ID: 900980015

View in Genome Browser
Species Human (GRCh38)
Location 1:6040967-6040989
Sequence GAGGAACAGGATGCCGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 273}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900980015_900980029 29 Left 900980015 1:6040967-6040989 CCAACCCCGGCATCCTGTTCCTC 0: 1
1: 0
2: 3
3: 15
4: 273
Right 900980029 1:6041019-6041041 CTGCCAGTTTCTCCTGAGCGAGG 0: 1
1: 0
2: 0
3: 6
4: 121
900980015_900980023 4 Left 900980015 1:6040967-6040989 CCAACCCCGGCATCCTGTTCCTC 0: 1
1: 0
2: 3
3: 15
4: 273
Right 900980023 1:6040994-6041016 TTTATACATCGCAGCCCCTGTGG 0: 1
1: 0
2: 1
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900980015 Original CRISPR GAGGAACAGGATGCCGGGGT TGG (reversed) Intronic
900980015 1:6040967-6040989 GAGGAACAGGATGCCGGGGTTGG - Intronic
901677789 1:10897087-10897109 GAGGCTCAGGCTGCCGGGGAGGG - Intergenic
902112375 1:14093122-14093144 GAGGGAGAGGATGCAGAGGTGGG - Intergenic
904005488 1:27361104-27361126 GAGGGCCAGGATGCCCGGGGGGG - Intronic
904341378 1:29837100-29837122 GAGGAAAAGGAAGCAGGGGAGGG - Intergenic
905733715 1:40312585-40312607 GAGGACCAGGAAGCCCGGGCTGG + Exonic
906035871 1:42750139-42750161 GAGGTACAGCATGCGGGGGCGGG + Intronic
906308653 1:44737900-44737922 CAAGAACAGGAGGCCGGGCTTGG + Intergenic
912510840 1:110189283-110189305 GAGGAACAGGTTGATGGTGTTGG - Intronic
915473428 1:156138911-156138933 GAGGGGCAGGATGCAGAGGTGGG - Intronic
915546665 1:156602803-156602825 AAGGAACAGCTTGCAGGGGTAGG - Intergenic
919757712 1:201076197-201076219 GAATAACAGGAGGCCTGGGTGGG - Intronic
920315203 1:205071866-205071888 GAGGAACAGAATGTGGGGGCCGG + Intronic
920939854 1:210471567-210471589 GAGGAACTGGATGCAAGGCTGGG + Intronic
921067431 1:211632757-211632779 GAGGAACAGGAAGGCGATGTCGG - Intergenic
923953390 1:238987350-238987372 GAGTACCAGGATGCAGGGATTGG - Intergenic
924226307 1:241924571-241924593 GAGGAAGAGGAAGGGGGGGTTGG - Intergenic
1063253347 10:4298847-4298869 GAGGAACAGGGTGAAGGGGGAGG - Intergenic
1063726005 10:8638301-8638323 GATGAACAGTCTGCCTGGGTTGG - Intergenic
1064243255 10:13649434-13649456 GAGGATCTGGATGATGGGGTGGG + Intronic
1065671842 10:28127802-28127824 GAAGACCAGGATGCCAGGGCAGG + Intronic
1065689546 10:28319171-28319193 GAGGAAGAGGGTGAAGGGGTAGG + Intronic
1068509258 10:57943196-57943218 GAGGAACAGGACTAGGGGGTGGG + Intergenic
1068681037 10:59820222-59820244 GAGGACTACGATGCTGGGGTGGG + Intronic
1068886279 10:62100300-62100322 GAGGAACATGATGGCCAGGTAGG + Intergenic
1068931286 10:62593089-62593111 AAGGAACAGACTGCAGGGGTCGG - Intronic
1068996706 10:63213949-63213971 GAGGAAAAGGATGCTGGCTTAGG + Exonic
1070764433 10:79048395-79048417 GAGGAAAAGGCCACCGGGGTTGG + Intergenic
1070796771 10:79221487-79221509 GAGCATCAGGATGCCGGGCCAGG - Intronic
1070825253 10:79386958-79386980 GAGGCGCCGGATGCTGGGGTCGG - Intronic
