ID: 900978214

View in Genome Browser
Species Human (GRCh38)
Location 1:6030824-6030846
Sequence ATGTGTAAGTATATGTGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1665
Summary {0: 1, 1: 2, 2: 27, 3: 224, 4: 1411}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900978214 Original CRISPR ATGTGTAAGTATATGTGTGT AGG Intronic
900593648 1:3470808-3470830 ATGTGCATGGATGTGTGTGTGGG + Intronic
900690013 1:3974895-3974917 ATGTATGAGCATATGTGTGGTGG - Intergenic
900764695 1:4496438-4496460 ATGAGTGTGTATATGTGTGAGGG - Intergenic
900833477 1:4981829-4981851 GTGTGTAAGTGTGTGTGTGGGGG - Intergenic
900978211 1:6030692-6030714 ATGTGTGTGTGTATGTGTGTAGG + Intronic
900978212 1:6030774-6030796 ATATGTGTGTGTATGTGTGTAGG + Intronic
900978214 1:6030824-6030846 ATGTGTAAGTATATGTGTGTAGG + Intronic
900978215 1:6030848-6030870 ATGTGTGTGTATGTATGTGTAGG + Intronic
900994953 1:6116259-6116281 GTGTGTATATATATGTTTGTTGG + Intronic
901233538 1:7654730-7654752 ATGTGTGTGTATAGGTGTGTGGG - Intronic
901233639 1:7655613-7655635 AGGTGTGTGTATAGGTGTGTGGG - Intronic
901312067 1:8277044-8277066 GTGTGTATGTGTATATGTGTTGG - Intergenic
901465231 1:9417069-9417091 ATGAGCATGCATATGTGTGTGGG - Intergenic
901474163 1:9477732-9477754 ATGTGTGTGTATATGTGTGTGGG - Intergenic
902463599 1:16599498-16599520 GTGTGTGTGTGTATGTGTGTGGG - Intronic
902625781 1:17675485-17675507 GTGTGTGTGTATAGGTGTGTGGG + Intronic
903247058 1:22023982-22024004 ATGTGAAAGTATATACGTTTCGG - Intergenic
903265146 1:22153729-22153751 ATGTGTGTGTGAATGTGTGTTGG + Intergenic
903275939 1:22221902-22221924 CTGTGTGAGAATATGTGTGCAGG - Intergenic
903345034 1:22678454-22678476 ATGTGTGTGTGTATGTGTGTGGG - Intergenic
903345040 1:22678501-22678523 ATGTGTGTGCATGTGTGTGTGGG - Intergenic
903668080 1:25020042-25020064 ATGTGTGTGCATGTGTGTGTGGG - Intergenic
903847957 1:26289695-26289717 ATGTGTAAGTATCACTGTGGGGG + Intronic
904041778 1:27589694-27589716 GTGTGTCTGTATCTGTGTGTTGG + Intronic
904094861 1:27968731-27968753 GAGAGTAAGTATTTGTGTGTTGG + Intergenic
904272687 1:29360964-29360986 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
904383507 1:30126953-30126975 ATTTGCAAGTAACTGTGTGTGGG - Intergenic
904813174 1:33177022-33177044 GTGTGCATGTGTATGTGTGTTGG - Intronic
904935848 1:34129010-34129032 ATGTATATGTGTGTGTGTGTGGG - Intronic
905246103 1:36614948-36614970 GTGTGTGTGTATATGTATGTAGG + Intergenic
905303101 1:36999002-36999024 GTGTGTATGTGTGTGTGTGTTGG + Intronic
905591153 1:39165088-39165110 ATGTGTAGGACTTTGTGTGTAGG + Intronic
905874024 1:41420880-41420902 ATATGTTTGTATATATGTGTGGG + Intergenic
905874758 1:41425631-41425653 GTGTATACGTGTATGTGTGTAGG + Intergenic
905874760 1:41425836-41425858 ATGTCTGTGTATATGTGTGTAGG + Intergenic
905874764 1:41425872-41425894 ATGTGTGCGTATGTGGGTGTGGG + Intergenic
905893208 1:41529779-41529801 ATGTGTATGTATGAGTGTGTGGG - Intronic
906006154 1:42472933-42472955 ATGTGTATGTATATATATCTTGG - Intronic
906457961 1:46013847-46013869 GTGTGTGTGTATATGTGTGTTGG + Intronic
907035906 1:51216015-51216037 GTGTGTATGTGTGTGTGTGTTGG - Intergenic
907177729 1:52540573-52540595 ATGTGTAAGGATAAGTGAATGGG - Intronic
907640834 1:56188692-56188714 ATGTGTAAGCATGTGTGTGTGGG - Intergenic
908433492 1:64081803-64081825 GTGTGTTTGTGTATGTGTGTGGG - Intronic
908512544 1:64860962-64860984 GTGTGTATGTGTGTGTGTGTTGG + Intronic
908517139 1:64904732-64904754 GTGTGTGTATATATGTGTGTGGG - Intronic
908591234 1:65637357-65637379 ATGTGTGTGTGTGTGTGTGTTGG - Exonic
908983501 1:69987304-69987326 ATGTGTAAGCTTTTTTGTGTAGG + Intronic
909106474 1:71415902-71415924 GTGTGTATGTGGATGTGTGTGGG + Intronic
909590952 1:77348756-77348778 ATGTGTTTGTGTGTGTGTGTGGG - Intronic
909910481 1:81251607-81251629 GTGTGTATGTATGTGTGTGAGGG + Intergenic
909975499 1:82041999-82042021 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
910033230 1:82757799-82757821 ATGTGTATATATATATGTGTGGG + Intergenic
910316823 1:85895134-85895156 ATGTGTAAGTATGCATGTGTGGG + Intronic
910342614 1:86204922-86204944 GTGTGTAAGCATATGTGTGTGGG - Intergenic
910481064 1:87659041-87659063 ATGTGTGTGTGTGTGTGTGTTGG + Intergenic
910631963 1:89364637-89364659 GTGTGTGTGTATGTGTGTGTGGG + Intronic
910937245 1:92494413-92494435 ATGTGTACGTGTGTGTGTGTAGG - Intergenic
910947213 1:92607121-92607143 ATGTGTATGTACCAGTGTGTTGG - Intronic
911139464 1:94483310-94483332 GTGTGTGTGTGTATGTGTGTCGG - Intronic
911164607 1:94713531-94713553 GTGTGTGTGTATATGTGTGCAGG - Intergenic
911286746 1:96003726-96003748 ATGTGTAGGTAAATGAGTTTGGG - Intergenic
911526697 1:98996279-98996301 ATGTGTATGTATGTGTGGGTGGG - Intronic
911618102 1:100037302-100037324 ATGTGTATGTATATGTAGGTGGG - Intergenic
911875336 1:103155192-103155214 GTGTGTATATATATGTGTGTGGG + Intergenic
911902608 1:103525139-103525161 GTGTGTATGTGTGTGTGTGTAGG - Intergenic
912017238 1:105056021-105056043 ATCTGTGTGTCTATGTGTGTGGG - Intergenic
912197095 1:107410891-107410913 ATGTGCAAATACATTTGTGTGGG + Intronic
912201776 1:107465939-107465961 GTGTGTGTGCATATGTGTGTGGG + Intronic
912557398 1:110525999-110526021 ATGTCTCTGTGTATGTGTGTGGG - Intergenic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
913100478 1:115559544-115559566 ATGTGTGTATGTATGTGTGTTGG - Intergenic
913131746 1:115844257-115844279 CTGTGTGAGTATATCTGTGTAGG - Intergenic
913235477 1:116777482-116777504 ATGGGGAAGGCTATGTGTGTTGG + Intergenic
913320338 1:117583421-117583443 GTGTATATGTATATGTTTGTGGG + Intergenic
913374479 1:118135411-118135433 ATGTGTGTGTGTGTGTGTGTGGG + Intronic
913448361 1:118973763-118973785 GTGTGTGTGTGTATGTGTGTAGG - Intronic
913690127 1:121271736-121271758 ATGTGTGTGTGCATGTGTGTTGG + Intronic
913992075 1:143623176-143623198 ATGTGTGAGTGTGTGTGGGTGGG + Intergenic
914147413 1:145008227-145008249 ATGTGTGTGTGCATGTGTGTTGG - Intronic
915012046 1:152696672-152696694 ATGTGTGTGTATGTGTGTGTGGG - Intergenic
915338466 1:155162415-155162437 ATGTGTATGTCTGTGTGTGAGGG - Intergenic
915710287 1:157891103-157891125 GTGTGTATGTGTGTGTGTGTAGG - Intronic
915943544 1:160134276-160134298 GTGTGTATGTGTGTGTGTGTGGG - Intronic
916383343 1:164238120-164238142 GTGTGTGTATATATGTGTGTGGG - Intergenic
916480362 1:165209035-165209057 GTGTGTATGTGTCTGTGTGTAGG + Intronic
916510252 1:165466915-165466937 GTGTGTATGTATATGGGGGTGGG - Intergenic
917374982 1:174342028-174342050 ATGTGTAAGTATATTTTCCTAGG + Intronic
917486638 1:175460898-175460920 ATGAGCATGTACATGTGTGTGGG - Intronic
917730830 1:177872918-177872940 ATTTATAAGTATATGTATTTGGG - Intergenic
917757168 1:178113474-178113496 TTGTGTATGTGTATGTGTGTGGG + Intronic
918391661 1:184070244-184070266 GTGTGTTTGTATGTGTGTGTTGG - Intronic
918664887 1:187138602-187138624 GTGTGTATGTATGTGTGTTTTGG + Intergenic
918666737 1:187160839-187160861 ATGGATAAGTATGTGTGTGTGGG + Intergenic
918864715 1:189880847-189880869 ATATGTAGGTATGTGTGTATAGG + Intergenic
918864717 1:189880900-189880922 ATATGTAGGTATGTGTGTATAGG + Intergenic
918927173 1:190803168-190803190 AATTGTAAATATATGTGTGTAGG - Intergenic
919074372 1:192796098-192796120 GTTTGTGAGTATATGTGTTTTGG - Intergenic
919423467 1:197400975-197400997 GTGTATATGTATGTGTGTGTTGG - Intronic
919629953 1:199950799-199950821 ATATGTATATATATGTGTGTGGG + Intergenic
919638628 1:200028650-200028672 ATCTGTAATTATTTGTCTGTTGG + Intronic
919928420 1:202205612-202205634 AGGTGTATGTGTATGTGTGAAGG - Intronic
919985821 1:202674032-202674054 ATGTGTGAGTATTCTTGTGTGGG + Intronic
920302085 1:204995342-204995364 GTGTGTGTGTGTATGTGTGTCGG + Intronic
920477449 1:206290217-206290239 ATGTGTGTGTGCATGTGTGTTGG + Intronic
920498619 1:206472560-206472582 GTGTGTGTGTGTATGTGTGTAGG - Intronic
920868186 1:209770501-209770523 ATGTGAAAGTATGTGTGTGCAGG + Intronic
920868261 1:209771225-209771247 ATGTGAAGGTATGTGTGTGCAGG + Intronic
920868335 1:209771991-209772013 AGGTGGAAGTGTATGTGTGCAGG + Intronic
921327905 1:214005964-214005986 ATGTGTCTGTGTCTGTGTGTGGG + Intronic
921794271 1:219324707-219324729 GTGTGTGTGTATGTGTGTGTTGG + Intergenic
922018842 1:221683318-221683340 ATGTGTACATATATATTTGTAGG - Intergenic
922127055 1:222738026-222738048 ATGTGTGAGTATGTGTGTGTTGG + Intronic
922604782 1:226883033-226883055 ATCTGTAAGAATTTGTGTTTTGG - Intronic
922997028 1:229972351-229972373 TTGTGTATGTATGGGTGTGTAGG - Intergenic
923540291 1:234883935-234883957 ATGTGTATGTGTGTGTGTGTTGG - Intergenic
923906070 1:238386314-238386336 ATGTGTACATATATGTGTGTGGG + Intergenic
924084491 1:240436770-240436792 ATGTGTAAGTGTATATGTTAGGG + Intronic
924187762 1:241513974-241513996 ATATGTGTGTATATGTATGTGGG - Intronic
924211435 1:241771875-241771897 GTATATATGTATATGTGTGTGGG - Intronic
924370972 1:243349206-243349228 ATGTGTCTGTATATGTGAGTGGG - Intronic
924583015 1:245337562-245337584 GTGTATGAGTATATGTGTTTTGG + Intronic
924598041 1:245464375-245464397 GTGTGTAGGTGTGTGTGTGTGGG + Intronic
924637060 1:245798423-245798445 ATGTGTGTGTATGTGTGTGGGGG - Intronic
924748982 1:246867900-246867922 ATGTGTGTGTGTGTGTGTGTGGG - Intronic
924857048 1:247884116-247884138 CTGTGTATGTCTTTGTGTGTTGG - Intergenic
924927613 1:248698310-248698332 ATGTGAAAGAATATGTCTGAAGG + Intergenic
1062977631 10:1697198-1697220 ATGTGTGTGTTTAGGTGTGTGGG - Intronic
1063257242 10:4341749-4341771 GTGTGTGAGTATGTGTGTATGGG - Intergenic
1063257245 10:4341802-4341824 ATGTGTACATGCATGTGTGTGGG - Intergenic
1063331179 10:5161049-5161071 GTGTGTATATATATGTGTGTGGG + Intergenic
1063557948 10:7098249-7098271 GTGTGAATGTATATGAGTGTGGG - Intergenic
1063760787 10:9072993-9073015 ATGTGTTTATTTATGTGTGTTGG + Intergenic
1064040847 10:11962179-11962201 ATGTGTGAGTGTGCGTGTGTGGG - Intronic
1064488292 10:15820494-15820516 ATGTGTGTGTATATGTGTTAGGG + Intronic
1064806054 10:19134533-19134555 ATGTGTAAGTTTATTTATGCTGG + Intronic
1064862072 10:19837436-19837458 GTGTGTGTGTATGTGTGTGTTGG + Intronic
1065152282 10:22834278-22834300 ATGTGTGTGTGTTTGTGTGTGGG - Intergenic
1065196920 10:23275576-23275598 GTGTGTGTGTATGTGTGTGTAGG - Intronic
1065315202 10:24457354-24457376 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1065400263 10:25292075-25292097 ACATGTATGTATATGTGTGTGGG - Intronic
1065706171 10:28473375-28473397 CTTTTTATGTATATGTGTGTTGG - Intergenic
1065990864 10:31008739-31008761 ATGTATAAGTTTTTGTATGTAGG + Intronic
1066412489 10:35187249-35187271 ATATATAATTATATGTATGTTGG + Intronic
1066471686 10:35703973-35703995 ATGTGTGTGCGTATGTGTGTTGG - Intergenic
1066494018 10:35923635-35923657 GTGTGTATGTATGCGTGTGTAGG + Intergenic
1066496743 10:35949431-35949453 GTGTGTGTGTATGTGTGTGTGGG - Intergenic
1066517045 10:36174132-36174154 ATTTATATGTATATGTGTATGGG - Intergenic
1066550545 10:36551947-36551969 CTTTGTAAGTCTGTGTGTGTGGG - Intergenic
1066586142 10:36938524-36938546 ATTTGTTAGTAAATGTGTTTTGG + Intergenic
1067053704 10:43039521-43039543 ATGTGTGTGTATGTGTGCGTGGG - Intergenic
1067267489 10:44757968-44757990 ATGTGTGTGTATGTGTGTGTGGG + Intergenic
1067682975 10:48451806-48451828 GTGTGTAATTTTATGTGTGTGGG - Intronic
1068048273 10:51915547-51915569 ATGTGTGTGTGTGTGTGTGTTGG + Intronic
1068137955 10:52969583-52969605 ATGTGTGAGGATATGGGGGTGGG - Intergenic
1068141525 10:53014543-53014565 ATGTATATGTGTGTGTGTGTCGG + Intergenic
1068395316 10:56453955-56453977 ATGTGTGTGTGTATGTGTGTGGG - Intergenic
1068396082 10:56464131-56464153 TTGTGTATGTATATATGCGTGGG + Intergenic
1068857274 10:61810511-61810533 ATGTGTCTATATGTGTGTGTGGG - Intergenic
1069058936 10:63873178-63873200 GTGTGTAATTATATGACTGTGGG + Intergenic
1069165086 10:65145789-65145811 GTGTATATGTTTATGTGTGTAGG - Intergenic
1069781704 10:70960821-70960843 ATGTATAAGTGTGTGTGTGAAGG + Intergenic
1069795616 10:71049966-71049988 GTGTATAAGAGTATGTGTGTGGG - Intergenic
1069844376 10:71360714-71360736 ATGTGCAAGGATTTATGTGTAGG + Intronic
1070012813 10:72493212-72493234 TTGTGTGTGTATGTGTGTGTGGG - Intronic
1070200602 10:74201588-74201610 ATGTGTAGGTATGTATGTGTAGG + Intronic
1070269748 10:74941602-74941624 ATGTGTGTGTGTTTGTGTGTTGG - Intronic
1070295429 10:75157057-75157079 GTATGTGTGTATATGTGTGTAGG + Intronic
1070342273 10:75508781-75508803 ATATGCAAATATATTTGTGTGGG - Intronic
1070361330 10:75692384-75692406 ATGTGTGTGTATATATATGTAGG - Intronic
1070547238 10:77462562-77462584 GTGTGTAAGTGCATGTGTGAGGG - Intronic
1070620630 10:78007586-78007608 TTCTGTATGTATATGTGTGGTGG + Intronic
1070677029 10:78419002-78419024 ATGTGTATAGATAGGTGTGTGGG - Intergenic
1070713689 10:78702201-78702223 ATGGGTAAGTATGTGTTTGTGGG - Intergenic
1070823568 10:79377312-79377334 ATGTGTGTGCACATGTGTGTGGG + Intergenic
1070882577 10:79862418-79862440 ATGTGTGTGTGTGTGTGTGTTGG + Intergenic
1071058177 10:81535366-81535388 ATGTGTGTGTGTATGTGTGTGGG + Intergenic
1071082383 10:81827698-81827720 ATGTGTGTGTGTGTGTGTGTAGG + Intergenic
1071314360 10:84379170-84379192 ATTTGTATGTATATTCGTGTTGG + Intronic
1071319001 10:84433424-84433446 GTGTGTGTGTGTATGTGTGTGGG - Intronic
1071332964 10:84579082-84579104 ATGTGTATATATATGAGGGTAGG + Intergenic
1071367801 10:84917698-84917720 ATGTGTGTGTGTGTGTGTGTGGG - Intergenic
1071496469 10:86170666-86170688 GTGTGTGTGTGTATGTGTGTGGG - Intronic
1071701050 10:87936681-87936703 GTATGTATGCATATGTGTGTGGG - Intronic
1071981249 10:91006084-91006106 ATGTGTGAGTGTATGTGTATTGG - Intergenic
1072027277 10:91473424-91473446 AAGTTTAAGTATACGTCTGTTGG - Intronic
1072502800 10:96035264-96035286 ATGTGCATGTGTGTGTGTGTTGG - Intergenic
1072785974 10:98282546-98282568 CTGTGTGTGTACATGTGTGTTGG + Intergenic
1073066793 10:100765400-100765422 CTCTGTAAGTATTTGGGTGTGGG - Intronic
1073115848 10:101091233-101091255 ATGTGTGTGGATGTGTGTGTGGG + Intronic
1073247844 10:102104317-102104339 ATGTTTACGTATGTGTCTGTTGG - Intergenic
1073247946 10:102104992-102105014 ATGTTTATGTATGTGTCTGTTGG - Intergenic
1073493554 10:103871611-103871633 TTGTGTATGTGTATGTTTGTAGG - Intergenic
1073588547 10:104734084-104734106 GTGTGTGAGTAGATGTATGTTGG + Intronic
1073714980 10:106094539-106094561 ATATGTATGTATGTGTGTGTAGG + Intergenic
1074372705 10:112913269-112913291 GTGTGTAGGTGTGTGTGTGTAGG + Intergenic
1074833756 10:117269194-117269216 GTGTGTATGTGTATGTGTGTAGG - Intronic
1074844251 10:117383127-117383149 GTGTGTGTGTACATGTGTGTTGG + Intergenic
1074869083 10:117562966-117562988 ATGTGTATGCATATGTGTACAGG + Intergenic
1074887604 10:117706312-117706334 ATGTGTGGTTATATGTGTATGGG - Intergenic
1075211795 10:120497437-120497459 AAGTGTGTGTTTATGTGTGTGGG + Intronic
1075241521 10:120783349-120783371 GTGTGTATGTGTGTGTGTGTTGG + Intergenic
1075283230 10:121159418-121159440 ATGTGTGTGTATGTGTGTGTGGG + Intergenic
1075311053 10:121413780-121413802 GTGTGTATGTGTGTGTGTGTGGG + Intergenic
1075312260 10:121424333-121424355 ATGTGTGTGTATGTGTGTGCAGG - Intergenic
1075483019 10:122798451-122798473 GTGTGTGTGTATATGTGTGTGGG - Intergenic
