405285 8:124580507-124580529 TCTGGTGGCTGCTCACGGTGTGG - Intronic
1047700592 8:127445672-127445694 GCTGGTGGCTGCACAGGCTGGGG - Intergenic
1048467821 8:134682127-134682149 GCTGGTGCCAGCTCATGGTGAGG - Intronic
1049148535 8:141019669-141019691 GCTGGGGGAGGTTCTGGGTGGGG - Intergenic
1049234561 8:141506043-141506065 GCTGGGGCCCACTCTGGGAGTGG + Intergenic
1049509620 8:143020963-143020985 GCTGGCTGCCCTTCTGGGTGTGG + Exonic
1049639343 8:143707603-143707625 GCTGGTGGCCGGGCCGGGGGCGG - Intronic
1049799153 8:144509765-144509787 GCTGGGGGCCGCGCTAGCTGGGG + Exonic
1049838245 8:144754186-144754208 GAACGTGGCCTCTCTGGGTGAGG - Exonic
1050437762 9:5628593-5628615 GCTGCCGGCCGCTGTGGCTGTGG - Intergenic
1050802383 9:9631615-9631637 GCTTGTGTCTGCGCTGGGTGAGG - Intronic
1053122148 9:35555452-35555474 GCTGTGGGCTGCTCTGGGGGAGG - Exonic
1053131898 9:35620047-35620069 GCTGGTGGCAGGGGTGGGTGGGG + Intronic
1053662384 9:40292772-40292794 GGTGGTGGTCACTCAGGGTGTGG - Intronic
1053912836 9:42922937-42922959 GGTGGTGGTCACTCGGGGTGTGG - Intergenic
1054374513 9:64439001-64439023 GGTGGTGGTCACTCGGGGTGTGG - Intergenic
1054522226 9:66083512-66083534 GGTGGTGGTCACTCAGGGTGTGG + Intergenic
1056773766 9:89497583-89497605 GCAGGTGGCTCCTCTGGGCGCGG - Intronic
1057979956 9:99650569-99650591 GCTGGTGGCTGCTCAAGGTGGGG - Intergenic
1061178184 9:129009632-129009654 GCTGGAACCCACTCTGGGTGCGG - Intronic
1061280162 9:129593417-129593439 GCTGGTAGCTGTACTGGGTGAGG + Intergenic
1061481074 9:130898003-130898025 GCAGGAAGCCGCTCTGGGGGTGG + Intergenic
1062123785 9:134848639-134848661 GGTGGTGTCCGCACTGGGAGCGG - Intergenic
1062339845 9:136089187-136089209 GCAGGGGGAGGCTCTGGGTGGGG - Intronic
1062683786 9:137799470-137799492 GCAGGTGGCCCCTGTGTGTGAGG - Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185960360 X:4541666-4541688 GCTGGTGGCTGAGCTTGGTGAGG + Intergenic
1186784416 X:12944366-12944388 GCTGGTGGCTGAGCTTGGTGAGG - Intergenic
1186846981 X:13540523-13540545 GCTGATGGCGGGTCTGGCTGAGG + Intergenic
1189133688 X:38527126-38527148 ACTGGTTGCCTCTGTGGGTGGGG + Intronic
1192240632 X:69324964-69324986 GCTGGTGGCAGCTGTGCCTGAGG - Intergenic
1193449464 X:81647566-81647588 GGTCGTGGCCACTCTGGGTGGGG + Intergenic
1193907959 X:87265269-87265291 ACTGGTGGCGAGTCTGGGTGGGG + Intergenic
1198983382 X:142424530-142424552 GTTGGTGGCTGAGCTGGGTGAGG + Intergenic
1199000684 X:142632772-142632794 AGTGGTGGCCACTCAGGGTGAGG + Intergenic
1199847618 X:151702437-151702459 GCTGGTGGCCTCACTGGGGTAGG - Exonic