1070917957 10:80166988-80167010 GAGGAAGAGGCAGCAGGGGTGGG + Intronic
1071488543 10:86120155-86120177 GAGGAACAGGAGGCCAGGCTGGG - Intronic
1071505665 10:86230050-86230072 CAGGAGCAGGATGCAGGGGCTGG - Intronic
1071524615 10:86351219-86351241 GAGCCACAGGATGCCGGAGTCGG - Intronic
1072303433 10:94084442-94084464 GAGGAATAGGTGGCCGGGGATGG - Intronic
1073084610 10:100880086-100880108 GGGGAACAGGAGGCCAGGATAGG + Intergenic
1075675253 10:124291593-124291615 GAGGAACACGAGGCAGAGGTGGG + Intergenic
1075960935 10:126567307-126567329 GAGGAAAAGGATGAAGGGGAAGG + Intronic
1076518142 10:131061660-131061682 GAGAAACAGGATACCTGTGTAGG - Intergenic
1077352920 11:2101069-2101091 GAGGGACTGGATGCCTGGGGAGG + Intergenic
1077366403 11:2163021-2163043 GAGGAACAGACTGCCAGGCTGGG + Intergenic
1077517529 11:3010791-3010813 AAGGATCAGGAAGCCTGGGTGGG - Intronic
1077554318 11:3218631-3218653 GAGGAACAGGAAGTCGGCGGCGG + Exonic
1078431499 11:11291958-11291980 GAGTAACTGGATGCCAGGATTGG + Intronic
1079079926 11:17407014-17407036 CAGGAGCAGGATGCCGGCGGAGG + Exonic
1081449859 11:43160874-43160896 TAGGAACAATATCCCGGGGTGGG - Intergenic
1082980376 11:59115370-59115392 GGGGAACTGGATGACAGGGTGGG - Intronic
1083662587 11:64258674-64258696 GAAGGAGAGGATGACGGGGTAGG - Exonic
1083935638 11:65868490-65868512 AAGGTACAGGTTGCCCGGGTGGG - Exonic
1084063066 11:66688144-66688166 GAGAGCCAGGATGCCTGGGTAGG - Intronic
1084275718 11:68050049-68050071 GATGAAGAGGAGGCCGAGGTGGG + Exonic
1084936958 11:72592048-72592070 GAGGGACAGGATGATGGGGGTGG - Intronic
1087241802 11:95789466-95789488 GAGGAGCAGGATGGCGGCCTCGG - Exonic
1088759092 11:112912575-112912597 GAGAAACAGCATGGCGGGGCTGG + Intergenic
1089513795 11:119018689-119018711 GAGGAGGAGGAGGCTGGGGTGGG + Exonic
1090224863 11:125063666-125063688 GAAGAACAGGCTGCCAGGGAGGG + Intronic
1090377883 11:126304156-126304178 GAGGAAAAGGAGGCAGGAGTTGG + Exonic
1090974991 11:131672828-131672850 GAAGACCACGGTGCCGGGGTGGG + Intronic
1090975009 11:131672895-131672917 GAAGACCACGGTGCCGGGGTGGG + Intronic
1090975027 11:131672962-131672984 GAAGACCACGGTGCCGGGGTGGG + Intronic
1090975044 11:131673029-131673051 GAAGACCACGGTGCCGGGGTGGG + Intronic
1091219211 11:133920434-133920456 CAGAGACAGGATGCCCGGGTAGG + Exonic
1093234496 12:16589981-16590003 GAGGTACAGGATGAATGGGTGGG - Intronic
1095544909 12:43354920-43354942 GAGGAACAGGTGGCAGAGGTAGG + Intronic
1096109076 12:49018579-49018601 GAGGAACAGGGTCACGGGATAGG + Intronic
1096506921 12:52099494-52099516 TAGGAACAGTATCACGGGGTGGG + Intergenic
1097139414 12:56887354-56887376 GAGGAAGAGGATGAAGGGGGAGG - Intergenic
1097823119 12:64147432-64147454 GAGGCACAGGAAGGCGGGGATGG - Exonic
1102197381 12:111034747-111034769 GAGGAGGAGGGAGCCGGGGTTGG + Intronic
1102451291 12:113043837-113043859 GAGGCACAGGATGCCAGGATTGG - Intergenic