1075627080 10:123971126-123971148 GTGTGTATGTGTTTGTGTGTGGG - Intergenic
1075650475 10:124125153-124125175 ATGTGTGAGTGTGTGTGTGTTGG - Intergenic
1075650489 10:124125233-124125255 ATGTCTCAGTGTGTGTGTGTTGG - Intergenic
1075650510 10:124125472-124125494 GTGTGTTGGTATGTGTGTGTGGG - Intergenic
1075678360 10:124313558-124313580 ATGTGTGTGTGTGTGTGTGTAGG - Intergenic
1075868870 10:125752983-125753005 ACGTGTGTGTGTATGTGTGTGGG + Intronic
1076078483 10:127556601-127556623 GTGTGTATATATATATGTGTGGG + Intergenic
1076194099 10:128502965-128502987 ATGTGTGGGTATGTCTGTGTGGG - Intergenic
1076359893 10:129880322-129880344 ATGTGTGTGTATGTATGTGTGGG - Intronic
1076578236 10:131487104-131487126 ATGTGTATATTTGTGTGTGTTGG + Intergenic
1076726312 10:132415592-132415614 GTGTGTGAGTAAATGTGAGTGGG - Intronic
1076755109 10:132565783-132565805 GCGTGTGAGTATGTGTGTGTGGG + Intronic
1076778873 10:132713186-132713208 ATGTGCACATGTATGTGTGTAGG + Intronic
1077167057 11:1147745-1147767 ATGTGTATGCAGGTGTGTGTGGG + Intergenic
1077314920 11:1914958-1914980 ATGTTTGTGTATGTGTGTGTTGG + Intergenic
1077418019 11:2434595-2434617 AAGTGTATGTGTGTGTGTGTAGG + Intergenic
1077914400 11:6601819-6601841 ATGTGTATATGTGTGTGTGTTGG - Intronic
1078001510 11:7500424-7500446 ACGTGTATGTATGTGTGTGGCGG - Intronic
1078355069 11:10626950-10626972 ATGTGTATGTCTGTGTGTGGAGG + Intronic
1078488922 11:11751264-11751286 ATGTGTGCCTGTATGTGTGTGGG - Intergenic
1078738055 11:14039420-14039442 GTGTGTGTGTATGTGTGTGTAGG + Intronic
1078930325 11:15907444-15907466 GTGTGTATGTGTGTGTGTGTAGG - Intergenic
1079286007 11:19133370-19133392 GTGTGTATATATATGTGTGTGGG - Intronic
1079378022 11:19911423-19911445 TTGAGTGTGTATATGTGTGTAGG + Intronic
1079383113 11:19956355-19956377 GTGTGTGTGTGTATGTGTGTCGG - Intronic
1079567956 11:21906041-21906063 ATGTGTATGTGTATTTATGTGGG - Intergenic
1079596561 11:22256837-22256859 ATCTGTATGCATATTTGTGTGGG - Intronic
1079920201 11:26424252-26424274 ATGTGTATGTGTGTGTGTGTGGG - Intronic
1079941978 11:26692340-26692362 AAGTGTAAGAATCTATGTGTGGG + Intronic
1081351161 11:42054079-42054101 ATGTGTGCGTGCATGTGTGTTGG - Intergenic
1081408482 11:42726314-42726336 GTGTGTATGTGTATGTGTGCTGG - Intergenic
1081628783 11:44673142-44673164 CTGTGTAAATATACATGTGTGGG - Intergenic
1081681027 11:45002890-45002912 ATATGTATGTATATATGTATGGG + Intergenic
1081706944 11:45187824-45187846 GTGTGTGTGTATGTGTGTGTTGG + Intronic
1081748054 11:45486828-45486850 AAATGTGTGTATATGTGTGTTGG - Intergenic
1081994927 11:47357984-47358006 ATGTGTGAGCAGGTGTGTGTGGG - Intronic
1082280331 11:50265024-50265046 ATGTATATGTGTGTGTGTGTGGG + Intergenic
1082557574 11:54581219-54581241 ATGGGAAAATATATGTGTATAGG - Intergenic
1083055512 11:59815374-59815396 ATGTGTATATGTATGTGTGCAGG - Intergenic
1083256229 11:61497191-61497213 GTGTGTGGGTATATGAGTGTGGG + Intergenic
1083256231 11:61497229-61497251 GTGTGTAAGTGTATATGTGTGGG + Intergenic
1083256240 11:61497512-61497534 GAGTGTGAGTGTATGTGTGTGGG + Intergenic
1083256252 11:61497806-61497828 ATGTGTGAGTGTATGTGTGTGGG + Intergenic
1083640698 11:64143741-64143763 GTGTGTGTGTATGTGTGTGTCGG - Intronic
1083676965 11:64331708-64331730 ATGTGTGAATGTGTGTGTGTAGG + Intergenic
1083679979 11:64347092-64347114 ATGAATAAGTAAAAGTGTGTTGG - Intronic
1083686567 11:64379693-64379715 GTGTGTAAGCACAAGTGTGTGGG + Intergenic
1083719493 11:64597418-64597440 AGGTCTAAGGAGATGTGTGTGGG - Intronic
1083738730 11:64696512-64696534 GTGTGTATGTATGTATGTGTGGG - Intronic
1084580319 11:70019242-70019264 ATGTGTGTGTGTGTGTGTGTGGG - Intergenic
1085000621 11:73030192-73030214 ATGTATATGTATGCGTGTGTGGG + Intronic
1085137368 11:74104500-74104522 ATGTGTATGTACATGTATGGGGG + Intronic
1085379773 11:76104677-76104699 GTGTGCATGTATATGTGTGGTGG - Intronic
1085657805 11:78332508-78332530 TTGAGTCAGGATATGTGTGTAGG - Intronic
1085728444 11:78975597-78975619 ATGTGTGTGTGTGTGTGTGTGGG - Intronic
1085825669 11:79844510-79844532 GTGTGTAAGTGTGTGTGTGATGG - Intergenic
1085829215 11:79881934-79881956 ATGTGTGTGTATGTGTGTGTGGG + Intergenic
1085976745 11:81664433-81664455 GTGTGTATGTGTGTGTGTGTAGG - Intergenic
1086164336 11:83760384-83760406 ATGAGAAAGAATATGTGTTTAGG - Intronic
1086818963 11:91411227-91411249 ATGTGTGTGTATATATGTATAGG - Intergenic
1086914062 11:92507457-92507479 ATATGTATATATATGTGTGGGGG + Intronic
1087232032 11:95676655-95676677 ATTTGTAATTATATGTCTGTTGG - Intergenic
1087291795 11:96328141-96328163 ATGTGTGTATATATGTGTGATGG + Intronic
1087390722 11:97529284-97529306 GTGTGTGTATATATGTGTGTGGG + Intergenic
1087543784 11:99556597-99556619 ATATGTATGTATATATGTGTGGG - Intronic
1088021113 11:105120674-105120696 AAGTGTGTGTATGTGTGTGTTGG - Intergenic
1088181386 11:107116650-107116672 TTGTGTATGTGTGTGTGTGTGGG + Intergenic
1088632883 11:111791171-111791193 ATATGTAAGCATTTGTGTGCTGG + Intronic
1088751650 11:112847164-112847186 GTGTGTATGTGTGTGTGTGTTGG + Intergenic
1089016607 11:115170573-115170595 ATGTGTAATGATGTGAGTGTTGG + Exonic
1089110157 11:116049192-116049214 ATGTGTAAGTGTATGTTTGTAGG - Intergenic
1089217709 11:116845375-116845397 TTGTGAAAGTATATTTGAGTTGG - Intronic
1089615471 11:119692411-119692433 ATGTGTGTGTGTGTGTGTGTGGG + Intronic
1089943254 11:122441124-122441146 ATGTGTATGTATATATTTTTTGG - Intergenic
1090257265 11:125293760-125293782 CTGTGTCAGTATGTGAGTGTGGG - Intronic
1090272356 11:125396958-125396980 ATGTTAAAATATATGGGTGTAGG + Intronic
1090298365 11:125610747-125610769 GTGTGTATGTGTGTGTGTGTGGG - Intronic
1090438438 11:126706472-126706494 ATGTATAAATATATGTCTCTAGG + Intronic
1090585557 11:128208166-128208188 GTGTGTATGTATGTGTGTGTTGG - Intergenic
1091032227 11:132200891-132200913 ATATGTAAGTATGTATGTATAGG - Intronic
1091061716 11:132469668-132469690 ATGTGTGTGTATATGTGTGGGGG + Intronic
1091061740 11:132469843-132469865 ATGTGTGTGTATGTATGTGTGGG + Intronic
1091150732 11:133326303-133326325 GTGGGTATGTATAAGTGTGTGGG + Intronic
1091150759 11:133326441-133326463 ATGTGTGTGTATGTGTGTGTGGG + Intronic
1091170806 11:133518315-133518337 GTGTATAAGTGTGTGTGTGTGGG + Intronic
1091196925 11:133739142-133739164 GTGTGTGGGTATATGTGTGTGGG + Intergenic
1091196978 11:133739375-133739397 GTGTGTTTGTGTATGTGTGTGGG + Intergenic
1091492028 12:941030-941052 ATCTGTAAATTTATGTCTGTCGG - Intronic
1091930337 12:4390772-4390794 ATGTCTAAGAATTTGTGTCTTGG + Intergenic
1092630016 12:10366934-10366956 ATGTGTAAATATTTGTCTTTTGG - Intergenic
1092922074 12:13241279-13241301 ATGTATATATATGTGTGTGTGGG - Intergenic
1092942932 12:13427504-13427526 ATGTGTATGTGTGTATGTGTGGG + Intergenic
1092976927 12:13754343-13754365 ATGTGTGTGTATGTCTGTGTGGG - Intronic
1093217082 12:16375999-16376021 GTGTGTACATATAGGTGTGTGGG - Intronic
1093371532 12:18372195-18372217 ATGTGTGTGTGTGTGTGTGTGGG + Intronic
1093779222 12:23114549-23114571 TTGTGTGTGTATGTGTGTGTGGG - Intergenic
1093837200 12:23847904-23847926 ATGTGTTTGTATATTTATGTAGG - Intronic
1095211815 12:39503071-39503093 ATGTGTGTGTATGTGTGTGGTGG - Intergenic
1095608111 12:44094783-44094805 ATGTGTTAGTGTGTGTGTGGGGG + Intronic
1095656385 12:44674322-44674344 ATTTGTGTGTGTATGTGTGTGGG - Intronic
1096096137 12:48937022-48937044 GTGTGTGTGTATATGGGTGTGGG - Exonic
1096197974 12:49661088-49661110 AGGTGTAAGTCTAAATGTGTTGG + Intronic
1096227821 12:49877826-49877848 CTATGTGCGTATATGTGTGTAGG + Intronic
1096558094 12:52416270-52416292 ATGTGTATGCATGTGTGTGTGGG + Intergenic
1096605105 12:52759434-52759456 GTGTGTGTGTCTATGTGTGTGGG + Intergenic
1096750183 12:53753704-53753726 ATGTGTGTGTGTCTGTGTGTTGG + Intergenic
1096849936 12:54428915-54428937 CTGTGTATATATGTGTGTGTTGG - Intergenic
1096942147 12:55358603-55358625 ATTTTTAAGTTTATTTGTGTAGG - Intergenic
1097296526 12:57970850-57970872 GTGTGTATATATATATGTGTAGG + Intergenic
1097317756 12:58190468-58190490 ATATATAAGTATTTTTGTGTGGG - Intergenic
1097448479 12:59706376-59706398 GTGTGTGTGTTTATGTGTGTTGG + Intronic
1097715026 12:62956581-62956603 ATGTGTCAGTATATGTAATTGGG + Intergenic
1097782097 12:63719641-63719663 ATCTTTAAGTAAATGTGTGGAGG + Intergenic
1097954906 12:65474366-65474388 ATGTGTGTGTATATATGTATAGG - Intronic
1097972906 12:65653653-65653675 TTGTGTATGTGTGTGTGTGTTGG - Intergenic
1098463655 12:70762282-70762304 GTGTGTGTGTATGTGTGTGTAGG - Intronic
1098467046 12:70799214-70799236 AAGTCTATGTCTATGTGTGTTGG + Intronic
1098484296 12:71003051-71003073 GTGTGTGTGTGTATGTGTGTGGG - Intergenic
1098859931 12:75697266-75697288 ATGTGTATGTGTGTGTGTGTAGG - Intergenic
1099049644 12:77767522-77767544 ATGTGTGAGTAGGTGAGTGTGGG + Intergenic
1099607049 12:84816763-84816785 ATTTTTATGTATGTGTGTGTGGG - Intergenic
1099787099 12:87279438-87279460 AGGTTTAAGTGGATGTGTGTGGG - Intergenic
1099810374 12:87574135-87574157 ATATTTAAGTACATGTGTTTAGG - Intergenic
1100004951 12:89883799-89883821 GTGTGTGTGTATGTGTGTGTAGG - Intergenic
1100235953 12:92661037-92661059 ATGTGTTTATGTATGTGTGTAGG - Intergenic
1100726376 12:97413411-97413433 ATGTTTATGTGTGTGTGTGTCGG + Intergenic
1100837693 12:98582634-98582656 ATATGTGTGTGTATGTGTGTAGG + Intergenic
1101307096 12:103539287-103539309 GTGTGTATGTGTGTGTGTGTGGG + Intergenic
1101550910 12:105760707-105760729 GTGTGGACGCATATGTGTGTAGG + Intergenic
1102097731 12:110253656-110253678 ATCTTTATGCATATGTGTGTAGG + Intergenic
1102165435 12:110802458-110802480 ATGAGTGAGTCTATGAGTGTGGG + Intergenic
1102321846 12:111942762-111942784 ATGTGTATGTGTGTGTGTGTGGG + Intronic
1102835289 12:116052068-116052090 GTGTGTGTGTGTATGTGTGTAGG - Intronic
1102866078 12:116375421-116375443 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1103060145 12:117852053-117852075 ATGTGTACCTATGTGTGTGGGGG + Intronic
1103105304 12:118219255-118219277 TTGTGTATGTGTGTGTGTGTCGG + Intronic
1103165780 12:118769313-118769335 ATGTGTGTGTGTGTGTGTGTTGG + Intergenic
1103193824 12:119025125-119025147 GTGTGTGTGTATTTGTGTGTAGG + Intronic
1103217081 12:119210178-119210200 ATGTCTGTGTGTATGTGTGTAGG - Intronic
1103245004 12:119449118-119449140 ATGTGTATGTATATGTGAACAGG + Intronic
1103320375 12:120089284-120089306 GTGTGTATGTGTGTGTGTGTGGG + Intronic
1103628421 12:122238976-122238998 GTATGTATGTATGTGTGTGTGGG - Intronic
1104242768 12:127006902-127006924 ATGTGTGTGTAGATGTTTGTAGG - Intergenic
1104372493 12:128236207-128236229 ATGAATATGTATATTTGTGTGGG + Intergenic
1104593909 12:130106530-130106552 ATGTGTATGTCCTTGTGTGTAGG + Intergenic
1104607017 12:130197487-130197509 CTATGTATGTATGTGTGTGTGGG + Intergenic
1104816311 12:131647797-131647819 ATGTGAGTGTATATGTGTGAGGG - Intergenic
1104929608 12:132331263-132331285 CTGTGTATGCACATGTGTGTAGG + Intergenic
1105331686 13:19422688-19422710 ATATGTAAGTAAGTGGGTGTTGG + Intergenic
1105348919 13:19599030-19599052 ATGTGTGTGTGTCTGTGTGTCGG + Intergenic
1105601287 13:21890764-21890786 ATGTGCAAGTGTGTATGTGTGGG - Intergenic
1105601300 13:21891011-21891033 ATGTATATGCATGTGTGTGTGGG - Intergenic
1105658034 13:22461564-22461586 GTGTGTAAGTATATGAGCATTGG + Intergenic
1105722648 13:23132176-23132198 ATGAGTCTGTATGTGTGTGTGGG - Intergenic
1105933649 13:25076960-25076982 AAATGTAGGTAAATGTGTGTAGG + Intergenic
1106051642 13:26195801-26195823 AATTGTATGTATGTGTGTGTGGG - Intronic
1106219982 13:27738285-27738307 ATGTGTGTGTGTGTGTGTGTTGG + Intergenic
1106710472 13:32325889-32325911 ATTTGTGAGTACATATGTGTTGG + Intronic
1107022001 13:35761372-35761394 GTGTGTATGTCTGTGTGTGTAGG - Intergenic
1107022006 13:35761422-35761444 GTGTGTATGTATGTGTGTGTAGG - Intergenic
1107022052 13:35762014-35762036 GTGTGTAGATATGTGTGTGTAGG - Intergenic
1107022067 13:35762264-35762286 GTGTGTATGTGTAGGTGTGTAGG - Intergenic
1107022086 13:35762476-35762498 TTGTGTATGTATGTGTGTGTAGG - Intergenic
1107022096 13:35762633-35762655 GTGTGTATGTATGTGTGTGTAGG - Intergenic
1107022124 13:35762941-35762963 GAGTGTAGGTATGTGTGTGTAGG - Intergenic
1107022185 13:35763748-35763770 GTGTGTATGTGTGTGTGTGTAGG - Intergenic
1107733634 13:43373573-43373595 GTGTGTATGTGTATGTGTGTGGG - Intronic
1107807260 13:44165202-44165224 CTGTGTAAGTGTATGTGTTGGGG - Intergenic
1108034322 13:46272835-46272857 CTGTGTATGTATGTGTCTGTGGG - Intronic
1108036844 13:46298981-46299003 ATGTGTGTGTGTGTGTGTGTTGG - Intergenic
1108260292 13:48649036-48649058 GTGTGTATGTATGTGTATGTGGG + Intergenic
1108296565 13:49025904-49025926 ATTTAGAAGTATATATGTGTTGG - Intronic
1108413826 13:50177454-50177476 TTCTGTATGTATATGTGTGTGGG + Intronic
1108592177 13:51921918-51921940 GTGTGTATGTGTGTGTGTGTTGG + Intergenic
1108625003 13:52219156-52219178 ATGTATAAGTAAGTGGGTGTTGG + Intergenic
1108661049 13:52587261-52587283 ATGTATAAGTAAGTGGGTGTTGG - Intergenic
1108835085 13:54534889-54534911 ATGTGTATGTGAAGGTGTGTTGG - Intergenic
1108959893 13:56213601-56213623 GTGTGTTTGTGTATGTGTGTGGG - Intergenic
1109209629 13:59519945-59519967 GTGTGTGTGTGTATGTGTGTGGG - Intergenic
1109528607 13:63608794-63608816 CTGTGTATGTATATGTGTTTTGG + Intergenic
1109734443 13:66463680-66463702 ATTTGAAAGAAAATGTGTGTTGG + Intronic
1109768117 13:66931942-66931964 ATATGTATGTTTATGTGTGTGGG + Intronic
1109774458 13:67021902-67021924 ATGTGTATATATATGTATGTAGG + Intronic
1109897857 13:68717809-68717831 TTGTGTAATTATATGGGAGTAGG - Intergenic
1109996999 13:70141837-70141859 ATGTATGTATATATGTGTGTTGG - Intergenic
1110000949 13:70199475-70199497 GTGTATAAGTATGTATGTGTTGG + Intergenic
1110198923 13:72825391-72825413 ATGTATGAGTATGTGTGTGTAGG + Intronic
1110335161 13:74321299-74321321 ATATTTAAATATATATGTGTGGG + Intergenic
1110629383 13:77690158-77690180 ATGAATTATTATATGTGTGTAGG + Intergenic
1110875297 13:80502259-80502281 TTGTGTACCTATATATGTGTAGG + Intergenic
1111039527 13:82727786-82727808 GTGTGTATGTATGTGTCTGTGGG + Intergenic
1111108620 13:83677275-83677297 ATGTGTATGTATATGTGTGATGG + Intergenic
1111233427 13:85375092-85375114 TGGTGGCAGTATATGTGTGTGGG + Intergenic
1111279511 13:86001845-86001867 ATGTGTAAGAATCTGCATGTTGG + Intergenic
1111337568 13:86842045-86842067 ATGTGTATGTTTCTGTGTGTTGG + Intergenic
1111378750 13:87417402-87417424 GTGTGTGTGTCTATGTGTGTGGG + Intergenic
1111451327 13:88421439-88421461 ACATGTATGTGTATGTGTGTGGG + Intergenic
1111985677 13:95064513-95064535 ATGTGTGTGTGTGTGTGTGTGGG + Intronic
1112024501 13:95399898-95399920 AGCTGTATGTATCTGTGTGTAGG - Intergenic
1112043636 13:95573591-95573613 ATGTGAAAGAATATGTGCCTTGG + Intronic
1112182910 13:97102968-97102990 ATGTGTATGTATGTGTGTGATGG - Intergenic
1112285372 13:98099360-98099382 ATGTATATGTATATATGTGTTGG - Intergenic
1112572878 13:100609702-100609724 ATGTATATGTATATATGTATGGG - Intronic
1112640735 13:101272053-101272075 ATGAGCATGTATAAGTGTGTAGG + Intronic
1112672736 13:101659797-101659819 ATATGTAAGTATATGTGTGTAGG + Intronic
1112723523 13:102274683-102274705 ATGTGTATGTGTGTATGTGTGGG - Intronic
1112906836 13:104433027-104433049 ATGTGTGTGTGTCTGTGTGTTGG + Intergenic
