ID: 900978941

View in Genome Browser
Species Human (GRCh38)
Location 1:6035387-6035409
Sequence CGCGTAGAGTCTGCCGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900978941 Original CRISPR CGCGTAGAGTCTGCCGGCGG GGG Intronic
900978941 1:6035387-6035409 CGCGTAGAGTCTGCCGGCGGGGG + Intronic
908355778 1:63323829-63323851 CGCTTACAGCCTGGCGGCGGCGG + Exonic
914125465 1:144813794-144813816 GGCGGAGAGGCGGCCGGCGGCGG - Intergenic
917891486 1:179442701-179442723 CGGGATGAGTCTGCCGGCAGCGG - Intronic
1069864431 10:71492818-71492840 CGCTTGGAGTCTGCCGTGGGGGG + Intronic
1070933683 10:80277730-80277752 TGCGTGGAGTCTGCCGGGTGGGG - Intronic
1095206166 12:39442903-39442925 TGAGGACAGTCTGCCGGCGGCGG - Intronic
1103800566 12:123534328-123534350 CGCGGAGTGTCTGCGGGCCGGGG - Intergenic
1111951312 13:94711537-94711559 CGAGTAGGGGCTGCCCGCGGCGG + Exonic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1122220917 14:100238836-100238858 CGAGCAGAGTGTGGCGGCGGCGG + Intronic
1123691024 15:22838499-22838521 CGCGTAGAGTGTGGGGACGGGGG - Intergenic
1126348255 15:47718415-47718437 CGGGTAGTGCCTGCCGGCGAGGG + Intronic
1140223753 16:73063160-73063182 CGCGCAGAGGCCGCCGGTGGCGG - Intergenic
1144763840 17:17722474-17722496 CGCGTGGAGCCTGGCGGAGGTGG - Intronic
1148356360 17:46978490-46978512 CGCGGCGAGACTGTCGGCGGGGG - Exonic
1163631318 19:18419347-18419369 GGCGTAGAGGCAGCGGGCGGGGG + Exonic
1166334383 19:42096348-42096370 CGGGGGGAGTCTGCAGGCGGCGG - Intronic
1167866393 19:52332069-52332091 CGGGACGAGTCTGCCGGCAGCGG + Intergenic
1202693078 1_KI270712v1_random:104994-105016 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693102 1_KI270712v1_random:105081-105103 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693114 1_KI270712v1_random:105125-105147 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693126 1_KI270712v1_random:105169-105191 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693138 1_KI270712v1_random:105213-105235 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693150 1_KI270712v1_random:105257-105279 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693162 1_KI270712v1_random:105301-105323 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693174 1_KI270712v1_random:105345-105367 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693186 1_KI270712v1_random:105389-105411 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693198 1_KI270712v1_random:105433-105455 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693209 1_KI270712v1_random:105477-105499 GGCGCAGAGGCGGCCGGCGGCGG + Intergenic
1202693221 1_KI270712v1_random:105521-105543 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
929960227 2:46490677-46490699 GGCGCAGAGTCTGCCTGCAGAGG + Intergenic
947870588 2:233435648-233435670 CGCTTAGAGGCTGATGGCGGTGG - Intronic
1180031343 21:45210652-45210674 CTCGTGGTGTCTGCCGGCTGCGG - Intronic
951527983 3:23671969-23671991 CGCGGAGCTTCTGCCGGTGGAGG + Intergenic
966411853 3:179653159-179653181 AGCGCGGGGTCTGCCGGCGGCGG - Exonic
968463686 4:738957-738979 CGCCTAGAAACTGCTGGCGGGGG - Intronic
968835920 4:2964036-2964058 CTCGCAGAATCCGCCGGCGGCGG + Exonic
991351258 5:65722346-65722368 CGCTGAGAGGCTGGCGGCGGCGG - Exonic
1009437669 6:63636246-63636268 CGCGGAGAGTCCGCCGCGGGAGG - Intronic
1014230101 6:118893978-118894000 CGCGCGGAGGCCGCCGGCGGCGG - Intronic
1019343690 7:519842-519864 CGTGTGGAGCCGGCCGGCGGCGG + Intronic
1049659867 8:143815139-143815161 CGGGCAGATTCTGCCGCCGGAGG + Intronic
1058418021 9:104808190-104808212 CACCTACAGTCTGCCGGAGGTGG - Intronic
1061853740 9:133430098-133430120 CCTGGTGAGTCTGCCGGCGGTGG + Exonic
1191006743 X:55717838-55717860 CTCGGAGAGTCAGCCGGCGGGGG - Intronic
1195370277 X:104166519-104166541 CGGGCTGAGTCTGGCGGCGGCGG + Intergenic