1102628153 12:114252934-114252956 GAGGCAGAGGATGCAAGGGTAGG - Intergenic
1113408774 13:110065418-110065440 GATGGCCAGGATGCTGGGGTGGG - Intergenic
1114492294 14:23110849-23110871 GAGGAAAAGGGTGCGGTGGTAGG + Intergenic
1116201400 14:41802274-41802296 GAGGAACAGGTTGTCAGGGATGG + Intronic
1118772116 14:68949181-68949203 GAAGAACTGGAGGCAGGGGTGGG + Intronic
1119731164 14:76952091-76952113 GAGGATAAGGATGCTGGAGTCGG - Intergenic
1121860393 14:97312315-97312337 GAGGTACAGAATGGCTGGGTTGG + Intergenic
1123218166 14:106831494-106831516 GAGGATCAGGACACCAGGGTCGG - Intergenic
1125466730 15:39960607-39960629 GAGGAACAGGATGGGGCGGGTGG + Intronic
1125584471 15:40810403-40810425 GAGGATCAGGAGGTAGGGGTGGG - Intronic
1126526773 15:49664939-49664961 TGGGAACAGGATGCAGGGGCAGG - Intergenic
1128279997 15:66386897-66386919 GAGGGACTGGAGGCCGGGGGAGG - Exonic
1130421029 15:83747256-83747278 CAGGAACAGGATGCAAGTGTGGG - Intronic
1130558482 15:84940534-84940556 GAGGAAGAGGATGAGGGGGAAGG - Intronic
1131413220 15:92228594-92228616 GAAGAAAAGGATGAGGGGGTTGG + Intergenic
1132620993 16:868256-868278 GAGGAGCAGGAGGCAGGGATGGG - Intronic
1133009131 16:2900636-2900658 GAGGAAGAGGAGGCCGGGGTGGG + Intergenic
1133226128 16:4341315-4341337 GAGGGAGAGGCTGCCAGGGTGGG - Intronic
1133326146 16:4943528-4943550 GAGGGCCAGCCTGCCGGGGTGGG + Intronic
1134052285 16:11145420-11145442 GAGGGACTGGATGCAGGAGTGGG - Intronic
1136003580 16:27313884-27313906 GGGGAGCAGGAAGCCGGGGCGGG + Intronic
1136287865 16:29254725-29254747 GAGGGACTGGAGGCCGGTGTCGG - Intergenic
1136416058 16:30104587-30104609 GGGGGCCAGGATGCCTGGGTTGG + Intergenic
1136480633 16:30539451-30539473 GGGCAACAGGAAGCAGGGGTGGG + Intronic
1136684097 16:31983979-31984001 GAGGGGCAGGAGGCCAGGGTGGG + Intergenic
1136784722 16:32927531-32927553 GAGGGGCAGGAGGCCAGGGTGGG + Intergenic
1136885061 16:33926275-33926297 GAGGGGCAGGAGGCCAGGGTGGG - Intergenic
1139229955 16:65274022-65274044 GAATAACAGGATGAAGGGGTCGG + Intergenic
1140479864 16:75256768-75256790 GAGGAAGGGGTTGCTGGGGTGGG - Intronic
1141995309 16:87633360-87633382 GTGGTAGAGGATGCCGGGGGTGG + Intronic
1142093517 16:88227428-88227450 GAGGGACTGGAGGCCGGTGTGGG - Intergenic
1142344000 16:89542340-89542362 GAGGAACAAGAGGCTGGGGAGGG - Intronic
1203087380 16_KI270728v1_random:1191537-1191559 GAGGGGCAGGAGGCCAGGGTGGG + Intergenic
1143783679 17:9242004-9242026 GGAGAACAGGAGCCCGGGGTGGG + Exonic
1147869652 17:43578377-43578399 GAGGAAGAGGATGCCCAGGGAGG + Intronic
1148700996 17:49586895-49586917 GAGGAAGAGGATGGGTGGGTGGG - Intergenic
1149814198 17:59707163-59707185 AAGGAACAGGCTGCTGGGGAGGG - Intronic
1150004680 17:61462490-61462512 GAGGGACAGGAGGACGGGGTGGG + Intronic
1151337025 17:73446037-73446059 GAGGAGCTGGATGCCGGAGAAGG + Intronic