1113081100 13:106521037-106521059 ATTTGGATGTATATGTGTGTTGG + Intronic
1113225657 13:108156936-108156958 GTGTGTATGTGTGTGTGTGTGGG - Intergenic
1113225663 13:108157082-108157104 GTGTGTGAGTATGTGTGAGTAGG - Intergenic
1113327179 13:109293554-109293576 ATGTATAGGTGTATGTGTTTGGG - Intergenic
1113327237 13:109293958-109293980 GTGTGTAGGTGTGTGTGTGTAGG - Intergenic
1113327262 13:109294115-109294137 GTGTGTAGGTGTGTGTGTGTAGG - Intergenic
1113439532 13:110317133-110317155 GTGTGTCTGTATGTGTGTGTGGG - Intronic
1113439535 13:110317214-110317236 ATGTGTGTGTCTGTGTGTGTGGG - Intronic
1113896097 13:113765467-113765489 ATGTGTAAGTGCGTGTGTGCAGG - Intronic
1113935442 13:113991879-113991901 ATGTGTGAGCATGTGTGTGTGGG - Intronic
1113964030 13:114142355-114142377 GTGTGTCAGTGTATGTGTATGGG - Intergenic
1114542757 14:23474576-23474598 TTGTGAAAGTGTGTGTGTGTAGG - Intronic
1114589733 14:23850485-23850507 GTGTGTATGTATATATGTCTAGG + Intergenic
1114669946 14:24405074-24405096 GTGTGTGTGTGTATGTGTGTTGG + Intronic
1114753003 14:25227169-25227191 ATATGCATGTATATGTGTATTGG + Intergenic
1114788302 14:25626268-25626290 CTGTGTGTGTATGTGTGTGTTGG + Intergenic
1114904951 14:27115664-27115686 GTGTGTATGTGTGTGTGTGTAGG + Intergenic
1114961262 14:27892777-27892799 GTGTTTATGTATATGTGTGGTGG - Intergenic
1114972148 14:28045950-28045972 ATGTGTGTGTATGTGTGTGTAGG + Intergenic
1115056122 14:29129274-29129296 TTGTGTGTGTATGTGTGTGTAGG - Intergenic
1115157254 14:30355521-30355543 ATGTGTGAGTGTGAGTGTGTGGG - Intergenic
1115338477 14:32267363-32267385 ATGTCTTAGTATCTGGGTGTGGG - Intergenic
1115520749 14:34230893-34230915 GTGTGTGCGCATATGTGTGTAGG - Intronic
1115524132 14:34262515-34262537 ATTTGTATGTATATGAATGTGGG - Intronic
1115658250 14:35464963-35464985 GTGTGTGTGTATGTGTGTGTTGG - Intergenic
1115814116 14:37144374-37144396 AAGAGAATGTATATGTGTGTAGG - Intronic
1116363594 14:44031988-44032010 ATATGGATGCATATGTGTGTTGG + Intergenic
1116425388 14:44784385-44784407 TTGTGGAAGTATGTGTGTTTGGG - Intergenic
1116530116 14:45960938-45960960 ATGTGTATGTGCATATGTGTGGG + Intergenic
1117694388 14:58344338-58344360 ATCTGCCAGTATATTTGTGTGGG + Intronic
1117914809 14:60666462-60666484 GGGTGTATGTATATATGTGTGGG - Intergenic
1117950418 14:61077811-61077833 ATGTTTAAGTAACTGAGTGTGGG - Intronic
1118080458 14:62352607-62352629 ATGTGTATGTGCATATGTGTGGG - Intergenic
1118133031 14:62989016-62989038 GTGTGTATGTGTGTGTGTGTAGG - Intronic
1118230738 14:63946427-63946449 ATGTGTATGTGTATGTTTTTTGG - Intronic
1118438399 14:65791550-65791572 ATGTGTATGTACGTGTGTGGTGG + Intergenic
1118499086 14:66340662-66340684 ATGTGTGTGTATATATATGTGGG + Intergenic
1118857925 14:69638454-69638476 GTGTGTAATTGTGTGTGTGTGGG + Intronic
1119106508 14:71930417-71930439 ATATGTATGTGTATGTATGTGGG - Intergenic
1119272572 14:73321811-73321833 CTATGTATGTATATATGTGTAGG + Intronic
1119945330 14:78687414-78687436 AATTGTAAGTAGATGAGTGTGGG + Intronic
1120025068 14:79574221-79574243 ATGTGTGTGTGTGTGTGTGTGGG - Intronic
1120302426 14:82725057-82725079 ATGTGTGTGTGTATGTGTGGGGG + Intergenic
1120484818 14:85099861-85099883 ATATATATGTATATGTGTGTGGG + Intergenic
1120636455 14:86957616-86957638 CTGTTTAAGAATATATGTGTGGG + Intergenic
1120653821 14:87165782-87165804 ATGTGTGTGTATGTGTGTGTTGG - Intergenic
1120747774 14:88167314-88167336 CTGTGTGTGTATGTGTGTGTGGG - Intergenic
1120784426 14:88518974-88518996 GTGTGTATGTGTGTGTGTGTAGG - Intronic
1121407267 14:93726936-93726958 GTGTGTGTGTATATGAGTGTGGG - Intronic
1121532432 14:94665043-94665065 ATATGTATATATATGTGTGTAGG - Intergenic
1121569704 14:94937820-94937842 CTGTGTGTGTATATCTGTGTGGG + Intergenic
1121871398 14:97411298-97411320 ATGTGTCTGTGTATGTGTGAAGG - Intergenic
1121883212 14:97518687-97518709 CTGAGTATGTATATATGTGTGGG - Intergenic
1122140057 14:99657960-99657982 GTGTGTATGTATGTGTGTGAAGG - Intronic
1123080238 14:105689289-105689311 ATGTGTGTGTATATGTGTATGGG - Intergenic
1123913971 15:25001905-25001927 ACATGTATGTGTATGTGTGTGGG + Intergenic
1123927390 15:25130027-25130049 ATCTGTGAGTATGTGTGAGTAGG + Intergenic
1124250890 15:28106055-28106077 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1125065384 15:35478344-35478366 ATGTGTGGGTATGTGTGTATGGG - Intronic
1125110804 15:36031037-36031059 ATGTGTATATGTATGTGTGTAGG + Intergenic
1125114397 15:36072362-36072384 ATGTATATGTGCATGTGTGTAGG - Intergenic
1125119347 15:36135160-36135182 ATGTGTGTGTGTGTGTGTGTGGG + Intergenic
1125124736 15:36206940-36206962 TTCTGTAGGTATATGTGTATTGG - Intergenic
1125415364 15:39446927-39446949 ATGTGTGAGTATGTGTGTTGGGG + Intergenic
1125622178 15:41073278-41073300 GTGTGTGAGTAGCTGTGTGTAGG - Intronic
1125792633 15:42380547-42380569 ATATGTTTGTATGTGTGTGTGGG + Intronic
1126192666 15:45895005-45895027 AGGAGAAAGTGTATGTGTGTGGG + Intergenic
1126435499 15:48633441-48633463 AAGTGTGAGTATGTGTGTGGTGG + Intronic
1126506540 15:49410986-49411008 GTGTGTGTGTATCTGTGTGTGGG + Intronic
1126665356 15:51071136-51071158 ATGTTTATGTATATGTTTTTAGG - Intronic
1127146302 15:56027700-56027722 ATATGTAGACATATGTGTGTAGG - Intergenic
1127460332 15:59192839-59192861 ATGTGGATGTATGTGTGGGTGGG + Intronic
1127604517 15:60573005-60573027 CTGAGTAAGTACATGAGTGTGGG + Intronic
1127607040 15:60596885-60596907 ATGTGTATGTGTGTGTGGGTGGG - Intronic
1127665848 15:61146443-61146465 GTGTGTATGTGTATGTGTGTTGG - Intronic
1127692646 15:61412969-61412991 ATGTGTATGTGTATCTGTGGAGG - Intergenic
1127745928 15:61972482-61972504 GTGTGTATGTGCATGTGTGTTGG + Intronic
1127784077 15:62340779-62340801 ATGTGTATGCATATATGTATAGG + Intergenic
1128078472 15:64842440-64842462 GTGTGTGTGTATGTGTGTGTTGG + Intronic
1128078481 15:64842499-64842521 GTGTGTGTGTATGTGTGTGTTGG + Intronic
1128585261 15:68843879-68843901 GTGTGTGTGTGTATGTGTGTGGG - Intronic
1128611770 15:69079663-69079685 TTGTGAAAGTGTGTGTGTGTTGG + Intergenic
1128916518 15:71567601-71567623 ATGTGTGTGTGTGTGTGTGTGGG - Intronic
1129201399 15:74003457-74003479 GTGTGCATGTATGTGTGTGTTGG - Intronic
1129222828 15:74143011-74143033 GTGTGTGAGTATGTGTGTGATGG + Intergenic
1129295423 15:74597502-74597524 GTGTGTGTGTGTATGTGTGTGGG - Exonic
1129544723 15:76383119-76383141 ATGTATATATATGTGTGTGTAGG - Intronic
1129661306 15:77554538-77554560 ACGTGTGTGTGTATGTGTGTGGG - Intergenic
1130162695 15:81417406-81417428 GTGTGTATGTATATGTAAGTGGG - Intergenic
1130185358 15:81675779-81675801 GTGTGTGTGTATGTGTGTGTGGG - Intergenic
1130459742 15:84152116-84152138 GTGTATATGTATATGTGTGCGGG - Intergenic
1130772834 15:86942130-86942152 ATGTGTGTGTTTGTGTGTGTAGG - Intronic
1130808845 15:87355397-87355419 ATATGCATGTTTATGTGTGTGGG + Intergenic
1131412206 15:92219146-92219168 ATGAGTAAGAATATGTGTTGGGG + Intergenic
1131619421 15:94051488-94051510 GTCTGTGAGTGTATGTGTGTGGG - Intergenic
1131642297 15:94305458-94305480 ATGTGTGTGTATGTGTGTGGAGG - Intronic
1131775276 15:95788792-95788814 GTGTGTGAGTGTGTGTGTGTGGG + Intergenic
1131869799 15:96751178-96751200 GTGTATATGTATTTGTGTGTTGG - Intergenic
1131941156 15:97567310-97567332 ATTTATTGGTATATGTGTGTGGG + Intergenic
1132023025 15:98381155-98381177 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
1132306821 15:100821035-100821057 GTGTGTGAGTGTGTGTGTGTGGG - Intergenic
1132335165 15:101043610-101043632 ATGTGTGTGTGTGTGTGTGTTGG + Intronic
1132342929 15:101089442-101089464 ATGTGTGTGCATGTGTGTGTAGG + Intergenic
1132386754 15:101406217-101406239 ATGTGTGCGTGTGTGTGTGTGGG - Intronic
1132411163 15:101579106-101579128 GTATATATGTATATGTGTGTGGG + Intergenic
1133039220 16:3051201-3051223 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1133138228 16:3727126-3727148 ATGTATAGATAGATGTGTGTGGG + Exonic
1133688837 16:8193336-8193358 ATGTTTATGTGTGTGTGTGTGGG + Intergenic
1133876101 16:9736049-9736071 ATCTGTGTGTGTATGTGTGTTGG - Intergenic
1133945863 16:10347876-10347898 ATGTATGTGTATATATGTGTGGG + Intronic
1134056320 16:11172289-11172311 ATGTGTGAGTGTGTATGTGTAGG - Intronic
1134176315 16:12009370-12009392 ATGTTTTTGTATGTGTGTGTGGG + Intronic
1135044192 16:19141399-19141421 GTGTATATATATATGTGTGTGGG - Intronic
1135281799 16:21158999-21159021 GTGTGTATGTGTGTGTGTGTTGG - Intronic
1135397155 16:22139940-22139962 ATGGGTGTGTACATGTGTGTAGG - Intronic
1135845394 16:25913902-25913924 ATGTGTGTGCATATGTATGTAGG + Intronic
1135845415 16:25914091-25914113 ATGTGTGTGTATGTGTATGTAGG + Intronic
1135845443 16:25914297-25914319 ATGTGTATGTATGTGTGTATAGG + Intronic
1136023903 16:27457605-27457627 GTATGTATGTATTTGTGTGTGGG - Intergenic
1136114955 16:28088785-28088807 GTGTGTGAGTGTGTGTGTGTGGG - Intergenic
1136501925 16:30675367-30675389 ATGTTTTAGTATATGTGGCTGGG + Intergenic
1136637828 16:31537203-31537225 ATGTGTGTGTGTGTGTGTGTGGG + Intergenic
1137273086 16:46915841-46915863 ATGTGTCTGTGTATGTGTGTAGG - Intronic
1137561620 16:49506058-49506080 GTGTGTGTGTATGTGTGTGTAGG + Intronic
1138587067 16:57977577-57977599 GTGTGTGTGTATGTGTGTGTTGG + Intronic
1138755614 16:59481027-59481049 ATGTGTAAGAATATGTGGGCTGG + Intergenic
1138840107 16:60490957-60490979 ATGTGTGTGTGTGTGTGTGTGGG + Intergenic
1138920327 16:61520320-61520342 ATGTGTGTATATATGTGTGTGGG - Intergenic
1138960887 16:62027896-62027918 ATGTGCACGTGTATGTGTGTGGG - Intronic
1139029472 16:62861728-62861750 ATATGTGTGTATCTGTGTGTGGG + Intergenic
1139135799 16:64203408-64203430 ACGTCTGAGTAGATGTGTGTGGG - Intergenic
1139453939 16:67056512-67056534 GTGTGTGTGTGTATGTGTGTAGG + Intronic
1140212926 16:72984932-72984954 ATGTATGTGTATATGTGTATAGG - Intronic
1140328111 16:74025534-74025556 ATGTGCACGCATGTGTGTGTGGG - Intergenic
1140647923 16:77053261-77053283 TTGTGTATGTTTATGTGTGTTGG + Intergenic
1140967475 16:79980900-79980922 TTGTGTGTGTATGTGTGTGTAGG - Intergenic
1141216424 16:82029094-82029116 ATGTGTATATCTCTGTGTGTAGG - Intergenic
1141270488 16:82535791-82535813 AAGTGTTTGTGTATGTGTGTTGG - Intergenic
1141329689 16:83099081-83099103 ATCTTTATGTATGTGTGTGTGGG - Intronic
1141492502 16:84383741-84383763 GTGTGTGTGTATGTGTGTGTTGG + Intronic
1141674483 16:85510430-85510452 GTGTGTCAGTGTGTGTGTGTCGG + Intergenic
1141741680 16:85897701-85897723 ATTTGTAAGTAAATCTGTGTAGG + Intergenic
1141928858 16:87187020-87187042 ATGTGTGTGTGCATGTGTGTGGG + Intronic
1141928879 16:87187253-87187275 GTGTGTACATGTATGTGTGTGGG + Intronic
1141928929 16:87187824-87187846 ATGTGTGCGTGTACGTGTGTGGG + Intronic
1141928955 16:87188054-87188076 ATGTGTACATGTGTGTGTGTGGG + Intronic
1142086473 16:88185976-88185998 ATGTGTGAGTGTGTGTGTCTGGG - Intergenic
1142321322 16:89384833-89384855 GTGTGTAAGAACATGTGTGTGGG + Intronic
1142423175 16:89985939-89985961 ATATATACATATATGTGTGTGGG - Intergenic
1142639130 17:1275418-1275440 GTGTGTGAGTGAATGTGTGTGGG + Intergenic
1142951458 17:3484502-3484524 TTGTGTATGTGTATGTGTTTGGG + Intronic
1142956111 17:3523891-3523913 GTGTGTATGTGTGTGTGTGTAGG - Intronic
1143462006 17:7109844-7109866 GTGTGTGAGTGTACGTGTGTGGG - Intronic
1143747650 17:9005427-9005449 GTGTGTATGTGTGTGTGTGTTGG - Intergenic
1143800470 17:9375735-9375757 ATATGTATGTATGTGTATGTGGG - Intronic
1144125036 17:12195380-12195402 ATGCCTAGGTATGTGTGTGTAGG + Intergenic
1144175471 17:12700900-12700922 ATGTGTGTGTATGTGTGTGGGGG + Intronic
1144201809 17:12948713-12948735 GTGTGTGTGTGTATGTGTGTTGG - Intronic
1144212192 17:13025054-13025076 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
1144218717 17:13080758-13080780 GTGTGTACATATGTGTGTGTGGG + Intergenic
1144428956 17:15173192-15173214 ATGTATATGTATGTGTGTATGGG - Intergenic
1144461902 17:15465122-15465144 CTGTGTTTGTATCTGTGTGTTGG - Intronic
1144507713 17:15846860-15846882 ATGTGTAGGTGTATGTGTGTAGG - Intergenic
1145171837 17:20664477-20664499 ATGTGTAGGTGTATGTGTGTAGG - Intergenic
1146227033 17:31075894-31075916 GTGTGTATGCATCTGTGTGTTGG - Intergenic
1146404880 17:32528461-32528483 GTGTGTGTGTGTATGTGTGTCGG + Intronic
1146468608 17:33106853-33106875 GTGTGAAAAAATATGTGTGTGGG + Intronic
1146494721 17:33311448-33311470 GTGTGTGTGTAGATGTGTGTAGG + Intronic
1146548308 17:33758180-33758202 GTGTGTATATATGTGTGTGTAGG + Intronic
1146553541 17:33803329-33803351 CTGTGTATGTGTATATGTGTGGG + Intronic
1146630729 17:34467403-34467425 ATGTGAGTGTGTATGTGTGTGGG - Intergenic
1146684189 17:34829484-34829506 ATGTGAATGTATTTGTGTGTGGG - Intergenic
1146946894 17:36879514-36879536 ATGTGTGTGTATCTCTGTGTAGG + Intergenic
1147012385 17:37460761-37460783 ATGTGTGTGTATGTATGTGTAGG + Intronic
1147047581 17:37765937-37765959 AGGTGTATCTATTTGTGTGTTGG - Intergenic
1147163374 17:38580275-38580297 ATGTGTGTGTGTGTGTGTGTTGG - Intronic
1147181494 17:38688945-38688967 ATGTGTGTGTGTGTGTGTGTGGG - Intergenic
1147494094 17:40899302-40899324 ATGTGTGTGTATGTATGTGTGGG + Intergenic
1147494323 17:40901514-40901536 ATGTGTGTGTATGTATGTGTGGG + Intergenic
1147664192 17:42135613-42135635 ATGTGTAAGTCCATGAATGTGGG + Intronic
1148160199 17:45445331-45445353 GTGTATAAATTTATGTGTGTGGG + Intronic
1148445486 17:47734601-47734623 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1148485580 17:47988680-47988702 GTGTGTGTGTATGTGTGTGTGGG - Intergenic
1148682076 17:49479944-49479966 CTGTGTGTGTTTATGTGTGTTGG - Intergenic
1148750586 17:49943650-49943672 GTGTGTGGGTATGTGTGTGTAGG + Intergenic
1148839193 17:50483836-50483858 AATTGGAGGTATATGTGTGTGGG - Intronic
1149430416 17:56592944-56592966 GTGTGTGTATATATGTGTGTTGG + Intergenic
1149627501 17:58090242-58090264 ATGTGTGTGTATGTGTGTGTGGG + Exonic
1150391490 17:64792210-64792232 GTGTATAAATTTATGTGTGTGGG + Intergenic
1150410302 17:64936341-64936363 GTGTGTACATTTATGTGTGTGGG + Intergenic
1151035008 17:70788783-70788805 ATGTGGAAGTGCATGTGAGTTGG + Intergenic
1151206443 17:72511583-72511605 GTGTGTAAGTGTACGTATGTGGG + Intergenic
1151281833 17:73081739-73081761 ATATATACATATATGTGTGTGGG + Intronic
1151460458 17:74251220-74251242 ATGTGCCTGTATGTGTGTGTGGG + Intronic
1151497148 17:74465288-74465310 TTGTGTGAGTGTATGTGTGTGGG + Intergenic
1151741641 17:75986877-75986899 ATGTGTTTGTATATGTGGGTGGG + Intronic
1152028767 17:77828564-77828586 GTGTGTATGTATATGCATGTGGG + Intergenic
1152158841 17:78654355-78654377 GTGTGTATGTGTATGTATGTGGG - Intergenic
1152285826 17:79412815-79412837 ATGTGTGTGTATATATGTGAGGG + Intronic
1152581963 17:81169579-81169601 ATGTGTAGATGTGTGTGTGTGGG + Intergenic
1152582010 17:81170010-81170032 ATGTGTATGTGCATATGTGTAGG + Intergenic
1152582016 17:81170114-81170136 ATGTGTAGGCATGTGTGTGTTGG + Intergenic
1152872731 17:82766645-82766667 CTGTGTAAGTATAACTGTGTTGG + Intronic
1153499369 18:5732449-5732471 ATGTGTGAGCGTATGTGTTTGGG + Intergenic
1153579603 18:6558975-6558997 ATGTGGGTGTGTATGTGTGTGGG + Intronic
1153924531 18:9824454-9824476 GTGTGTAGGTGTGTGTGTGTTGG + Intronic
1153968354 18:10202307-10202329 ATGTGTGAGTGTGTGAGTGTTGG - Intergenic
1153979833 18:10299153-10299175 ATATGTATGTATACGTGTGTGGG - Intergenic