1151471614 17:74321857-74321879 GTGGAACAGGATGCTGTGATGGG + Intergenic
1151595265 17:75074509-75074531 CAGGGACAGGATGCCTAGGTGGG + Intergenic
1151811690 17:76447057-76447079 GAGGCACAGGATGTTGGGATAGG - Intronic
1152262629 17:79275194-79275216 GAGGAACATGAGGCCAGGGGAGG - Intronic
1155532979 18:26786235-26786257 GAGGAACAGGATGACTCTGTTGG + Intergenic
1156126703 18:33914556-33914578 GAGGAAGAGGATGACTGGCTAGG + Intronic
1156337887 18:36186613-36186635 GCGGAGCGGGATGCAGGGGTGGG - Intergenic
1160050605 18:75429912-75429934 GAGGAAAAGGAGGGAGGGGTGGG - Intergenic
1160181115 18:76637473-76637495 GAGGAACAGGTTACCGGGAAAGG - Intergenic
1160990092 19:1856936-1856958 GAGGAGCAGGTTGCCGGGGTGGG + Intronic
1161306896 19:3573494-3573516 GAGGGACTGGAGGCCGAGGTGGG - Intronic
1162901056 19:13795697-13795719 GAGGAGCGCGATGCCGGGGCCGG + Exonic
1163245393 19:16090542-16090564 GATGAACAGGAGGCCAGGCTCGG - Intronic
1163373370 19:16914900-16914922 GAGGAAATGGAGGCCGGGGGTGG - Intronic
1163587756 19:18173268-18173290 GAGGGGCAGGATGTGGGGGTTGG + Intronic
1163597950 19:18231432-18231454 GAGGAACTAGAAGCCGGGGCGGG + Intronic
1163605783 19:18274547-18274569 GGGGAACAGGATGCAGGGCAGGG + Intergenic
1164498367 19:28791423-28791445 CAAGAACAGGGTGCTGGGGTCGG - Intergenic
1165825559 19:38703780-38703802 GAGGAACTGGGTGGCGGGTTGGG + Intronic
1165858443 19:38894024-38894046 CTGGGACAGGCTGCCGGGGTTGG + Intronic
1165879598 19:39032616-39032638 AAGAAAGAGGATGCAGGGGTGGG - Intronic
1166007273 19:39916292-39916314 GAGGAACAGGCTGTGGGGGCAGG - Intronic
1166120445 19:40683207-40683229 GAGGACCACGGTGCCGGGTTAGG - Intronic
1166302660 19:41921234-41921256 GAGGAACTGGAGGTTGGGGTGGG + Intronic
1166747106 19:45146648-45146670 GAGGCCCAGGATGCCAGGGGTGG + Exonic
925436885 2:3846197-3846219 GAAGAACAGGAGGACGGGGGTGG - Intronic
925609302 2:5691301-5691323 GAGGAAGAGGAGGCCTGGGAAGG + Intergenic
927848302 2:26483427-26483449 GAGGTACAGGAGGCTGGGGCTGG - Intronic
928002567 2:27537649-27537671 GAGGAACTGGATGCAGGGAGAGG + Intronic
928724219 2:34152159-34152181 GAGGAGGAGGAAGCAGGGGTGGG - Intergenic
928745596 2:34410796-34410818 GAGGAGCAGGATGCTGGGAAAGG + Intergenic
930262451 2:49163582-49163604 AAGGAACAGTATGCTGGAGTTGG + Intergenic
931567664 2:63631901-63631923 GCAGAGCAGGATGCTGGGGTTGG - Intronic
931669164 2:64631088-64631110 GCGGAACAGGGTGCAAGGGTGGG + Intergenic
934716363 2:96546949-96546971 AAGTCACAGGAGGCCGGGGTTGG - Intronic
937077322 2:119116752-119116774 GAGGAACAGGTTGCTAGGATAGG + Intergenic
937216903 2:120318674-120318696 AGAGAACAGGATGCAGGGGTGGG + Intergenic
937254139 2:120542697-120542719 GAGGAACAGAACGTGGGGGTTGG + Intergenic
937275102 2:120679158-120679180 GAGGAAGAGGAAGCAGGGCTAGG - Intergenic
937552317 2:123108916-123108938 GAGGAGCAGGATGGTGGAGTAGG - Intergenic
939900356 2:147844048-147844070 GAGGAAGAGGACCCCGAGGTGGG - Intergenic