1154035134 18:10793626-10793648 GTGTGTGAATATGTGTGTGTGGG + Intronic
1155180163 18:23338119-23338141 ATGTGAAAATATATGTTTGGTGG - Intronic
1155234691 18:23807490-23807512 CTGTGTGTGTATGTGTGTGTAGG + Intronic
1155460817 18:26080785-26080807 ATATGTATGTCTGTGTGTGTTGG - Intronic
1155758875 18:29539223-29539245 ATCTGTAAGTGTTAGTGTGTCGG - Intergenic
1155812339 18:30252880-30252902 ATCTGTAAGTTTCTGTGTGAGGG - Intergenic
1155843713 18:30678852-30678874 ATGTGTATGCATGTGTGTGTGGG - Intergenic
1155867669 18:30985922-30985944 GTGTGCAAGTGCATGTGTGTGGG + Intergenic
1155890798 18:31265975-31265997 TTGTATAGGTATATGTGTTTTGG + Intergenic
1156115551 18:33783164-33783186 ATATGTAATTATATGTATATAGG + Intergenic
1156147282 18:34199446-34199468 ATTTGTGTGTATTTGTGTGTGGG - Intronic
1156324904 18:36066132-36066154 ATGTGTAAGTATGTGTGTATTGG - Intronic
1156476273 18:37407565-37407587 ATATGTGTGTGTATGTGTGTGGG + Intronic
1156518282 18:37699370-37699392 GTGTGTATGTGTATGTGTGGTGG + Intergenic
1156619550 18:38833244-38833266 ATGTGATAGTATATGGATGTGGG + Intergenic
1156649657 18:39210366-39210388 ATATGTATATATATGTGGGTGGG + Intergenic
1157152841 18:45236607-45236629 ATGTGTGTGTATATATGTGTGGG + Intronic
1157256792 18:46146602-46146624 TTTTGTAAGTATATATGTATGGG - Intergenic
1157287092 18:46384337-46384359 GTGTGTACATGTATGTGTGTGGG + Intronic
1157300500 18:46475620-46475642 ATGTGTGTGTACATGAGTGTGGG - Intergenic
1157312467 18:46562352-46562374 ATGTGCAGATATATGTGTGCAGG - Intronic
1158109199 18:53921071-53921093 ATGTGTATGTGCATGGGTGTGGG + Intergenic
1158150897 18:54369141-54369163 ATATGTGAGTATATGTGGGTTGG - Intronic
1158386969 18:57005579-57005601 ATGAGTAAGTATATTTGGGTAGG + Intronic
1158429207 18:57368965-57368987 ATGTGTGTGTATGTGTGTGTGGG - Intronic
1158831458 18:61283932-61283954 GTGTGTATGTGTGTGTGTGTTGG - Intergenic
1158881738 18:61785412-61785434 GTGTGTATGTGTGTGTGTGTTGG + Intergenic
1158916435 18:62136275-62136297 GTGTGTATATATATGTGTATAGG - Intronic
1159228271 18:65569798-65569820 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
1159318629 18:66815551-66815573 ATGTTTGTATATATGTGTGTGGG + Intergenic
1159424719 18:68270693-68270715 AGGTGAAATTAAATGTGTGTGGG + Intergenic
1159477178 18:68936878-68936900 TTACGTATGTATATGTGTGTTGG - Intronic
1159484472 18:69036997-69037019 ATGTGTATATATATGTGTGGGGG + Intronic
1159520919 18:69522223-69522245 GTGTGTGTGTGTATGTGTGTGGG - Intronic
1159625595 18:70690195-70690217 ATATGTTTGTATATTTGTGTGGG + Intergenic
1159675450 18:71278648-71278670 ATTTGGGAGAATATGTGTGTGGG - Intergenic
1159677215 18:71299819-71299841 CTGTGTGTATATATGTGTGTGGG + Intergenic
1159903875 18:74073135-74073157 GTGTGTGTGTATGTGTGTGTAGG - Intergenic
1160071443 18:75632235-75632257 ATTTGGAAATAAATGTGTGTGGG - Intergenic
1160450592 18:78962353-78962375 ATGTGTGTGTATGGGTGTGTGGG - Intergenic
1160523211 18:79520734-79520756 ATGTGTGTGTCTGTGTGTGTAGG + Intronic
1160523260 18:79520981-79521003 ATGTGTGTGTCTGTGTGTGTGGG + Intronic
1160523312 18:79521277-79521299 ATGTGTGTGTCTGTGTGTGTGGG + Intronic
1160523344 18:79521463-79521485 ATGTGTATGTGTGTGTGTGGGGG + Intronic
1160523359 18:79521565-79521587 ATGTGTGTGTCTGTGTGTGTGGG + Intronic
1160523365 18:79521602-79521624 ATGTGTATGTCTGTGTGTGTGGG + Intronic
1160523376 18:79521642-79521664 ATGTGTGTGTCTGTGTGTGTGGG + Intronic
1160523409 18:79521821-79521843 ATGTGTGTGTCTGTGTGTGTGGG + Intronic
1160523419 18:79521861-79521883 ATGTGTGTGTCTGTGTGTGTGGG + Intronic
1160523427 18:79521898-79521920 ATGTGTATGTCTGTGTGTGTGGG + Intronic
1160656250 19:272261-272283 GTGTGTATGTGTGTGTGTGTGGG - Intergenic
1161755745 19:6132744-6132766 ATGTGTGTGCATATGTGAGTGGG + Intronic
1161755749 19:6132814-6132836 ATGTGTGTGCATATGTGAGTGGG + Intronic
1161933406 19:7356119-7356141 ATGTGTGTGTGTATGTGTGTTGG - Intronic
1162468448 19:10857252-10857274 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1162530406 19:11232773-11232795 CTGTGTAGGTATATGCATGTGGG + Intronic
1162569736 19:11464580-11464602 GTGTGTGTGTATGTGTGTGTGGG - Intronic
1162624621 19:11874661-11874683 ATGTGTAACTATTGGAGTGTGGG + Intronic
1162629712 19:11917495-11917517 ATGTGTAACTATTGGAGTGTGGG + Intergenic
1162634767 19:11958726-11958748 ATGTGTAACTATTGGAGTGTGGG + Intronic
1164565102 19:29320172-29320194 CTGTGTGTGTATGTGTGTGTGGG - Intergenic
1164849054 19:31465424-31465446 ATTGGTTGGTATATGTGTGTTGG + Intergenic
1165076032 19:33280380-33280402 ATGTGTGTGTGTATGTGTGTTGG - Intergenic
1165607942 19:37122891-37122913 ATGTGTAAGTATGTGACTCTGGG - Intronic
1165722739 19:38091080-38091102 ATTTATAAGTATATGACTGTAGG - Intronic
1165933844 19:39377313-39377335 ATGTGTACCTATATGTTTGTGGG + Intronic
1166646593 19:44536570-44536592 ATGTGTGTGTGTGTGTGTGTAGG - Intergenic
1166790092 19:45393917-45393939 ATGTGTATGTGTGTGTGTTTTGG - Intronic
1166963603 19:46514677-46514699 CTGTGTAAGTCTGTGTGTGTAGG - Intronic
1167072633 19:47229803-47229825 GTGTGTATGTATGTGTGTGGTGG - Intronic
1167226577 19:48246962-48246984 ATAGGTAAGTATATTTGTATAGG - Intronic
1167786239 19:51639158-51639180 TTGTATAAGTATTTATGTGTTGG + Intronic
1168114442 19:54213762-54213784 ATATGTAAATATATATATGTTGG + Intronic
1168159102 19:54496932-54496954 ATGTGTGTGTATATATATGTAGG - Intergenic
1168508030 19:56952676-56952698 ATTTATATGTATATATGTGTGGG - Intergenic
1168508038 19:56952738-56952760 ATTTATAAGTATATTTGTGGGGG - Intergenic
924999052 2:390557-390579 ACGTGTGTGTATGTGTGTGTGGG + Intergenic
925055181 2:851794-851816 GTGTGTGAGTGTGTGTGTGTAGG + Intergenic
925149381 2:1604323-1604345 GTGTGTATGTCTTTGTGTGTAGG - Intergenic
925329288 2:3045908-3045930 ATGTGTACGTGTGTGTATGTAGG + Intergenic
925376983 2:3393498-3393520 GTGTGTGTGTATATGTGTGAGGG - Intronic
925483389 2:4301725-4301747 ATTTGTAGGTATATGTGTGTGGG + Intergenic
925513463 2:4653311-4653333 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
925572749 2:5329354-5329376 AGGTGTATGTGGATGTGTGTGGG + Intergenic
925733091 2:6936310-6936332 ATATGTATCTATATGTGTGTGGG - Intronic
925922936 2:8649476-8649498 ATGTATATATATATGTGTGTAGG + Intergenic
925950723 2:8907916-8907938 CAGTGTAAGGATAAGTGTGTTGG - Intronic
926263347 2:11289244-11289266 TTGTTTATGTGTATGTGTGTGGG - Intronic
926293316 2:11548383-11548405 ATGTGTATGTGTATGTATGTGGG - Intronic
926332446 2:11836806-11836828 AGGTGTGGGTATATGAGTGTGGG + Intergenic
926550947 2:14300094-14300116 TTGTGTGTGTATGTGTGTGTGGG - Intergenic
926705260 2:15833100-15833122 ATGTGTGTGTTTATGTATGTGGG + Intergenic
927011769 2:18911626-18911648 GTGTGTGAGTGTGTGTGTGTTGG + Intergenic
927011779 2:18911699-18911721 GTGTGTGAGTGTGTGTGTGTTGG + Intergenic
927011802 2:18911842-18911864 ATGTGTGAGTGTGTGTGTGTTGG + Intergenic
927048539 2:19304120-19304142 ATGTGTGTGTGTGTGTGTGTGGG - Intergenic
927445209 2:23154502-23154524 CTGTGGAAGTATGTGTGTGGCGG + Intergenic
928236468 2:29546100-29546122 ATATGTATGTCTATGTGTGGAGG + Intronic
928395170 2:30938044-30938066 GTGTGTAAGTATGTGTGTGGTGG - Intronic
928550314 2:32364109-32364131 AAGTGAAGGTATATGTGTGCAGG + Intronic
928573388 2:32629885-32629907 GTGTGTATGTGTGTGTGTGTGGG + Intronic
928872992 2:36003507-36003529 ATGTTTATTTATATGTGTCTGGG - Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
928937674 2:36696734-36696756 GTGTGTGTGTGTATGTGTGTGGG + Exonic
929259238 2:39845968-39845990 GTGTGTATGTATGTGGGTGTGGG + Intergenic
929269267 2:39955465-39955487 ATGTGTATATATATGAGTATAGG - Intergenic
929304162 2:40340920-40340942 ATGGGAATGTATATTTGTGTAGG - Intronic
930284208 2:49407760-49407782 GTGTGTATGTGTGTGTGTGTGGG + Intergenic
930473306 2:51847993-51848015 ATGTGGTCGTACATGTGTGTAGG + Intergenic
930494550 2:52124946-52124968 ATGTAAATGTAAATGTGTGTGGG - Intergenic
930537193 2:52657742-52657764 GTGTGTATGTGTGTGTGTGTAGG - Intergenic
930553286 2:52863088-52863110 GTGTGTCAGTGTGTGTGTGTAGG - Intergenic
930851053 2:55960801-55960823 ATGTGCATGCATCTGTGTGTAGG - Intergenic
931035603 2:58239772-58239794 ATTGTTAAGTATATGTATGTGGG - Intronic
931138909 2:59435597-59435619 ATGTGTGTGTGTGTGTGTGTCGG + Intergenic
931169211 2:59785055-59785077 GTGTGTATGTGTATATGTGTAGG + Intergenic
931856113 2:66303262-66303284 GTGTGTATGTATGTGTGGGTGGG - Intergenic
931937367 2:67214093-67214115 ATGTGGGTGTGTATGTGTGTGGG - Intergenic
931937417 2:67214413-67214435 ATTTGGATGTGTATGTGTGTGGG - Intergenic
931957754 2:67447014-67447036 AAATGTAAAAATATGTGTGTTGG - Intergenic
931987416 2:67755305-67755327 ATGTGTATGTGCGTGTGTGTTGG + Intergenic
932030131 2:68175255-68175277 ATGTGTGAATATTTGTTTGTTGG + Exonic
932129628 2:69176082-69176104 GTGTGTGTGTATGTGTGTGTGGG - Intronic
932224748 2:70030712-70030734 CTCTGTATGTGTATGTGTGTTGG + Intergenic
932345514 2:70992772-70992794 ATATATATGTATATATGTGTTGG - Intronic
932522009 2:72423686-72423708 ATGTGTGAGTAGATGTTTGTAGG - Intronic
932922146 2:75928876-75928898 GTGTGTGTGTATTTGTGTGTGGG + Intergenic
932948387 2:76264346-76264368 ATTTGTATGTATTTGTGTGTTGG - Intergenic
933065392 2:77787370-77787392 TTTTGTGTGTATATGTGTGTAGG - Intergenic
933070525 2:77852324-77852346 TTGTGTGTGTATATGTGGGTGGG + Intergenic
933104104 2:78300348-78300370 GTGTGTGTGTGTATGTGTGTTGG - Intergenic
933477429 2:82808944-82808966 ATGTGTGTGTGTGTGTGTGTGGG + Intergenic
933556154 2:83833405-83833427 ATGTGTACGTATATGTATATAGG - Intergenic
934014191 2:87861015-87861037 ATGTGTGAGTGTCAGTGTGTGGG + Intergenic
934032523 2:88061159-88061181 TTGTGTGTGTATGTGTGTGTTGG + Intergenic
934032529 2:88061197-88061219 GTGTGTGTGTATGTGTGTGTTGG + Intergenic
934124002 2:88868569-88868591 ATGTGTATATGTATGTATGTAGG + Intergenic
934490416 2:94758686-94758708 ATGTGTGTGTGTTTGTGTGTTGG - Intergenic
934581464 2:95444239-95444261 ATGTGTAAGTGAAAGTGGGTGGG - Intergenic
934597986 2:95632475-95632497 ATGTGTAAGTGAAAGTGGGTGGG + Intergenic
934928532 2:98399975-98399997 GTGTGTATGTATATATATGTTGG + Intergenic
935282509 2:101530809-101530831 ATGTATGGGTATATATGTGTGGG + Intergenic
935426760 2:102927634-102927656 CTTTGTGAGTATATATGTGTGGG + Intergenic
935715665 2:105936941-105936963 GTGTATATGTGTATGTGTGTTGG - Intergenic
935962500 2:108440679-108440701 GTGTGTGTGTATGTGTGTGTGGG - Intergenic
936745016 2:115565141-115565163 ATGTGTGTATATATGTATGTAGG + Intronic
937052597 2:118904717-118904739 ATGTGCATGTATTTGTGAGTAGG + Intergenic
937160383 2:119755549-119755571 GTGTGTGCGTGTATGTGTGTGGG + Intergenic
937380356 2:121371067-121371089 ATTTATACATATATGTGTGTAGG - Intronic
937503777 2:122513366-122513388 GTGTGTATGTGGATGTGTGTAGG + Intergenic
937550555 2:123084232-123084254 AAGAGTAAGTTGATGTGTGTTGG - Intergenic
937688926 2:124731704-124731726 ATGTGTAAGAATGTGTGTATGGG + Intronic
937742132 2:125367747-125367769 ATGTGTGTGTATTTGTGTGTAGG - Intergenic
937944571 2:127320640-127320662 GTGTCTAGGTATATTTGTGTAGG - Intronic
938130468 2:128711179-128711201 GTGTGTATGTATGTGTGTTTTGG + Intergenic
938235807 2:129706100-129706122 GTGTGTAAATATGTGGGTGTAGG + Intergenic
938274392 2:130005092-130005114 GTGTGTGTGTATGTGTGTGTTGG + Intergenic
938440988 2:131332186-131332208 GTGTGTGTGTATGTGTGTGTTGG - Intronic
938782719 2:134599916-134599938 GTGTGTGTATATATGTGTGTAGG - Intronic
938839481 2:135145383-135145405 GTGTGTATGTGTGTGTGTGTTGG - Intronic
938843067 2:135181491-135181513 ATGTATATCTTTATGTGTGTGGG + Intronic
939007199 2:136803152-136803174 ATGTGCATGTGTGTGTGTGTGGG - Intronic
939224178 2:139344294-139344316 GTGTGTGTGTATGTGTGTGTGGG + Intergenic
939260122 2:139796411-139796433 TTGTGTGTGCATATGTGTGTGGG - Intergenic
939284039 2:140105760-140105782 ATATATATGTATGTGTGTGTAGG - Intergenic
939685482 2:145193843-145193865 CCGTGTGAGTGTATGTGTGTGGG - Intergenic
939698937 2:145364381-145364403 ATGTGTGCATATGTGTGTGTGGG + Intergenic
939931435 2:148239056-148239078 ATGTGTGTGTATATATGTGTGGG + Intronic
940001354 2:148969451-148969473 GTGTGTGTGTGTATGTGTGTGGG + Intronic
940008749 2:149033917-149033939 ATGTGTGTGTGTGTGTGTGTAGG + Intergenic
940040538 2:149355571-149355593 ATGTGCATATATATGTATGTAGG - Intronic
940133920 2:150414594-150414616 AGGTGTATGTATGTGTGTGTAGG - Intergenic
940204227 2:151184984-151185006 GTGTGTGTGTATGTGTGTGTAGG - Intergenic
940205455 2:151197071-151197093 GTGTGTGTGTGTATGTGTGTTGG - Intergenic
940541357 2:155024058-155024080 ATGTGAAAGTTTCTGTGTCTTGG + Intergenic
940671725 2:156678098-156678120 ATGTGTATGCATGTGTGTATCGG - Intergenic
940693902 2:156955540-156955562 ATTTGTAATTATTTTTGTGTGGG + Intergenic
940927356 2:159379993-159380015 GTGTGTATGTATATGAGTTTAGG - Intronic
941046762 2:160684636-160684658 ATGTGTGCATGTATGTGTGTAGG - Intergenic
941098128 2:161264854-161264876 ATGAGTGTGTATATATGTGTTGG - Intergenic
941488961 2:166119267-166119289 ATGTGAAATTATATGTGTTGAGG - Intronic
941581166 2:167296960-167296982 TTGTGTAGGTATATATGAGTGGG - Intergenic
941852295 2:170195925-170195947 ATTTTTAGGTATATGTGTGATGG - Intronic
941878886 2:170461818-170461840 GTGTGTATGTATATGTATGGAGG + Intronic
942609355 2:177726854-177726876 ATGTGTACGTACATATCTGTGGG - Intronic
942723230 2:178977164-178977186 AAGTGTAAGTATAAGAGTGTTGG + Intronic
942937752 2:181578238-181578260 GTGTGTATATATATGTGTGTGGG + Intronic
942982346 2:182097331-182097353 ATGTGTGAGTGTATGTGTTCAGG - Intronic
943197475 2:184772924-184772946 ATATGTATATATATGTGTGTGGG - Intronic
943354180 2:186831341-186831363 ATGTGTATGTATACGTGTGTGGG + Intronic
943650725 2:190455007-190455029 ATGTATATGTATATGTGTGTTGG + Intronic
943792656 2:191951892-191951914 ATGAGTAAGTCTATGTGCCTTGG + Intronic
943816786 2:192267929-192267951 ATCTGTATTTATATGTGTGCTGG - Intergenic
943860440 2:192855328-192855350 ATGTGTATGTGTATGTGTGTGGG - Intergenic
944351561 2:198733669-198733691 GTGTGTATGTGTGTGTGTGTAGG + Intergenic
944366485 2:198926817-198926839 GTGTGTATGTGTGTGTGTGTTGG - Intergenic
945117862 2:206426871-206426893 GTGTGTATGTGTGTGTGTGTTGG - Intergenic
945202047 2:207291872-207291894 ATGTGTAAGTAAAAGTTTATTGG + Intergenic
945447894 2:209959755-209959777 ATGTGTCTGAATGTGTGTGTTGG + Intronic
945510324 2:210693638-210693660 ATGTGTGCCTACATGTGTGTGGG - Intergenic
945538823 2:211056629-211056651 ACGTGTATGTATGTGTTTGTGGG - Intergenic
946546772 2:220752557-220752579 ATGTGTAGGGATATATGTGCAGG + Intergenic
946572320 2:221038266-221038288 ATGTGTAAATGTGTATGTGTGGG + Intergenic
946707940 2:222477559-222477581 ATGTGTGAGTGTATGTATATAGG + Intronic
946925929 2:224626821-224626843 ATGTGTGTGTCTGTGTGTGTTGG - Intergenic
947428412 2:230004573-230004595 ATGTAGAACCATATGTGTGTGGG + Intronic
948779419 2:240308732-240308754 CTGTGTATGTCTCTGTGTGTGGG + Intergenic
948985159 2:241517117-241517139 TTGGGTATGTGTATGTGTGTTGG - Intergenic
1169515667 20:6313183-6313205 TTTTATAAGTATTTGTGTGTGGG - Intergenic
1169780477 20:9304219-9304241 GGGTGTATGTATGTGTGTGTGGG + Intronic