940004063 2:148995303-148995325 GAGCAACAGGATGCCATGGAAGG - Intronic
941533829 2:166698190-166698212 GAGGAACAATATCACGGGGTGGG - Intergenic
942675291 2:178420644-178420666 GGGGAAGAGGAAGCAGGGGTGGG + Intergenic
946970307 2:225083587-225083609 GAGGAGAAGGATGCAGAGGTAGG + Intergenic
947707124 2:232285361-232285383 GAGGAAGGGGATGCCTGGGTGGG - Intronic
947837733 2:233187806-233187828 GAGGAGCAGGAGGACGGGCTTGG - Intronic
948455140 2:238101381-238101403 CAGGAACAGGATGCTGGGCCGGG - Intronic
948801228 2:240434561-240434583 GGAGAACAGGGGGCCGGGGTGGG + Intergenic
1169784594 20:9346028-9346050 GAGGAACTGGTTGCAGGGCTTGG - Intronic
1173210901 20:41030412-41030434 AATGAACAGGAAGCAGGGGTGGG - Intronic
1173812690 20:45965855-45965877 GAGGAGGAGTATGCAGGGGTAGG - Intronic
1174187796 20:48719433-48719455 GAGAGACAGGATGAAGGGGTGGG + Intronic
1174313084 20:49674596-49674618 GAGGCACAGGAGACCGAGGTGGG + Intronic
1174402947 20:50285723-50285745 GGGGACCAGGAGGCCGGGCTGGG - Intergenic
1174543094 20:51304927-51304949 GAGGGACAGGAGGCCTGGGTGGG + Intergenic
1174783969 20:53415453-53415475 GAGGAAGAGGAAGAAGGGGTGGG - Intronic
1174798214 20:53540235-53540257 GAGGCACTGGAGGCCGGGCTTGG - Intergenic
1175036281 20:56004228-56004250 GAGCACCGGGATCCCGGGGTAGG - Exonic
1175780697 20:61680262-61680284 GAGGGACAGGGTGCCAGGCTGGG + Intronic
1175806761 20:61833930-61833952 GAGGCACAGGGTGCAGGAGTGGG + Intronic
1175948480 20:62569841-62569863 GAGGGACAGGGTGCTGGGGTGGG - Intronic
1177833737 21:26169357-26169379 GGGGCACAGGATGCTGGGGAGGG - Intronic
1179170296 21:38967913-38967935 GAGGTACAGGATGGCTGGATTGG - Intergenic
1179176413 21:39011109-39011131 CAGGAAGAGGATGCCAGGCTGGG + Intergenic
1179218412 21:39386369-39386391 GAGTCACAGGATTCTGGGGTAGG - Intronic
1179906962 21:44427492-44427514 GGGGAACAGGATGCCAGGCGAGG - Intronic
1180048953 21:45322751-45322773 GAGGAAGAGGAGGGCGGGGCTGG - Intergenic
1180064653 21:45406131-45406153 GGGGAACTGGGTCCCGGGGTTGG - Intronic
1180067294 21:45418805-45418827 CAGGCACAGGAGGTCGGGGTGGG - Intronic
1180619049 22:17147896-17147918 GAGGACCAGGATGAGGGCGTAGG - Intronic
1181274677 22:21681058-21681080 GAGGAAGACGATGCCGGGATTGG + Intronic
1182524314 22:30906102-30906124 GAGGAAAGGGGTGCCCGGGTGGG + Intronic
1183024604 22:35055195-35055217 GAAGAACAGAATGTCAGGGTTGG - Intergenic
1183505148 22:38204583-38204605 GAGAAACAGGAAGCCAGGGCAGG + Intronic
1183564262 22:38601849-38601871 GAGGAACAGGCTGGGGCGGTGGG + Intronic
1183608597 22:38882396-38882418 GAGGAACAGGGCGCATGGGTGGG + Intergenic
1183746994 22:39697775-39697797 GAGACACAGGGTGCAGGGGTGGG + Intergenic
1184676176 22:46044700-46044722 GAGGAAAAGCAGGCCGGGGAGGG - Intergenic
1184857207 22:47152834-47152856 GAGACGCAGGATGCCAGGGTGGG + Intronic
1185074780 22:48677359-48677381 GGGGATGGGGATGCCGGGGTCGG + Intronic