1169833362 20:9850586-9850608 ATGTATATGTATATGTATGTAGG - Intergenic
1169932094 20:10844764-10844786 ATCTTTAAGTATATGTCTATAGG - Intergenic
1169975756 20:11325459-11325481 GTGTGTGTGTTTATGTGTGTTGG - Intergenic
1170260575 20:14402114-14402136 ATGTGTATGTGTATGTGCATGGG + Intronic
1170379372 20:15740143-15740165 ATGTGGAAGAATATGTGGGAGGG + Intronic
1171030376 20:21671088-21671110 TTGTGTATGTATATGTGGGGGGG - Intergenic
1171110879 20:22480978-22481000 ATGTGTAAGTATGTGAAAGTAGG - Intergenic
1171179079 20:23078549-23078571 ATGTGTGTGTTTATGTGTGTGGG + Intergenic
1171283468 20:23919786-23919808 ATGTGTACATACATGTATGTGGG - Intergenic
1171335076 20:24377539-24377561 TTGTGTATGTATATATGTGTGGG + Intergenic
1171335125 20:24378349-24378371 ATTTGTGTGTATATATGTGTGGG + Intergenic
1171771693 20:29326960-29326982 ATGTGTACCTGTGTGTGTGTCGG - Intergenic
1172332916 20:34088269-34088291 TTGTGTATGTATGTGTGTTTGGG - Intronic
1173064150 20:39693429-39693451 ATGTGTATGTGTGTGTGTGTTGG + Intergenic
1173850938 20:46217213-46217235 ATGTGTGAGTATATCTGTGTGGG - Intronic
1173897275 20:46560613-46560635 GCGTGTGTGTATATGTGTGTGGG - Intronic
1173938772 20:46892493-46892515 ATATGTAACTATATATGTATAGG + Intergenic
1173941712 20:46916382-46916404 GTGTGTGAGTATATGAATGTGGG + Intronic
1174056396 20:47801185-47801207 ATGTGTGAGTGTAGGTGTGTTGG + Intergenic
1174105509 20:48159747-48159769 AAGTGCATGTATATGAGTGTGGG + Intergenic
1174308131 20:49629526-49629548 ATGTGTGTGTGTGTGTGTGTGGG + Intergenic
1174308778 20:49634295-49634317 GTGTGTGTGTGTATGTGTGTGGG - Exonic
1174798805 20:53545091-53545113 ATATGTATGTGTGTGTGTGTGGG + Intergenic
1174864496 20:54122756-54122778 ATGTGTATGCATGTGTGTGTAGG - Intergenic
1175050039 20:56146701-56146723 AGTTGTATGTATGTGTGTGTGGG - Intergenic
1175104806 20:56607269-56607291 ATGTGCGTGTATATGTGTTTGGG - Intergenic
1175512488 20:59540998-59541020 ATGTGTCTGTATAAGTGAGTGGG + Intergenic
1175546238 20:59779796-59779818 ATGTGCAAGCCTGTGTGTGTGGG - Intronic
1175687472 20:61041934-61041956 GTGTGTGAGTGTGTGTGTGTAGG - Intergenic
1175744355 20:61444947-61444969 ATCTGTGTGTATATGTGTGTGGG + Intronic
1175757083 20:61536698-61536720 ATGTGTATATGTATGTATGTAGG - Intronic
1176200285 20:63857166-63857188 CTCTGTACGTATATGTTTGTAGG + Intergenic
1176741309 21:10605881-10605903 ATATGTAAGTAAGTGGGTGTTGG - Intronic
1176948796 21:15018685-15018707 TGGTGTGTGTATATGTGTGTGGG - Intronic
1177114020 21:17063868-17063890 GTGCGTATGTGTATGTGTGTTGG + Intergenic
1177127654 21:17216528-17216550 AAATGTAAGTATATGTGTGCAGG + Intergenic
1177306445 21:19323989-19324011 GTGTGAATGTGTATGTGTGTAGG - Intergenic
1177407874 21:20693731-20693753 GTGTGTGTATATATGTGTGTGGG - Intergenic
1177515180 21:22140480-22140502 ATGTTAAAATATATGTGTTTTGG - Intergenic
1177516767 21:22162178-22162200 ATATGTAAGTGTGTGTGTGTTGG - Intergenic
1177883118 21:26717780-26717802 ATGTGTGTGTGTGTGTGTGTAGG + Intergenic
1177887751 21:26766321-26766343 ATGTGTGTGTGTATGTGTGTGGG - Intergenic
1177928335 21:27248069-27248091 ATGTGTAAGTGAACTTGTGTAGG - Intergenic
1178388998 21:32183137-32183159 GTGTGTGAGTACAAGTGTGTGGG - Intergenic
1178470808 21:32891095-32891117 ATCTGTGAGCATATGTGTGATGG + Intergenic
1178607729 21:34054393-34054415 GTGTGTGTGTATGTGTGTGTAGG + Intergenic
1179191441 21:39125671-39125693 GTGTGTGAGTACATGTGTGTTGG - Intergenic
1179270783 21:39849465-39849487 GTGTGTGTGTGTATGTGTGTGGG + Intergenic
1179393209 21:41012572-41012594 GTGTGTGAGTGAATGTGTGTGGG - Intergenic
1179399023 21:41067126-41067148 GTGTGTATGTATGTGTGTGTGGG - Intergenic
1179467290 21:41584779-41584801 GGGTGTATGTATATGTGTGTGGG - Intergenic
1179504267 21:41830339-41830361 TTGTGTGTGTATTTGTGTGTGGG - Intronic
1179731280 21:43369026-43369048 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1180051340 21:45332439-45332461 GTGTGTCTGTATCTGTGTGTCGG + Intergenic
1180051342 21:45332589-45332611 GTGTGTCTGTATCTGTGTGTTGG + Intergenic
1180083171 21:45495981-45496003 ATGTGTGCATATATGTGTATTGG - Intronic
1180338238 22:11598693-11598715 GTGTGTAACTGTGTGTGTGTCGG + Intergenic
1180761569 22:18213644-18213666 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1180774098 22:18410966-18410988 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181070207 22:20329979-20330001 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181193201 22:21157916-21157938 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181216244 22:21334685-21334707 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1182302943 22:29348741-29348763 ATGTGTGTGTATGTGTGTATAGG + Intronic
1182829742 22:33295348-33295370 ATGTGTGTGTACATGCGTGTGGG + Intronic
1183062155 22:35342802-35342824 CTGTGTAGGTGTATGAGTGTAGG - Intronic
1183062267 22:35343571-35343593 GTGTGTAGGTGTATGAGTGTAGG - Intronic
1183062322 22:35343994-35344016 GTGTGTAGGTGTATGAGTGTAGG - Intronic
1183186972 22:36297647-36297669 ATGTGTAAGGACATTTGTCTAGG + Intronic
1183250679 22:36728254-36728276 ATGTGTACATATGTTTGTGTGGG + Intergenic
1183366156 22:37408143-37408165 CTGTGTATGTATAAATGTGTGGG - Intronic
1183906268 22:41042940-41042962 ATGTGTGTGTATATATATGTGGG + Intergenic
1184288446 22:43485201-43485223 ATGAGTATGAATGTGTGTGTAGG - Intronic
1184354620 22:43970646-43970668 AGGTGTTAGTAAGTGTGTGTCGG + Intronic
1184491724 22:44813734-44813756 GTGTGTATGTAGGTGTGTGTAGG - Intronic
1184491729 22:44813834-44813856 GTATGTAAGTCTAAGTGTGTAGG - Intronic
1184914942 22:47562949-47562971 GTGTGTGTGTATGTGTGTGTAGG + Intergenic
1184917467 22:47580138-47580160 ATGTGTATGTGTGTGTGTGTGGG + Intergenic
1185114993 22:48928439-48928461 ATCTGTACATATATGTGTGTAGG + Intergenic
1185189193 22:49423382-49423404 ATGTGCACGTGTGTGTGTGTTGG + Intronic
949252935 3:2009512-2009534 ATGTGTGTGTCTATGTGTGTTGG - Intergenic
949267955 3:2182289-2182311 ATATATGTGTATATGTGTGTGGG - Intronic
949407452 3:3729467-3729489 CTGTGTGTGTGTATGTGTGTGGG - Intronic
949791516 3:7797301-7797323 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
949867252 3:8556410-8556432 GTGTGTATGTGTGTGTGTGTTGG + Intronic
950313311 3:11978038-11978060 AAGTGTAAGAATCTATGTGTGGG - Intergenic
950627061 3:14255014-14255036 GTGTTGAAGTATGTGTGTGTTGG + Intergenic
950824645 3:15805000-15805022 CTACGTAAGTACATGTGTGTTGG - Intronic
951131902 3:19056610-19056632 GTGTTTGTGTATATGTGTGTGGG - Intergenic
951252938 3:20415544-20415566 ATGTGTATGTGTTTGTGTATGGG + Intergenic
951780342 3:26355873-26355895 AAGTATAAGAAGATGTGTGTAGG - Intergenic
952041482 3:29267009-29267031 ATATGTATATATATGTGTGTGGG + Intergenic
952100212 3:30002388-30002410 GTGTGTATGTGTGTGTGTGTTGG - Intronic
952150914 3:30589990-30590012 GTGTGTGTGTATGTGTGTGTGGG + Intergenic
952720542 3:36528037-36528059 ATGTATAAATGTAAGTGTGTGGG + Intronic
953004861 3:38968966-38968988 ATGTATTTGTATCTGTGTGTGGG - Intergenic
953360206 3:42289097-42289119 ATGTATATGTGTTTGTGTGTGGG - Intergenic
953645364 3:44748844-44748866 ATGTCTTAGTATCTGGGTGTGGG - Exonic
953740628 3:45535769-45535791 ATGTGTGTGTATGTGGGTGTGGG - Intronic
954042241 3:47897543-47897565 GTGTGTATGTATGTGTGTTTAGG + Intronic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
954605725 3:51907679-51907701 ATGAGTATGTGTGTGTGTGTTGG - Intergenic
954633805 3:52060732-52060754 ATGGGTAGGACTATGTGTGTTGG - Intergenic
954654507 3:52185777-52185799 ATGTGCAAGTGAGTGTGTGTGGG - Intergenic
954966620 3:54617158-54617180 ATGTGGAAGTGCATGTGTTTTGG + Intronic
954983083 3:54763877-54763899 ATATGTATATATATGTATGTGGG + Intronic
955194733 3:56794708-56794730 AAGTGTAAGAGGATGTGTGTAGG - Intronic
955227649 3:57074239-57074261 ATGTGTGTGTATGTGTGTGTTGG - Exonic
955402473 3:58602868-58602890 ATGTGTATATACATGTTTGTGGG + Intronic
955410060 3:58649487-58649509 GTGTGTATGTATGTGTGTGAAGG - Intronic
955856224 3:63276911-63276933 ATGGGTGTGTATGTGTGTGTTGG - Intronic
955904666 3:63794160-63794182 GTGTGTGTGTATGTGTGTGTAGG - Intergenic
956234341 3:67051998-67052020 ATGTGTATATATATATGTGTGGG - Intergenic
956542633 3:70359045-70359067 GTGTGAGTGTATATGTGTGTTGG - Intergenic
956585275 3:70857722-70857744 ATGTATATGTATATATATGTGGG - Intergenic
956640769 3:71413429-71413451 ATGTGTGTATATGTGTGTGTGGG - Intronic
956657243 3:71564453-71564475 ATGTGTGTGTATGTTTGTGTGGG - Intronic
956658387 3:71575440-71575462 GTGTGTATGTGTGTGTGTGTAGG - Intronic
956715158 3:72072814-72072836 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
957343811 3:78936651-78936673 ATTTGTAAGTATATGGGGGAGGG + Intronic
957615722 3:82524163-82524185 GTGCTTGAGTATATGTGTGTGGG + Intergenic
957700559 3:83705709-83705731 ATTTATATGTACATGTGTGTAGG - Intergenic
957709442 3:83835921-83835943 GTGTGTAAGGGTATCTGTGTGGG - Intergenic
957801391 3:85087795-85087817 ATGTGTAAGAATATATGAGGAGG - Intronic
957853556 3:85843878-85843900 ATGTGAGTGTATGTGTGTGTGGG + Intronic
957862931 3:85981220-85981242 GTGTGTAAATGTGTGTGTGTAGG - Intronic
958119107 3:89261907-89261929 ATGTGTGGGTGTCTGTGTGTTGG - Intronic
958506971 3:94992240-94992262 GTGTGTCTGTATATGTATGTGGG + Intergenic
958883509 3:99699796-99699818 ATGTGTATGTGTATGTGAGGTGG - Intronic
959136300 3:102426109-102426131 ATGTGTGTGTGTGTGTGTGTAGG - Intronic
959139761 3:102471551-102471573 TTGTGTGTGTGTATGTGTGTAGG - Intronic
959359971 3:105376069-105376091 GTGTGTGAGTTTGTGTGTGTTGG + Intronic
959501655 3:107113725-107113747 ATGTTTGAATATATATGTGTGGG + Intergenic
959639736 3:108619268-108619290 CTGTGTGTGTGTATGTGTGTGGG + Intronic
959707297 3:109349936-109349958 AGGAGTCAGTATATGTTTGTTGG - Intergenic
959732356 3:109618952-109618974 ATGTGTGTGCATGTGTGTGTTGG + Intergenic
959793087 3:110388221-110388243 CTGAGTGAGTATAGGTGTGTGGG - Intergenic
959805545 3:110548487-110548509 ATGTGAAGGTATATGTGTGGGGG - Intergenic
959887445 3:111519038-111519060 GTGTGTATGCATGTGTGTGTGGG - Intronic
959923399 3:111894944-111894966 GTGTGTATGTATGTATGTGTGGG + Intronic
960334312 3:116397394-116397416 ATGTGTGTGTATGTGTGTGTGGG - Intronic
960354978 3:116640478-116640500 GTGTGTAAATTAATGTGTGTAGG - Intronic
960446335 3:117753462-117753484 GTGTGTACGTATATGTGTGTCGG + Intergenic
960548571 3:118947294-118947316 TTGTGCACGTATATGTTTGTTGG - Intronic
960552430 3:118990860-118990882 AAGGGTATGTATATATGTGTAGG + Intronic
960997197 3:123348071-123348093 ATGTGTGTGTATGTGTGTGCAGG + Intronic
961034603 3:123633837-123633859 GTGTGTGCGTGTATGTGTGTGGG + Intronic
961167753 3:124775312-124775334 AAGTGTGAGTGTATGTGTGTTGG + Intronic
961707541 3:128799637-128799659 ATCTCTAGGTGTATGTGTGTAGG - Intronic
961781176 3:129320840-129320862 ATGTGTGAGTAGGTGTCTGTGGG - Intergenic
961781193 3:129321096-129321118 ATGTGTGAGGATAAATGTGTGGG - Intergenic
961793768 3:129394833-129394855 ATGTGTGTGTATGTGTGTGCAGG - Intergenic
961878685 3:130044098-130044120 ATGTGTGTGTGTGTGTGTGTTGG - Intergenic
961970149 3:130954941-130954963 ATGTGTGTGTGTATGTGTTTTGG + Intronic
962207327 3:133445739-133445761 ATATGGAAGGATGTGTGTGTAGG + Intronic
962253377 3:133853303-133853325 ATGTAGAAGTATGTGTATGTGGG + Intronic
962506753 3:136054178-136054200 AGGTGTATGTGTATGTGTGTAGG - Intronic
962817377 3:139014169-139014191 ATGTGTATGTGTGTGTGTCTGGG - Intronic
962839176 3:139218107-139218129 ATGTGTGTGTGTTTGTGTGTAGG + Intronic
963005341 3:140721881-140721903 GTGTGTATGTGTATGTGTGTTGG - Intergenic
963145919 3:141994163-141994185 TTGTGTTTGTACATGTGTGTAGG + Intronic
963595955 3:147325168-147325190 ATGTGTGTATGTATGTGTGTGGG + Intergenic
963864085 3:150341668-150341690 AAAGGAAAGTATATGTGTGTTGG + Intergenic
963937718 3:151071929-151071951 TTGTATATGTATGTGTGTGTAGG + Intergenic
963991281 3:151657981-151658003 GTGTGTATGTGTTTGTGTGTGGG + Intergenic
963999968 3:151758829-151758851 ATGAGTATGTGCATGTGTGTGGG + Intronic
964046273 3:152331183-152331205 GTGTGTATGTGTGTGTGTGTAGG - Intronic
964810884 3:160663524-160663546 GTGTGTATGTGTGTGTGTGTGGG + Intergenic
965004145 3:162995672-162995694 ATGTGTGTGTGTGTGTGTGTAGG - Intergenic
965111857 3:164435306-164435328 GTGTGTAAATATGTGTGTATGGG + Intergenic
965264508 3:166523585-166523607 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
965433487 3:168618280-168618302 ATGTGTGTGTTTATATGTGTAGG + Intergenic
965440892 3:168712698-168712720 CTCTGTAAGTGTCTGTGTGTGGG - Intergenic
965691791 3:171365083-171365105 AGATGTAAGTATATGTTTGGAGG + Intronic
965964654 3:174472437-174472459 GAGTGTGAGTGTATGTGTGTTGG + Intronic
965991587 3:174825555-174825577 ATTTCTAGGTATATGTGTGTGGG - Intronic
966265942 3:178043768-178043790 ATGTTTAAGAATATTTGTCTTGG + Intergenic
966273058 3:178131744-178131766 ATGTATATTTATAGGTGTGTGGG + Intergenic
966326085 3:178756208-178756230 ATGTGTGTGTATATATATGTGGG + Intronic
966362432 3:179145214-179145236 ACGTGTGTGTATGTGTGTGTGGG + Intergenic
966620744 3:181961358-181961380 GTGTGAATGTATGTGTGTGTGGG - Intergenic
967090993 3:186134682-186134704 CTGTGTCAGTGTATGTGTATGGG + Intronic
967185196 3:186938952-186938974 GTGTGTGTGTATGTGTGTGTAGG + Intronic
967295545 3:187960985-187961007 ATGTGTAAGAATATATGACTTGG - Intergenic
967376888 3:188814102-188814124 GTGTGTCTGTATGTGTGTGTGGG - Intronic
967415267 3:189210113-189210135 ATGTGTGTGTCTGTGTGTGTTGG + Intronic
967878980 3:194285836-194285858 GTGTGTAAGTATGTGGGTATGGG + Intergenic
967910590 3:194539464-194539486 ATGTGTAAGGCTTTGTGTGAGGG + Intergenic
1202736296 3_GL000221v1_random:2271-2293 ATGAGTAAGACTGTGTGTGTAGG + Intergenic
968933790 4:3598819-3598841 ATGTGTATGTATGTGTGGGCAGG + Intergenic
968933823 4:3599209-3599231 ATGTGTATGTATGTGTGGGCAGG + Intergenic
969061503 4:4438965-4438987 ATGTGTGGGTATACATGTGTTGG - Intronic
969061570 4:4439447-4439469 GTATGTAGATATATGTGTGTGGG - Intronic
969410886 4:7027410-7027432 CTGTGTATGTGTAGGTGTGTGGG - Intronic
969510720 4:7616276-7616298 GTGTGTATGTATATGTGAGTGGG - Intronic
969514610 4:7639440-7639462 GTGTGTGAGTGCATGTGTGTGGG + Intronic
969959652 4:10931142-10931164 ATGTGTGTGTGTATGAGTGTGGG - Intergenic
970899916 4:21146959-21146981 ATGTATATGTATATATATGTGGG + Intronic
970958567 4:21845065-21845087 ATAAGTAAGTATATGTGGGTAGG - Intronic
971083008 4:23236927-23236949 ATGTGTATATGTGTGTGTGTTGG + Intergenic
971110277 4:23577357-23577379 TTGTGTGTGTATGTGTGTGTTGG + Intergenic
971496944 4:27276604-27276626 ATGTGTAAGTCTCAGTGTGTTGG - Intergenic
971569197 4:28188157-28188179 ATATGTAAATATATATGTATTGG - Intergenic
971589810 4:28453046-28453068 TTGTGTGTGTATGTGTGTGTTGG - Intergenic
971843312 4:31883783-31883805 ATGTGAAAGTATAAGTTTATGGG - Intergenic
971964092 4:33529071-33529093 ATGTGTGAGCATGTGTCTGTGGG - Intergenic
972019790 4:34297633-34297655 TTGTGTATGTGTATGTGTGTGGG + Intergenic
972038767 4:34562039-34562061 ATATGTATATATATGTATGTGGG - Intergenic
972099977 4:35403043-35403065 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
972167698 4:36307556-36307578 ATATGAATGTGTATGTGTGTGGG + Intronic
972223313 4:36981740-36981762 ATGTTTAAGTGTATGTATGTTGG - Intergenic
972585521 4:40433974-40433996 TTGTGTGAGTGTGTGTGTGTGGG + Intronic
972711584 4:41601554-41601576 ATGTGTAAGGACATGTGTGGTGG + Intronic
972802982 4:42496809-42496831 ATATGTACGTATATATGTGTGGG - Intronic
972922810 4:43965212-43965234 GTGTGTGTGTATGTGTGTGTGGG - Intergenic
973022286 4:45218645-45218667 ATATGTAAATATATATGTGTAGG + Intergenic
973052913 4:45616659-45616681 GTGTGCATGTATGTGTGTGTGGG + Intergenic
973259290 4:48145122-48145144 ATGTGTCAGGATGTGTGTGAAGG - Exonic
974145956 4:57947792-57947814 ATGTCTAACTGTGTGTGTGTGGG - Intergenic
974659541 4:64868153-64868175 ATGTGTGTGTCTGTGTGTGTGGG + Intergenic
974702398 4:65468508-65468530 GTGTGTCTGTATATATGTGTAGG - Intronic
974756497 4:66215664-66215686 GTGTGTGTGCATATGTGTGTTGG - Intergenic
974770500 4:66405313-66405335 GTGTGTGTGTATGTGTGTGTGGG + Intergenic
974773338 4:66445292-66445314 ATGTGTGTGTATATATGAGTTGG + Intergenic
975242843 4:72081942-72081964 ATGTGTAAGAATATGGTAGTGGG - Intronic
975268547 4:72400841-72400863 ATGTGTATATATCTGTGTATTGG + Intronic
975314394 4:72934451-72934473 TTGTGTGTGTATGTGTGTGTTGG - Intergenic
976019473 4:80603417-80603439 GTGTGCATGTATATATGTGTAGG - Intronic
976130316 4:81877185-81877207 TTGTGTGTGTATATATGTGTGGG - Intronic
976715790 4:88121359-88121381 ATGTGTATGTGTGTGTCTGTTGG + Intronic
976763639 4:88576632-88576654 ATGTGTGCGTGTGTGTGTGTTGG + Intronic
976924153 4:90476040-90476062 GTGTGTATGTGTGTGTGTGTGGG + Intronic
977132967 4:93266469-93266491 CTGTGTGTGTATGTGTGTGTGGG - Intronic
977134529 4:93286671-93286693 TTGTGTATGTGTGTGTGTGTGGG + Intronic
977540173 4:98308269-98308291 GTGTGTATATATATGTGTGTGGG - Intronic
977814029 4:101392580-101392602 ATGTGTGAGTAGATATATGTGGG + Intergenic
977892206 4:102325368-102325390 ATGTGAGAGTGCATGTGTGTTGG - Intronic
978026622 4:103883758-103883780 GTGTGTGTGTATATGTGTTTTGG + Intergenic
978058622 4:104307450-104307472 ATATATATATATATGTGTGTGGG + Intergenic
978061242 4:104343030-104343052 ATGTGTGTGTTTATGTGTGTGGG + Intergenic
978202883 4:106043753-106043775 GTGTGTATGTATATCTGTGTGGG + Exonic
978292207 4:107154769-107154791 GTGTGTATGGATATATGTGTGGG - Intronic
978299586 4:107251800-107251822 CTATGAAAATATATGTGTGTGGG + Intronic
978360196 4:107923474-107923496 GTGTGTGTGTATGTGTGTGTAGG - Intergenic
978865645 4:113506898-113506920 GTGTGTAGGTGTGTGTGTGTGGG - Intronic
978996397 4:115160053-115160075 GTGTGTATATATGTGTGTGTGGG - Intergenic
979033003 4:115676388-115676410 ACATGTATGTGTATGTGTGTGGG - Intergenic
979098940 4:116590187-116590209 TTGTGTATGTATATGTGTTTAGG - Intergenic
979122107 4:116916579-116916601 CTGTGTTTGTATATGTGTTTAGG + Intergenic
979501891 4:121449908-121449930 TGGTGTAAATGTATGTGTGTTGG + Intergenic
979837902 4:125396256-125396278 ATATGTATATATGTGTGTGTAGG + Intronic
979839556 4:125421439-125421461 TTGCGTAAGTATATATCTGTTGG - Intronic
979939419 4:126741423-126741445 GTGTGTTTGTATATGTGGGTGGG - Intergenic
979991869 4:127384333-127384355 ATGTGTATGTATATGTATATAGG - Intergenic
980066350 4:128193371-128193393 GTGTGTATGTGTTTGTGTGTGGG - Intronic
980136026 4:128859188-128859210 ATGTGTGAGTGTGTGTGTATGGG + Intronic
980183510 4:129432502-129432524 ATGTGTATATATGTGTGTGGGGG - Intergenic
980319617 4:131253189-131253211 ATGTGTGTATATATGTGTATAGG - Intergenic
980474499 4:133294881-133294903 ATGTATATGTATATGTGTGTGGG + Intergenic
980481936 4:133398661-133398683 ATGTGTAAGTGTATCTCTTTGGG - Intergenic
981182103 4:141757964-141757986 ATGTGTGTGTGTATGTGTGACGG - Intergenic
981222092 4:142248664-142248686 GTGTGTATGTGTATGTGTTTAGG + Intronic
981593534 4:146392431-146392453 ATGTATGTGTATATATGTGTGGG + Intronic
981780006 4:148418317-148418339 TTGTGTGGGTATGTGTGTGTGGG - Intronic
981844207 4:149148318-149148340 GTGTGTGTGTATGTGTGTGTAGG + Intergenic
981858974 4:149331588-149331610 ATGTGTGTGTTTGTGTGTGTGGG - Intergenic
982477957 4:155876252-155876274 CTGTGTAGTTATATATGTGTTGG - Intronic
982493831 4:156065170-156065192 GTGTGTGTGTATGTGTGTGTTGG + Intergenic
982541969 4:156684176-156684198 ATGTGTCAGTATCTTTGTGATGG - Intergenic
982642933 4:157985349-157985371 TGGTGTAACTGTATGTGTGTGGG - Intergenic
982840079 4:160173456-160173478 GTGTGTTTGTGTATGTGTGTTGG + Intergenic
983117783 4:163840783-163840805 ATGAGTATGTATCTCTGTGTTGG - Intronic
983280132 4:165670321-165670343 CTGTGTGTGTATGTGTGTGTAGG + Intergenic
983420897 4:167515661-167515683 ATATTTAAATATATATGTGTTGG + Intergenic
983727335 4:170944953-170944975 ATGTAAAAATATATGAGTGTAGG - Intergenic
983745388 4:171192160-171192182 ATGTTTAGGAATATGTGTGTAGG - Intergenic
983983801 4:174032902-174032924 ATGTGTTTGTATATCTTTGTAGG - Intergenic
984128514 4:175843031-175843053 ATATGTATATATATGTATGTAGG + Intronic
984149565 4:176109801-176109823 GTGTATAAATTTATGTGTGTAGG + Intronic
984230213 4:177088143-177088165 GTGTATATGAATATGTGTGTGGG - Intergenic
984239831 4:177204879-177204901 AGCTGTAAGTTTATTTGTGTTGG - Intergenic
984376008 4:178930924-178930946 ATGTGTGTGTGTGTGTGTGTGGG - Intergenic
984400098 4:179252357-179252379 GTGTGTGTGTTTATGTGTGTTGG + Intergenic
984576619 4:181456127-181456149 ATGTGTGTGTGTGTGTGTGTAGG + Intergenic
985282639 4:188302242-188302264 ATGTGTGTGTATATATGTTTGGG - Intergenic
985368359 4:189258441-189258463 AGGTGAAACTATATGTGGGTTGG - Intergenic
985421264 4:189787237-189787259 GTGTGTGAGTGTGTGTGTGTTGG - Intergenic
985426156 4:189832615-189832637 ATGTGTATTTAAATGTGAGTAGG - Intergenic
985516072 5:345312-345334 ATGTGTGTGTGTGTGTGTGTGGG + Intronic
985833777 5:2255885-2255907 ATGTGTATGTGCATGTGTGTGGG + Intergenic
985874158 5:2582710-2582732 TTGTGTGTGTACATGTGTGTGGG - Intergenic
985982629 5:3484471-3484493 ATGTGTGTGTATTTGTGTATAGG - Intergenic
986153648 5:5151714-5151736 GTGTGTGTGTGTATGTGTGTGGG + Intronic
986291175 5:6400390-6400412 ATCTGTGAATATGTGTGTGTAGG + Intergenic
986415648 5:7525627-7525649 ATGTAGATGTAAATGTGTGTGGG - Intronic
986943724 5:12989045-12989067 ATGTGTGTGTGTGTGTGTGTTGG + Intergenic
986974409 5:13379081-13379103 GTGTGTACATATATGTGTGTGGG + Intergenic
987006286 5:13713344-13713366 ATATGTCAGTATATATATGTCGG - Intronic
987035223 5:14012441-14012463 ATGTGAAAGTTTATGTTTTTAGG + Intergenic
987092857 5:14523046-14523068 AGATGTATGTATCTGTGTGTTGG - Intronic
987468635 5:18303298-18303320 GTGTGTGTGTGTATGTGTGTGGG - Intergenic
987542044 5:19268780-19268802 GTGTGTATGTATCTGTGTGTGGG - Intergenic
987742959 5:21934113-21934135 GTGTGTGAGTGTGTGTGTGTGGG - Intronic
987761288 5:22165473-22165495 ATGTGTATGTGTATGTGTGTTGG - Intronic
987953626 5:24708108-24708130 GTGTGTATGTATATGTATTTAGG + Intergenic
987973887 5:24986613-24986635 ATATGTAAATATATATATGTAGG + Intergenic
988083392 5:26441815-26441837 GTGTGTATGTGTATCTGTGTGGG - Intergenic
988105860 5:26746163-26746185 GTATATAAGTATATATGTGTGGG + Intergenic
988123337 5:26996099-26996121 TTCTGTAAGTGTATATGTGTAGG - Intronic
988163792 5:27556387-27556409 ATGTGTATGTGTATGTATCTGGG + Intergenic
988207265 5:28155577-28155599 ATGTTTATGTATATGTGTTGTGG + Intergenic
988220785 5:28344525-28344547 GTGTGTATATATGTGTGTGTGGG - Intergenic
988468798 5:31516498-31516520 GTATGTATATATATGTGTGTAGG + Intronic
988700740 5:33672128-33672150 ATGTGTGTGTGTATGTATGTGGG - Intronic
988726693 5:33933576-33933598 ATGTGGACATATTTGTGTGTGGG + Intergenic
988976751 5:36523719-36523741 GTGTGCATGTGTATGTGTGTTGG + Intergenic
988988132 5:36640974-36640996 GTGTGTATGTGTGTGTGTGTTGG - Intronic
989078415 5:37589239-37589261 GTGTGTGTGTGTATGTGTGTAGG - Intronic
989310730 5:40014301-40014323 CTGTGTGTGTGTATGTGTGTGGG - Intergenic
989776695 5:45217170-45217192 ATATATATATATATGTGTGTAGG + Intergenic
990327566 5:54693532-54693554 ATGTGTCTTTATATGTGTATGGG - Intergenic
990425432 5:55683574-55683596 GTGTGTACATATATGTGTCTAGG - Intronic
990436201 5:55794601-55794623 ATGGGAAAGTATTTGTATGTTGG + Intronic
990518391 5:56552526-56552548 AAGACTAATTATATGTGTGTTGG - Intronic
990972819 5:61528367-61528389 ATGTGTATGTATATATGGATGGG - Intronic
991213630 5:64135403-64135425 TTGTATATGTATATGTGTGTAGG - Intergenic
991393069 5:66170459-66170481 ATGTATATGTAAATGTCTGTAGG + Intronic
991395659 5:66202519-66202541 ATGTGTATGTGCACGTGTGTGGG - Intergenic
991896079 5:71398927-71398949 ATGTGTATGTGTATGTGTGTTGG - Intergenic
991944127 5:71883242-71883264 ATGTGGACATATATGTGTGCAGG + Intergenic
992130914 5:73692267-73692289 ATGTGTGAGACTGTGTGTGTGGG + Intronic
992225293 5:74614484-74614506 GTGTGTGTGTATTTGTGTGTGGG - Intergenic
992357231 5:75998656-75998678 GTGTGAATGTGTATGTGTGTGGG + Intergenic
992389503 5:76317440-76317462 GTGTGTATGTGTGTGTGTGTTGG - Intronic
992773685 5:80071643-80071665 GTGTGTGTGTATGTGTGTGTTGG - Intronic
992989092 5:82265302-82265324 ATGTGTATCTGTATGTGTATTGG - Intronic
993037866 5:82776960-82776982 ATGTGTATGTATATGCGAGTGGG - Intergenic
993140061 5:84020618-84020640 GTGTGTATGTGTGTGTGTGTCGG - Intronic
993206265 5:84883484-84883506 GTGTGTATGTATGTGTGTGTTGG + Intergenic
993425591 5:87760395-87760417 ATTTGTAGGTCTGTGTGTGTCGG + Intergenic
993547947 5:89236057-89236079 GTGTGTATGTGTATGTGTGTGGG + Intergenic
993595850 5:89854166-89854188 ATGTGGAAGGATATGAGTGACGG - Intergenic
993651916 5:90532003-90532025 GTGTATGTGTATATGTGTGTCGG - Intronic
993818815 5:92588255-92588277 GTGTTTATGTATATGTGTGTGGG + Intergenic
993831142 5:92759597-92759619 TTGTGTGTGTATATGTGTGTTGG + Intergenic
993957439 5:94252429-94252451 ACATGTACATATATGTGTGTGGG + Intronic
994035681 5:95197638-95197660 ATGTGTATATATATGTGATTTGG - Intronic
994045953 5:95309628-95309650 ATCTGTAACCAAATGTGTGTGGG - Intergenic
994082010 5:95717399-95717421 ATATGTGTGCATATGTGTGTGGG + Intronic
994458121 5:100040036-100040058 ATGTGTGAGTGTGTCTGTGTGGG + Intergenic
994548052 5:101193968-101193990 GTGTGTGTGTATATGTATGTAGG - Intergenic
994562037 5:101387113-101387135 ATGTGGAAAAATATGTGTGCAGG + Intergenic
994781127 5:104091675-104091697 ATGTATACATATATGTGTATAGG + Intergenic
994888401 5:105597326-105597348 ATGTATATGTATATGTATGATGG + Intergenic
995114098 5:108459528-108459550 GTGTGTATATATGTGTGTGTGGG - Intergenic
995232257 5:109780538-109780560 GTGTGTGTGTGTATGTGTGTAGG + Intronic
995256671 5:110054586-110054608 TTGGGTAAGTTTATTTGTGTGGG + Intergenic
995397228 5:111699780-111699802 ATGTGTATGTATATGTTTGTGGG + Intronic
995416162 5:111915671-111915693 ATGTGTAGGTGCATGTGTGAGGG - Intronic
996242172 5:121217086-121217108 ATGTGTATGTATGTTTGTGTAGG - Intergenic
996300266 5:121973596-121973618 ATGTGTGTGCATGTGTGTGTGGG + Intronic
996313675 5:122137141-122137163 ATGTGTATGTGCATGTGTATGGG + Intronic
996313680 5:122137173-122137195 GTGTGTAAGTGTGTGTGTTTGGG + Intronic
996352166 5:122556691-122556713 GTGTGTGAGTGTGTGTGTGTAGG - Intergenic
996570421 5:124927882-124927904 AGATGAAAGTATATGTGTGTGGG + Intergenic
996981475 5:129501006-129501028 TTGTATATGTATCTGTGTGTGGG - Intronic
996985030 5:129549775-129549797 ATATGTATGTGTGTGTGTGTTGG - Intronic
997018280 5:129963874-129963896 ATGTGTATGTGTATATGTGTAGG + Intronic
997085836 5:130797454-130797476 GTGTGTATGTGTATGTGTATTGG - Intergenic
998363944 5:141616536-141616558 CTGTGTATGTATACGTGGGTGGG - Intronic
998464758 5:142334610-142334632 GTGTGTAAGTATTTGTGTTAGGG + Intergenic
998574801 5:143303227-143303249 ATGTGTGTGTGTATGTGGGTGGG + Intronic
998682022 5:144478915-144478937 ATGTGTATGTGTATGTGTATGGG + Exonic
998728778 5:145049793-145049815 GTGTGTATATATATGTGTGTGGG + Intergenic
998801786 5:145876234-145876256 ATGTGTGTGTTTGTGTGTGTGGG - Intergenic
998893065 5:146767523-146767545 GTGTGTATGTATGTGTGTATTGG - Intronic
999030891 5:148289933-148289955 GTGTATATGTGTATGTGTGTTGG - Intergenic
999050532 5:148519504-148519526 ATGTGTAGGTTTATATGTGTGGG + Intronic
999072561 5:148761636-148761658 ATGTGTATGTATATATGTACAGG + Intergenic
999414706 5:151384966-151384988 GTGTGTATGTGTGTGTGTGTGGG + Intergenic
999439160 5:151588117-151588139 GTGTGTGTGTATGTGTGTGTGGG + Intergenic
999819560 5:155212534-155212556 ATGTATGTGTATGTGTGTGTAGG + Intergenic
999826481 5:155278270-155278292 TTGTGTATGCATGTGTGTGTGGG - Intergenic
1000367380 5:160504414-160504436 CTGTGTGTGTATGTGTGTGTGGG + Intergenic
1000367496 5:160505191-160505213 ATGTGTGTGTATGTGTGTGTGGG + Intergenic
1000367632 5:160505946-160505968 ATGTGTGTGTGTATGTGTGGGGG - Intergenic
1000393199 5:160746731-160746753 ATATGTAAGCATATTAGTGTGGG + Intronic
1000570419 5:162906080-162906102 ACATGTAGGTATATATGTGTGGG + Intergenic
1000772522 5:165373459-165373481 ATGTTTTAGAATATGTCTGTGGG - Intergenic
1000799232 5:165703862-165703884 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
1000872078 5:166589113-166589135 ATGTGTATGTATGGGTGTGCTGG - Intergenic
1000875436 5:166632174-166632196 ATGTGGGAGTAAATGTGTGGAGG - Intergenic
1001001648 5:168013101-168013123 ATGTGTGTGTAAGTGTGTGTTGG - Intronic
1001120422 5:168975460-168975482 ATGTGGATGTCTGTGTGTGTGGG - Intronic
1001226444 5:169948507-169948529 ATGTGTTTCTATGTGTGTGTAGG - Intronic
1001428843 5:171643888-171643910 GTGTGTATGTGTGTGTGTGTAGG + Intergenic
1001537763 5:172510162-172510184 GTGTGTATGTTTGTGTGTGTGGG + Intergenic
1001550185 5:172597056-172597078 ATGTATGTGTGTATGTGTGTGGG - Intergenic
1001714919 5:173807449-173807471 ATGTGTGTGTATGTGTGTTTGGG - Intergenic
1003516246 6:6821307-6821329 ATGTGTAGGGGTGTGTGTGTGGG - Intergenic
1003603309 6:7538647-7538669 GTGTGTATGTGCATGTGTGTGGG + Intergenic
1003740289 6:8929453-8929475 TTGTGTATGTGTATGTGTGGAGG - Intergenic
1003749035 6:9035553-9035575 TGGTGTATGTGTATGTGTGTGGG - Intergenic
1003759623 6:9162073-9162095 ATGTGGAAGCATATGTGTGCAGG + Intergenic
1003790072 6:9536324-9536346 GTGTGCATGTGTATGTGTGTGGG + Intergenic
1003893902 6:10588851-10588873 GTGTGTATGTGTATGTGTGTGGG + Intronic
1004097847 6:12577108-12577130 ATGTGTTTGTGTATGTGTATGGG + Intergenic
1004194473 6:13490695-13490717 GTGTGTATGTGTGTGTGTGTTGG - Intergenic
1004212142 6:13659241-13659263 GTGTGTATGTGTGTGTGTGTGGG - Intronic
1004239209 6:13903353-13903375 ATGTGTGTGTGTGTGTGTGTAGG + Intergenic
1004524867 6:16397777-16397799 AAATGTAATTGTATGTGTGTTGG + Intronic
1004830337 6:19470552-19470574 ATGTGTGTGTATGTGTGAGTCGG - Intergenic
1005058019 6:21748357-21748379 ATGAGTGAGTATGTGTGGGTGGG - Intergenic
1005199256 6:23324707-23324729 GTGTGTGTGTATGTGTGTGTTGG - Intergenic
1005217531 6:23548646-23548668 GTGTATATGTATGTGTGTGTGGG + Intergenic
1005282108 6:24285037-24285059 GTGTGCATGTATGTGTGTGTGGG - Intronic
1005511307 6:26513945-26513967 ATGTGTATGTATTTGGGAGTGGG - Intergenic
1005735862 6:28745380-28745402 GTGTGTATGTGTGTGTGTGTTGG + Intergenic
1006464641 6:34185340-34185362 TTGTGCATGTGTATGTGTGTGGG - Intergenic
1007168403 6:39845015-39845037 TGGTGTATGTATATGTGTGGGGG - Intronic
1007362847 6:41371267-41371289 GTGTGTATGTGTGTGTGTGTGGG - Intergenic
1007384262 6:41510049-41510071 ATGTGTGTGTACGTGTGTGTTGG - Intergenic
1007724977 6:43910363-43910385 CTGTGTTAATATATGTTTGTGGG - Intergenic
1007799493 6:44379995-44380017 ATGAGTATGTCTACGTGTGTGGG + Intergenic
1008034534 6:46732356-46732378 GTGTGTGTGTATGTGTGTGTTGG - Intronic
1008225587 6:48911237-48911259 ATGTGTATGTATGCATGTGTGGG + Intergenic
1008426734 6:51367208-51367230 GTGTGTATGAATGTGTGTGTAGG + Intergenic
1008488919 6:52065099-52065121 ATATATATGTATATGTGTGTGGG + Intronic
1008618754 6:53251228-53251250 TTGTGTAAGTGTGTGTGTATGGG + Intergenic
1008668403 6:53741391-53741413 ATGGGAGTGTATATGTGTGTTGG - Intergenic
1008698176 6:54066477-54066499 ATGTGTGTGTGTCTGTGTGTCGG + Intronic
1008783086 6:55130794-55130816 ATTTCTGTGTATATGTGTGTTGG - Intronic
1008802461 6:55386480-55386502 TTTTGTAAGTATATGTGTATAGG + Intronic
1008883595 6:56408451-56408473 AGGTGTGTGTATGTGTGTGTGGG - Intergenic
1009290500 6:61875152-61875174 ATGTGTGAGTTCGTGTGTGTGGG + Intronic
1009379944 6:63014892-63014914 GTGTGTGAGTATGTGTGTGGAGG - Intergenic
1009474161 6:64067081-64067103 ATATGTAAATATTTGTATGTGGG - Intronic
1009513067 6:64577485-64577507 GTGTGTGAGTGTGTGTGTGTAGG - Intronic
1009791020 6:68401191-68401213 GTGTGTGTGTATGTGTGTGTTGG - Intergenic
1009840443 6:69066153-69066175 ATGTGGATGTATATGTGTGAAGG - Intronic
1010042194 6:71397921-71397943 ATGTATGGGTATATGTGTTTGGG + Intergenic
1010056612 6:71572830-71572852 ATATATATGTATATGTGTGTGGG - Intergenic
1010094020 6:72018388-72018410 ATGTGTTTGTGTGTGTGTGTTGG + Intronic
1010767369 6:79791466-79791488 AAATGGAAGTATATGTCTGTAGG + Intergenic
1010923185 6:81710135-81710157 GTGTGTATATATATGTGTGTGGG + Intronic
1010972400 6:82276829-82276851 GTGTGTATGTGTGTGTGTGTAGG + Intergenic
1012036547 6:94148769-94148791 GTGTATAAGTATATGTGTCAAGG - Intergenic
1012136985 6:95570602-95570624 CAGTGTAAGAGTATGTGTGTGGG - Intergenic
1012272154 6:97226699-97226721 GTGTGTATATATATGTATGTAGG + Intronic
1012359408 6:98358737-98358759 GTGTGTATGTGTGTGTGTGTGGG + Intergenic
1012433466 6:99190319-99190341 GTGTGTGAGTATGTGTGCGTGGG - Intergenic
1012614983 6:101266574-101266596 ATGTGTGTGTTTGTGTGTGTGGG + Intergenic
1012769201 6:103407110-103407132 ATATGTAACTATATGAATGTGGG - Intergenic
1013393184 6:109707309-109707331 ATGTGTATATATATATGTATAGG + Intronic
1013486912 6:110606077-110606099 ATGTGTGTGTATGTGTGTCTGGG - Intergenic
1013501529 6:110756697-110756719 ATGTGTATATATATGTTTCTTGG + Intronic
1013863944 6:114671599-114671621 ATGTATATGTATATATGTATAGG - Intergenic
1013895296 6:115080905-115080927 GTGTGTGTATATATGTGTGTAGG - Intergenic
1013895299 6:115080945-115080967 GTGTGTGTGTATATGTATGTAGG - Intergenic
1013895305 6:115080999-115081021 GTGTGTGTATATATGTGTGTGGG - Intergenic
1013895378 6:115081740-115081762 GTGTGTGTATATATGTGTGTAGG + Intergenic
1013914334 6:115316662-115316684 ATGTGTACATACATGTATGTGGG + Intergenic
1013921124 6:115405030-115405052 ATGTGTAAATATAAATGTATGGG - Intergenic
1013939372 6:115643748-115643770 ATGTGTGTGTTTCTGTGTGTGGG + Intergenic
1014032531 6:116722178-116722200 ATGTGTTAGCAGACGTGTGTTGG + Exonic
1014139434 6:117924022-117924044 ATGTGTACCTATGTGTGTATAGG - Intronic
1014499480 6:122167487-122167509 CTATGTGTGTATATGTGTGTTGG + Intergenic
1014597660 6:123365540-123365562 GTGTGTAAGGGTATGTGTGCAGG + Intronic
1014783567 6:125592063-125592085 ATGGGTAAGGATATGATTGTGGG - Intergenic
1014796093 6:125726014-125726036 GTATGTATGTATGTGTGTGTAGG - Intergenic
1014975149 6:127871284-127871306 ATGTGTATGTGTATGTATATAGG - Intronic
1015044093 6:128758771-128758793 ATATATATGTATATGGGTGTGGG + Intergenic
1015084376 6:129271067-129271089 ATGGGTATGTGTCTGTGTGTAGG - Intronic
1015295167 6:131582834-131582856 GTATATAAATATATGTGTGTGGG - Intronic
1015534572 6:134254706-134254728 GAGTGTGAGTATATATGTGTGGG - Intronic
1015612833 6:135044378-135044400 TTGTGTATGTATGTATGTGTAGG + Intronic
1016474849 6:144416053-144416075 ATGTGTGTGTGTGTGTGTGTGGG + Intronic
1016653269 6:146487420-146487442 GTGTGTATGTATCTGTGTTTGGG + Intergenic
1016764718 6:147779156-147779178 ATGTGTGTGTGTATATGTGTAGG - Intergenic
1016772314 6:147865240-147865262 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
1017048988 6:150372748-150372770 ATGTGTATGTGTGTGTGGGTGGG + Intronic
1017239604 6:152152392-152152414 GTGTGTCTATATATGTGTGTTGG - Intronic
1017769022 6:157630776-157630798 CTGTGTAAGGGTATGTGTGTGGG - Intronic
1018638525 6:165885825-165885847 ATGTGTATGCATATGTGTGTTGG + Intronic
1018698518 6:166409145-166409167 GTGTGTATGTACATATGTGTAGG - Intergenic
1018850210 6:167582289-167582311 GTGTGTATATATATATGTGTGGG + Intergenic
1018941552 6:168311499-168311521 TTGTGTGTGTGTATGTGTGTGGG - Intronic
1019011382 6:168846330-168846352 ATGTATAAGTCTACGTGTGAAGG + Intergenic
1019075052 6:169380233-169380255 ATGTGTATGTATGTGTGTATGGG + Intergenic
1019433708 7:1011266-1011288 ATGTGTGGGTATCTGGGTGTGGG - Intronic
1019553915 7:1619308-1619330 GTGTGTAGGTGTATGTGTGTCGG + Intergenic
1019553920 7:1619344-1619366 GTGTGTAGGTGTGTGTGTGTAGG + Intergenic
1020557301 7:9686455-9686477 ATGTGTATGTATGTGTGTGTGGG + Intergenic
1020729259 7:11860996-11861018 ATGTGTGAGTATATGTGTGTAGG - Intergenic
1021219329 7:17957515-17957537 ATGTGTGTGTATGTGTGTGTGGG + Intergenic
1021266010 7:18523618-18523640 ATGTATATGTGTGTGTGTGTTGG + Intronic
1021287982 7:18805937-18805959 ATGTGTACATCTCTGTGTGTTGG - Intronic
1021299441 7:18954708-18954730 ATGTGTATGTATGTGTGTGAAGG - Intronic
1021416391 7:20390967-20390989 ATGTGTATATATATGTTTATAGG + Intronic
1021684002 7:23163923-23163945 ATGGGACGGTATATGTGTGTGGG - Intronic
1021686843 7:23194291-23194313 ATGTATACGTATATATGTATAGG - Intronic
1021896405 7:25240085-25240107 GTGTGTGTGTGTATGTGTGTGGG + Intergenic
1022150587 7:27599826-27599848 AATTGTAAGTAAATGTTTGTTGG + Intronic
1022417957 7:30194469-30194491 ATGTGTTTGTACAGGTGTGTAGG + Intergenic
1022579472 7:31535488-31535510 ATTTGTATATATGTGTGTGTGGG + Intronic
1022819260 7:33942925-33942947 TTGTGTAAGTAAATGGGAGTGGG + Intronic
1022941289 7:35242567-35242589 ATGTGTACGTATGGGTGGGTGGG - Intronic
1023177343 7:37447644-37447666 GTGTGTGAGTGTGTGTGTGTGGG - Intronic
1023286635 7:38627716-38627738 ATGTATAAGAATATGTATATAGG + Intronic
1023296686 7:38722206-38722228 GTGTGTATACATATGTGTGTGGG - Intergenic
1023354726 7:39355416-39355438 TTTTGTATGTATATATGTGTTGG + Intronic
1023454968 7:40328765-40328787 GTGTGTATGTGTATGTGTTTTGG + Intronic
1023663901 7:42499854-42499876 ATTTGTTTGTATGTGTGTGTTGG - Intergenic
1023740901 7:43279754-43279776 ATTTGTAAGTATATTTTTATTGG + Intronic
1023761760 7:43470726-43470748 GTGTGTGAGCATGTGTGTGTAGG - Intronic
1023810700 7:43909193-43909215 GTGTGTTTGTGTATGTGTGTAGG - Intronic
1024473678 7:49788927-49788949 ATGTGTGAGAATATGAGTGTGGG + Intronic
1024659269 7:51477633-51477655 ATGTGTGTGTATGTGTGTGTGGG + Intergenic
1024872855 7:53985721-53985743 GTGTGTATGTATAAGTGTGCGGG - Intergenic
1024987025 7:55203286-55203308 GTGTATATGTGTATGTGTGTGGG - Intronic
1025236600 7:57238973-57238995 ATGTGTGAGTGTAGGTGTGTTGG - Intergenic
1025958804 7:66203168-66203190 GTGTGTGTATATATGTGTGTGGG - Intergenic
1026010762 7:66634047-66634069 ATGTGTACATCTGTGTGTGTGGG - Intronic
1026014554 7:66662791-66662813 GTGTGCAGGTGTATGTGTGTAGG + Intronic
1026231824 7:68490507-68490529 ATTAGTATGCATATGTGTGTGGG - Intergenic
1026413078 7:70146953-70146975 ATGTGTACATATATGTAGGTAGG + Intronic
1026432582 7:70361872-70361894 ATGTATATGTATATGTATATAGG + Intronic
1026567071 7:71497997-71498019 ATGTGTATGCACATGCGTGTGGG + Intronic
1026636983 7:72092443-72092465 GTGTGTATATATGTGTGTGTGGG - Intronic
1026654060 7:72241392-72241414 TTGTTTAAGTAAATGTGTGGGGG - Intronic
1026909952 7:74085654-74085676 AGGTGTAGGTATATGTGGGGTGG + Intronic
1027433419 7:78137822-78137844 GTGTGTGTGTTTATGTGTGTAGG - Intronic
1027543465 7:79497345-79497367 ATGTGTGTGTGTGTGTGTGTGGG + Intergenic
1027587576 7:80077036-80077058 GTGTGTATGTGTGTGTGTGTCGG + Intergenic
1027758376 7:82246544-82246566 ATCTGTGAGTGTATGAGTGTAGG + Intronic
1028440243 7:90851349-90851371 GTGTGTATGAATGTGTGTGTGGG + Intronic
1028503359 7:91543720-91543742 TTGTGTATGTATATATGTATTGG + Intergenic
1029019867 7:97353245-97353267 ATGTATGTGTATGTGTGTGTTGG - Intergenic
1029311573 7:99671908-99671930 TTGTGTGTGTTTATGTGTGTGGG - Intronic
1029453962 7:100657961-100657983 ATGTATGTGTCTATGTGTGTTGG + Intergenic
1029484935 7:100834529-100834551 ATGTGTGAGTGTGTGTGTGTTGG + Intronic
1029842534 7:103381565-103381587 GTGTGTGTGTATATGTATGTAGG - Intronic
1029965602 7:104736506-104736528 ATGTGTGTGTGTGTGTGTGTGGG - Intronic
1029987193 7:104933313-104933335 ATGTGTATGTACGTGTGCGTAGG - Intergenic
1030156633 7:106461909-106461931 ATTAATAAGTATGTGTGTGTGGG + Intergenic
1030371648 7:108706804-108706826 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
1030618054 7:111759072-111759094 GTGTGTGTGTATGTGTGTGTAGG + Intronic
1031014763 7:116561279-116561301 ATGTGTTTGTATGTGTTTGTGGG + Intergenic
1031247568 7:119336085-119336107 GTGTGTGTGTATATGTGTGCTGG - Intergenic
1031366920 7:120912613-120912635 GTGTGTATGTGTGTGTGTGTTGG - Intergenic
1031502107 7:122531535-122531557 ATCTGTAAGTATATTAGTATAGG - Intronic
1031814741 7:126419905-126419927 CTGTGTGTGTCTATGTGTGTGGG - Intergenic
1032023372 7:128422208-128422230 GTGTGTGTGTATGTGTGTGTGGG + Intergenic
1032023377 7:128422278-128422300 ATGTGTGTGTAAGTGTGTGTAGG + Intergenic
1032791310 7:135245172-135245194 ATATGTATGTGTGTGTGTGTAGG - Intronic
1032829118 7:135604573-135604595 AAGAGTAAGTATATTTGTATAGG + Intronic
1032841250 7:135715241-135715263 ATGTGTATGTGTATGAGTGTGGG + Intronic
1032863446 7:135903343-135903365 ATTTGAAAGTATATGTGGGGTGG + Intergenic
1033113967 7:138608959-138608981 ATGTGTGTATATATATGTGTGGG - Intronic
1033198317 7:139346402-139346424 ATGTATAATTGTATATGTGTAGG - Intronic
1033458711 7:141525945-141525967 GTGTGTGTGTATATATGTGTGGG - Intergenic
1033593034 7:142830270-142830292 ATCTGTGTGTATGTGTGTGTGGG - Intergenic
1033638044 7:143230702-143230724 ATGTGTGTGAATGTGTGTGTTGG - Intergenic
1033638053 7:143230915-143230937 GTGTGTATGTGAATGTGTGTTGG - Intergenic
1033638060 7:143231046-143231068 GTGTGTATGAATGTGTGTGTTGG - Intergenic
1034480125 7:151313508-151313530 ATGTGTGAGTTCGTGTGTGTGGG + Intergenic
1034526872 7:151670173-151670195 ATATGTGAGTGCATGTGTGTGGG - Intronic
1034709145 7:153175547-153175569 GTGTGTGTGTATGTGTGTGTGGG + Intergenic
1034805642 7:154086944-154086966 ATGTGTAATGTTATATGTGTGGG - Intronic
1034827252 7:154276918-154276940 ATGGAGAAGAATATGTGTGTTGG - Intronic
1034858246 7:154574188-154574210 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1034858286 7:154574701-154574723 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1034937176 7:155207805-155207827 GTGTGTGAGTGTGTGTGTGTGGG + Intergenic
1035226156 7:157433679-157433701 ATGTGTGAGTATGTGTGGGTGGG - Intergenic
1035283137 7:157789668-157789690 ATGTGTGCATGTATGTGTGTGGG + Intronic
1035288311 7:157820500-157820522 ATGTGTAAGAATGCGTGTGTTGG - Intronic
1035288316 7:157820592-157820614 ATGTGTAAGAATGCGTGTGTGGG - Intronic
1035336459 7:158131730-158131752 ATGTGTGTGTATGAGTGTGTTGG - Intronic
1035336477 7:158132120-158132142 ACGTGTGTGTGTATGTGTGTTGG - Intronic
1035758514 8:2051980-2052002 ATGTGTGCATATATGTGTGTAGG + Intronic
1035877378 8:3206226-3206248 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1035877400 8:3206379-3206401 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1035877407 8:3206441-3206463 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1035877416 8:3206523-3206545 GTGTGTATGTATGTGTGTGTGGG + Intronic
1035877424 8:3206604-3206626 ATGTGTGTGTATGTGTGTGTGGG + Intronic
1035877429 8:3206640-3206662 GTGTGTGGGTGTATGTGTGTGGG + Intronic
1035920534 8:3670937-3670959 ATGTATGGGTATATGTGTATGGG + Intronic
1036086485 8:5618278-5618300 GTGTGTGAGCATGTGTGTGTGGG + Intergenic
1036097179 8:5737217-5737239 ATATGTATGCATGTGTGTGTGGG - Intergenic
1036141222 8:6210616-6210638 ATATATATGTATACGTGTGTGGG - Intergenic
1036652371 8:10653457-10653479 ATGTGTGTGTGTGTGTGTGTTGG - Intronic
1036705288 8:11041864-11041886 ATGTGTGTGTGTATATGTGTTGG - Intronic
1037119679 8:15267502-15267524 TTGTGTTAGTATCTGTGCGTTGG - Intergenic
1037133407 8:15433559-15433581 ATGTGTGTGTATACGTGTGAAGG - Intronic
1037174824 8:15934686-15934708 ATGTTTAAATATATGAATGTAGG + Intergenic
1037186965 8:16076320-16076342 ATGTGTATGTATATTTTTATTGG + Intergenic
1037431855 8:18821840-18821862 ATGTGTGTGCATGTGTGTGTGGG - Intronic
1037579787 8:20237724-20237746 ATGTGTGTGTATATCTGTATAGG - Intergenic
1037611873 8:20482742-20482764 ATGTGTGTGTATTTGTGGGTAGG + Intergenic
1037611878 8:20482802-20482824 GTGTGTATTTATGTGTGTGTAGG + Intergenic
1037740569 8:21605762-21605784 ATGTGTATGTGTGTGGGTGTGGG - Intergenic
1037740571 8:21605768-21605790 AAGAGTATGTGTATGTGTGTGGG - Intergenic
1038088496 8:24227365-24227387 ATGTATATGTATATGTATATGGG + Intergenic
1038126358 8:24677550-24677572 CTGTGTATGTGTTTGTGTGTTGG - Intergenic
1038333656 8:26629307-26629329 ATGTGTATGTGTGTGTGTGTAGG - Intronic
1038688170 8:29737560-29737582 GTGTGTGTGTATGTGTGTGTTGG - Intergenic
1038930932 8:32192835-32192857 GTGTGTGAGTTTATGTGTGTAGG - Intronic
1039185649 8:34913122-34913144 ATGTGTAGATAGATGTGTGGTGG + Intergenic
1039197745 8:35051026-35051048 ATGTATATGTGTGTGTGTGTGGG + Intergenic
1039235280 8:35496219-35496241 ATAGGTAAGTATCTGTGAGTAGG + Intronic
1039442394 8:37604214-37604236 ATGTGTGTGTGCATGTGTGTTGG - Intergenic
1039457460 8:37717036-37717058 TTGGTTAAGTATTTGTGTGTGGG + Intergenic
1039674484 8:39646525-39646547 GTGTGTATGTGTATTTGTGTTGG + Intronic
1039732458 8:40294546-40294568 ATATGTGTGTATGTGTGTGTGGG + Intergenic
1039784451 8:40820789-40820811 CTGTGTGTGTATATATGTGTGGG + Intronic
1039784464 8:40821039-40821061 ATGTGTGGGTGTGTGTGTGTTGG + Intronic
1039902219 8:41761334-41761356 ATGTGCATGTGTATGTGTGCAGG - Intronic
1040625830 8:49149110-49149132 GTGTGTAGGTGTGTGTGTGTTGG + Intergenic
1040713695 8:50221500-50221522 GTGTGTGTGTATGTGTGTGTTGG - Intronic
1040844286 8:51820930-51820952 ATGTGTGTGTGTCTGTGTGTTGG + Intronic
1041159879 8:55028943-55028965 ATGTGTGTGTATGTGTGTATGGG - Intergenic
1041256112 8:55980809-55980831 ATGTCTAAGTTTATGGTTGTTGG + Intronic
1041380506 8:57249733-57249755 ATGTGTGGGTGTATGAGTGTGGG + Intergenic
1041904335 8:63014877-63014899 GTGTGTAGGTATGTGTGTATAGG - Intergenic
1042070901 8:64931977-64931999 ATGTGTGTGTGTGTGTGTGTGGG - Intergenic
1042504815 8:69548921-69548943 TTGTGTGTGTGTATGTGTGTGGG - Intronic
1042642237 8:70949588-70949610 GTGTGTATGTGTGTGTGTGTTGG + Intergenic
1042714251 8:71755322-71755344 ATGTGTTGGTGTATGTGTGTGGG + Intergenic
1042844844 8:73159569-73159591 GTGTGTGAGCATGTGTGTGTAGG - Intergenic
1042881426 8:73495897-73495919 GTGTGTACATATATGTGTGCGGG - Intronic
1042882777 8:73512641-73512663 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1042921082 8:73920438-73920460 TTGTGTGTGTATATGTGTTTAGG - Intergenic
1043219235 8:77637554-77637576 ATGTGTATATATATGTATATGGG + Intergenic
1043236394 8:77873402-77873424 ATGTGTGTGTGTATGTGGGTAGG - Intergenic
1043244888 8:77985389-77985411 GTGTATATATATATGTGTGTGGG - Intergenic
1043389263 8:79776369-79776391 GTGTGTATGCACATGTGTGTGGG - Intergenic
1043771691 8:84209823-84209845 ATGTGTATGTGTACATGTGTGGG + Intronic
1043890679 8:85649612-85649634 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1043893809 8:85720891-85720913 GTGTGTATGTATGTGTGTGAGGG - Intergenic
1043896489 8:85742340-85742362 GTGTGTATGTATGTGTGTGAGGG - Intergenic
1043898513 8:85757835-85757857 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1043900125 8:85770029-85770051 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1043902087 8:85785304-85785326 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1043905308 8:85809691-85809713 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1043906918 8:85821878-85821900 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1044087876 8:87963515-87963537 ATGTGTAAGTATATATGTCTAGG + Intergenic
1044113207 8:88302618-88302640 ATAGGTATGCATATGTGTGTAGG + Intronic
1044172414 8:89071625-89071647 ATTTGTAATTATTTTTGTGTAGG + Intergenic
1044796642 8:95907307-95907329 ATATGTATGTATATGTGTGTAGG - Intergenic
1044886196 8:96780883-96780905 ATGTATATGTATGTGTGTGTCGG + Intronic
1044914593 8:97098905-97098927 GTGTTTATGTATGTGTGTGTGGG - Intronic
1045325409 8:101114201-101114223 ATGTGTGCCTATGTGTGTGTTGG + Intergenic
1045352905 8:101358823-101358845 ATGTGTGTGTATTTGTGTGTTGG - Intergenic
1045471803 8:102519233-102519255 GTGTGTGTGTATGTGTGTGTTGG + Intergenic
1045684053 8:104692826-104692848 GTGTGTGTGTATATGTGTGGGGG - Intronic
1045744677 8:105404658-105404680 AAGTGTATGTGTATGTATGTTGG - Intronic
1045768896 8:105710693-105710715 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1045838844 8:106555890-106555912 GTGTCTGTGTATATGTGTGTAGG + Intronic
1045878386 8:107009772-107009794 GTGTGTGTGTATATGTGTGTGGG - Intergenic
1045885218 8:107087913-107087935 GTGTGAAAGTTTATGTGTCTTGG + Intergenic
1045892038 8:107168928-107168950 ATTTGTAATTATATATTTGTGGG + Intergenic
1046993866 8:120493458-120493480 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1047022617 8:120792120-120792142 GGGTGTATGTATGTGTGTGTGGG - Intronic
1047143792 8:122173620-122173642 ATGTGTGTGTGTACGTGTGTTGG - Intergenic
1047324150 8:123820189-123820211 ATGTATGTGTATATTTGTGTAGG + Intergenic
1047617801 8:126577437-126577459 GTGTGTGTGTATATGTGTGTTGG - Intergenic
1047636253 8:126766240-126766262 TTGTGTGTGTATGTGTGTGTGGG - Intergenic
1047676228 8:127206147-127206169 TTATGTATGTATATGTGTGTGGG + Intergenic
1048047210 8:130784119-130784141 GTGTGTATGTGTGTGTGTGTTGG + Intronic
1048177587 8:132166730-132166752 ATTTGCAAGTATCTGTGTTTTGG - Intronic
1048203523 8:132396956-132396978 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1048266007 8:132987367-132987389 ATGTGTATGTGTATGTGTACAGG + Intronic
1048674254 8:136759601-136759623 CTGAGTGAGTATATGTGTGTGGG + Intergenic
1048709576 8:137194061-137194083 ATGTGCATGTCTGTGTGTGTGGG - Intergenic
1048758441 8:137765282-137765304 ATGTATGCATATATGTGTGTGGG + Intergenic
1048852848 8:138661063-138661085 GTGTGTATGTATGTGTATGTGGG - Intronic
1048871852 8:138805509-138805531 GTGTGTGTGTATATGTGTGATGG + Intronic
1049251154 8:141589721-141589743 GTGTGTATGTATGTGTGTGCAGG + Intergenic
1049305526 8:141900953-141900975 CTGTGTATGTGTAAGTGTGTGGG + Intergenic
1049343070 8:142124154-142124176 ATGTGTATGTCTGTGTGCGTGGG - Intergenic
1050348129 9:4713905-4713927 ATGTGGAGGTGTATATGTGTAGG - Intronic
1050348137 9:4713983-4714005 ATGTGTAGGCGTATATGTGTAGG - Intronic
1050348138 9:4713997-4714019 ATGTGTAGGTGTATATGTGTAGG - Intronic
1050348139 9:4714011-4714033 ATGTGTAGCTGTATATGTGTAGG - Intronic
1050715696 9:8522686-8522708 GTGTTTAAGTAAATGTGTTTTGG + Intronic
1050786570 9:9411047-9411069 GTGTGTATGTGTGTGTGTGTTGG + Intronic
1051019877 9:12530886-12530908 GTGTGGGTGTATATGTGTGTGGG + Intergenic
1051380839 9:16456986-16457008 ATGTGTGAGTATATGTGGTGGGG + Intronic
1051517053 9:17941674-17941696 ATATGTATGTGTAAGTGTGTGGG + Intergenic
1051684797 9:19646832-19646854 ATGTGTACATATATGTGTTTTGG - Intronic
1052235744 9:26211953-26211975 ATGTGTCTGTGTATGTGTGTTGG + Intergenic
1052406714 9:28070420-28070442 ACATGTATGTTTATGTGTGTTGG - Intronic
1052631328 9:31044417-31044439 ATGTATGTATATATGTGTGTAGG + Intergenic
1052713379 9:32085391-32085413 ATGTGTGTGTATCTGTGTGTTGG + Intergenic
1053172967 9:35904205-35904227 GTGTGTATGTGTATGTGTGAGGG + Intergenic
1053547729 9:39041489-39041511 CTGTGTGTGTGTATGTGTGTAGG - Intergenic
1053548006 9:39042924-39042946 AGGTGTGAGTGTTTGTGTGTAGG - Intergenic
1053667584 9:40327018-40327040 ATGTGTGTGTGTGTGTGTGTTGG + Intronic
1053811825 9:41861106-41861128 ATGTGTATGTTTGTGTGTGTAGG - Intergenic
1053812127 9:41862965-41862987 AGGTGTGAGTGTTTGTGTGTAGG - Intergenic
1053874236 9:42526346-42526368 GTGTGTGTGTACATGTGTGTGGG + Intergenic
1054268097 9:62940408-62940430 GTGTGTGTGTACATGTGTGTGGG - Intergenic
1054618468 9:67324474-67324496 AGGTGTGAGTGTTTGTGTGTAGG + Intergenic
1054618770 9:67326333-67326355 ATGTGTATGTTTGTGTGTGTAGG + Intergenic
1055187443 9:73473814-73473836 ATGATTAAATATATGTGTCTAGG - Intergenic
1055196122 9:73596342-73596364 CTTTGTGTGTATATGTGTGTAGG - Intergenic
1055318772 9:75061156-75061178 ATGTTTATGTATTTGTGTGTAGG - Intronic
1055356755 9:75445532-75445554 ATTTGTATTTATATGTTTGTTGG + Intergenic
1055580287 9:77701480-77701502 GTGTGTGTGTGTATGTGTGTGGG + Intergenic
1055717303 9:79132084-79132106 ATGGGAAAGCATATGTGTTTGGG - Intergenic
1055916572 9:81408196-81408218 ATGTGTGTGTGTATGTGTGTGGG - Intergenic
1056198398 9:84250909-84250931 ATGTATGTGTGTATGTGTGTGGG + Intergenic
1056198601 9:84252725-84252747 GTGTGTGTGTATGTGTGTGTTGG + Intergenic
1056244988 9:84686025-84686047 ATGTGTATATATATGGGGGTGGG - Intronic
1056460281 9:86802932-86802954 ATGTGTGTGCATGTGTGTGTGGG + Intergenic
1056460285 9:86802972-86802994 ATGTGTGGGTATGTATGTGTGGG + Intergenic
1056460348 9:86803827-86803849 ATGTGTGTGTATGTATGTGTGGG + Intergenic
1056768303 9:89458954-89458976 GTGTGTAGGCACATGTGTGTAGG - Intronic
1056768304 9:89458968-89458990 ATGAGTATGCATATGTGTGTAGG - Intronic
1056778969 9:89535105-89535127 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056778971 9:89535129-89535151 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056804345 9:89717168-89717190 GTGTGTGAGTATATGTATGTGGG - Intergenic
1056840328 9:89993666-89993688 GTGTATAAGTATGAGTGTGTAGG + Intergenic
1056926830 9:90842485-90842507 GTGTGTATGTGTATGTGTGTGGG + Intronic
1056984495 9:91349631-91349653 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1057022809 9:91713736-91713758 ATGAGTGTGTATCTGTGTGTGGG + Intronic
1057270773 9:93649901-93649923 ATGAGTATGTCTATGAGTGTTGG - Intronic
1057586120 9:96330302-96330324 GTGTGTGTGTATATGTGTGGGGG - Intronic
1057904026 9:98970680-98970702 GGGTGTATGTATATGAGTGTAGG + Intronic
1058609819 9:106763342-106763364 GTGTGTGTGTGTATGTGTGTTGG - Intergenic
1058622603 9:106899220-106899242 GTGTGTATGTGTGTGTGTGTGGG + Intronic
1059060492 9:111030958-111030980 ATGTATATTTATGTGTGTGTGGG - Intronic
1059073188 9:111161302-111161324 TTGTGTGCGTATATGTGTGGGGG - Intergenic
1059253114 9:112904976-112904998 GTGTGTATGTGTGTGTGTGTAGG + Intergenic
1059502654 9:114768220-114768242 ATGTGTGTATGTATGTGTGTGGG + Intergenic
1059502656 9:114768222-114768244 GTGTGTATGTATGTGTGTGGGGG + Intergenic
1059694054 9:116714105-116714127 ATATGTGCGTATATGTGTGTTGG - Intronic
1059821329 9:117976116-117976138 ATGTATAAGGATATGTATTTTGG - Intergenic
1060162756 9:121381189-121381211 ATGTGTATGTATGTGTGTGTGGG + Intergenic
1060227858 9:121806870-121806892 ATGTGTGTGTTTGTGTGTGTAGG + Intergenic
1060754801 9:126204742-126204764 CTATGTATGTATCTGTGTGTGGG + Intergenic
1061526125 9:131164256-131164278 GTGTGTAAGTGTGTGTGTGTTGG + Intronic
1061861373 9:133470221-133470243 GTGTGTATGTATATGTGTGTGGG + Exonic
1061887561 9:133600199-133600221 CTGTGTGAGTGTGTGTGTGTGGG + Intergenic
1062355775 9:136161371-136161393 GTGTGTGTGCATATGTGTGTGGG + Intergenic
1203705025 Un_KI270742v1:32710-32732 ATGAGTAAGACTGTGTGTGTAGG + Intergenic
1185480145 X:439799-439821 GTGTGTATGAATGTGTGTGTGGG - Intergenic
1185480183 X:440266-440288 GTGTGTCTGTATATGTCTGTGGG - Intergenic
1185589824 X:1268631-1268653 GTGTGTGTGTAGATGTGTGTGGG + Intergenic
1185754145 X:2639905-2639927 ATGTGTTTGTGTATGTGTGTAGG - Intergenic
1185833857 X:3327295-3327317 GTGAGTATGTGTATGTGTGTTGG - Intronic
1185878212 X:3716615-3716637 ATATGTTTGTGTATGTGTGTGGG + Intergenic
1185917419 X:4050718-4050740 ATGTATGTGTATATATGTGTGGG - Intergenic
1186006607 X:5078956-5078978 TACTGTAAGTATATGTGTGACGG - Intergenic
1186035092 X:5413707-5413729 ATGTGTATGTTTATATGTTTTGG + Intergenic
1186088515 X:6018208-6018230 ATGTGTATATATGTGGGTGTGGG - Intronic
1186258394 X:7747814-7747836 ATGTGTGTATATATTTGTGTGGG + Intergenic
1186758137 X:12694745-12694767 ATTTGTATGTGTATTTGTGTGGG - Intronic
1187049070 X:15678262-15678284 GTGTGTATGTATGTATGTGTGGG + Intergenic
1187158176 X:16740451-16740473 ATGGGTAAGTATATTTCTGGAGG - Intronic
1187441444 X:19324166-19324188 ATGTGTGAGTGCATATGTGTTGG - Intergenic
1188215701 X:27474353-27474375 ATATGTACGCATATGTGGGTGGG - Intergenic
1188453387 X:30334013-30334035 ATATGTAGGTATATATATGTAGG - Intergenic
1188711082 X:33399092-33399114 ATGTGTATTTATATTTGTATAGG + Intergenic
1188824342 X:34811639-34811661 ATGTAAAAATATATGTGTGTGGG - Intergenic
1189100105 X:38180158-38180180 GTATGTGTGTATATGTGTGTTGG - Intronic
1189283439 X:39835309-39835331 ATGTGTAAGTGAAGCTGTGTTGG + Intergenic
1189379323 X:40490784-40490806 GTGTGTAGGTATGTGTATGTAGG - Intergenic
1189435228 X:40987011-40987033 GTGTATATGTATATATGTGTGGG + Intergenic
1189549228 X:42076027-42076049 CTGTGTGTGTATGTGTGTGTGGG + Intergenic
1189559098 X:42174438-42174460 ATGTATAAGAATATATGTATGGG - Intergenic
1189583495 X:42432673-42432695 AAGTGTATGTCTATGTTTGTTGG + Intergenic
1189589404 X:42495724-42495746 ATGTGTCTGTATGTGTGTCTGGG + Intergenic
1189631256 X:42956099-42956121 ATGTGTGTGTGTATGTGTCTTGG + Intergenic
1189774767 X:44460787-44460809 ATGTTTAAGTGTGTGTGTGTTGG - Intergenic
1190109104 X:47578583-47578605 ATGTGTGACTGTATGTGTGTTGG - Intronic
1190148191 X:47917826-47917848 ATTTGAAAGTATATGTTTGGGGG + Exonic
1190375450 X:49784486-49784508 ATGTGTAAGTATGGGCATGTGGG + Intergenic
1191180217 X:57554229-57554251 TTGTGTGTGTGTATGTGTGTGGG - Intergenic
1192005308 X:67205501-67205523 ATGTTTGTGTATGTGTGTGTGGG + Intergenic
1192037961 X:67586264-67586286 ATGTGTATGTTTGTGTGTTTGGG - Intronic
1192184193 X:68935385-68935407 GTGTGTGTGTATGTGTGTGTGGG + Intergenic
1192230206 X:69259338-69259360 ATGTGTGTGTTTGTGTGTGTTGG - Intergenic
1192438352 X:71156351-71156373 AGGTAAGAGTATATGTGTGTAGG - Intronic
1192780070 X:74284898-74284920 ATGTGTAAGCAGATCTGTGCAGG - Intergenic
1192797986 X:74440415-74440437 GTGTGTATGTGTGTGTGTGTTGG + Intronic
1192892136 X:75401496-75401518 AAGTGTAATTACATGTGTGATGG - Intronic
1193443602 X:81572452-81572474 ATGTGTATATATGTGTGTGAGGG - Intergenic
1193763204 X:85491772-85491794 GTGTGTGTGTATGTGTGTGTTGG + Intergenic
1193959916 X:87912706-87912728 GTGTATATGTGTATGTGTGTGGG + Intergenic
1193992987 X:88331893-88331915 GTGTGTAAGTATGTTTGCGTGGG + Intergenic
1194547243 X:95252365-95252387 ATGTGTGTATATACGTGTGTGGG + Intergenic
1194598693 X:95892555-95892577 GTGTGTGTGTATGTGTGTGTTGG + Intergenic
1194620554 X:96165533-96165555 ATGTGTAAGTTGATGTAGGTAGG - Intergenic
1194679343 X:96833029-96833051 GTATGTATGTATGTGTGTGTTGG - Intronic
1194689912 X:96971424-96971446 GTGTGTATGTGTGTGTGTGTGGG + Intronic
1194919555 X:99748842-99748864 ATGGATATGTATTTGTGTGTAGG - Intergenic
1194965661 X:100285839-100285861 GTGTGTGTGTATTTGTGTGTGGG - Intergenic
1195029599 X:100913367-100913389 GTGTGTATGTGTATGTGTGTAGG - Intergenic
1195478927 X:105320562-105320584 ATGTGTACGTGTATATGTGCAGG + Intronic
1195570049 X:106388839-106388861 ATGTGAAAGCATGTGGGTGTGGG + Intergenic
1195890905 X:109693904-109693926 ATATGTATGTGTGTGTGTGTAGG + Intronic
1195966386 X:110433606-110433628 ATGTGTTTGTGTATGTGTTTGGG - Intronic
1196172447 X:112604625-112604647 ATGTGTGTGTGTATGTGTGTTGG - Intergenic
1196282359 X:113837170-113837192 ATGCATATGTGTATGTGTGTTGG + Intergenic
1196644710 X:118105056-118105078 GTGTGTTGGTATATGTGTGTGGG - Intronic
1196819298 X:119690332-119690354 GTGTGTATGTGTATGTATGTGGG - Intronic
1197117141 X:122846883-122846905 ATCTGGAAGGATATGAGTGTTGG - Intergenic
1197148546 X:123194417-123194439 AGGGGTAAGTGTATGGGTGTGGG + Intronic
1197180231 X:123527403-123527425 GTGTGTGAGAATGTGTGTGTAGG + Intergenic
1197286976 X:124607209-124607231 ATGTGTATGTGTATGTGTAGGGG + Intronic
1198079497 X:133225781-133225803 ATGTGTGGGGATGTGTGTGTTGG + Intergenic
1198083731 X:133263658-133263680 GTGTGTGTGTGTATGTGTGTAGG - Intergenic
1198301229 X:135335680-135335702 ATATATGAGTATATGTATGTGGG - Intronic
1198612284 X:138415400-138415422 CTTTGTAGGTTTATGTGTGTAGG - Intergenic
1198681240 X:139184627-139184649 GTGTGTATGTGTGTGTGTGTAGG - Intronic
1198962456 X:142196452-142196474 ATGTGAAGTTATATGTGTTTTGG + Intergenic
1198989321 X:142492477-142492499 GTGTGTAAGTGTGTGTGTGGGGG - Intergenic
1199119848 X:144038867-144038889 TTGTGTATATATGTGTGTGTGGG + Intergenic
1199130281 X:144177457-144177479 ATGTGTGAGTGTCAGTGTGTGGG - Intergenic
1199217286 X:145274833-145274855 TATAGTAAGTATATGTGTGTGGG - Intergenic
1199387071 X:147235536-147235558 GTGTGTGAGTATGTGTGTGTTGG - Intergenic
1199406698 X:147470562-147470584 ATGTGTAAGGGTGTGTGTGCTGG - Intergenic
1199682653 X:150237998-150238020 ATGTATGTGTATGTGTGTGTAGG - Intergenic
1199726226 X:150585095-150585117 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1200040404 X:153361785-153361807 TTCTGTAAGTATAGGGGTGTGGG - Intergenic
1200067900 X:153513328-153513350 ATGCGTGTGCATATGTGTGTGGG + Intergenic
1200333879 X:155327188-155327210 ATCTGTATGTATGTGTGTCTTGG - Intronic
1200881359 Y:8215719-8215741 ATATTTAAGTGTGTGTGTGTTGG - Intergenic
1200894633 Y:8361872-8361894 ATATGTGAGTATATGAGTTTTGG + Intergenic
1201052518 Y:9951709-9951731 GTATGTATGTGTATGTGTGTTGG + Intergenic
1201232397 Y:11877982-11878004 ATGTGTTTGTGTATGGGTGTGGG + Intergenic
1201512901 Y:14785110-14785132 AGGTGCAAGGATATGTGTGCAGG - Intronic
1201606891 Y:15796653-15796675 ATGTCCAACTATATGTGTTTAGG - Intergenic
1202587905 Y:26451308-26451330 ATGTGCAAGTATATATTTGAAGG + Intergenic
1202599626 Y:26580032-26580054 ATATGTAAGTAAGTGGGTGTTGG - Intergenic