1185281312 22:49971264-49971286 GGGGAACGCGAGGCCGGGGTGGG + Intergenic
1185338830 22:50282764-50282786 GGTGAAGAAGATGCCGGGGTTGG + Exonic
949360922 3:3231333-3231355 GAGGAAGAGAGTGACGGGGTAGG + Intergenic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
952285946 3:31969914-31969936 GAGAAAGAGTATGCGGGGGTGGG + Intronic
952845266 3:37682923-37682945 GAGGAACAGGGGGCCTGAGTAGG - Intronic
954612644 3:51954189-51954211 GAGGAGCAGGTTGTCGGGGAGGG + Intergenic
955407820 3:58636439-58636461 GATGGTCAGGATGCGGGGGTGGG + Intronic
956352080 3:68348595-68348617 GAGAAACAGGATGCCTGAATTGG - Intronic
960929671 3:122833363-122833385 GAGGAAGAGGAGGTCGGGGTGGG - Exonic
961421690 3:126810854-126810876 GAAGAACAGGTTGTGGGGGTGGG + Intronic
961460853 3:127049525-127049547 GAGGAACAGGCAGACAGGGTGGG + Intergenic
961636414 3:128335724-128335746 GAAGAACAGGCTGCGGGGGAGGG + Intronic
961755903 3:129127245-129127267 GAGGTCCAGGAGGCCTGGGTGGG + Intronic
962338654 3:134562318-134562340 GAGGAGCAGGAGGCTGGGTTTGG + Exonic
964667623 3:159191311-159191333 GAGGAGGAGGAGGCTGGGGTTGG + Intronic
967111589 3:186298404-186298426 GAGGCACAGGGTGCAGGGGATGG + Intronic
968075966 3:195816301-195816323 AAGGAAAAGGAGGCCGGGCTGGG - Intergenic
968121923 3:196131888-196131910 GTGGAACAGGAAACCCGGGTGGG + Intergenic
968952068 4:3700394-3700416 GATGAACAGGATTCTGGGGCTGG + Intergenic
969632370 4:8346170-8346192 GAGGCACTGGATGCAGGGCTGGG + Intergenic
971525021 4:27605818-27605840 GAGGAAGAGGATGAAGGGGGAGG - Intergenic
975098033 4:70480279-70480301 GGAGAACATGAAGCCGGGGTGGG + Intronic
978189464 4:105895591-105895613 GAGGAACAGGTTGGGGTGGTGGG - Exonic
981731360 4:147902798-147902820 CAGGAACAGGAGGCATGGGTGGG + Intronic
981782800 4:148445307-148445329 GAGGAGCAGCCTGGCGGGGTGGG - Intergenic
983172564 4:164552302-164552324 TAGGCACAGGATGCGGGGGGTGG + Intergenic
985872532 5:2568785-2568807 GAGGAAGAGGTTGGAGGGGTCGG - Intergenic
985988772 5:3538476-3538498 GGGGATGAGGATGCAGGGGTGGG - Intergenic
986253694 5:6083772-6083794 GAGGGGCAGGAGGCCAGGGTGGG - Intergenic
991312055 5:65254526-65254548 GAGAAACAGGAGGCCAGTGTAGG + Intronic
992105399 5:73446696-73446718 GAGGAAGAGGGTGCCGGGGAAGG - Exonic
994095252 5:95842057-95842079 GAGGAACAGGATGACATGGCAGG - Intergenic
995842090 5:116452179-116452201 GCAGAAGAGGATGCAGGGGTTGG - Intronic
997847197 5:137297649-137297671 GAGGAACAGGGTGGGGAGGTGGG + Intronic
998468370 5:142363972-142363994 GAGGAAAAGGATAAAGGGGTGGG + Intergenic
998497502 5:142603399-142603421 GAGGAAGAGGATGTGGGGGAGGG - Intronic
998935414 5:147228021-147228043 TAGGAACAGAATCCCAGGGTGGG + Intergenic
999065812 5:148684320-148684342 GAGGAGCTGGGTGCCGGAGTGGG - Intergenic
1001506230 5:172283255-172283277 GAGGATCAGGATGGCGGCGCCGG - Intronic
1001630180 5:173169079-173169101 GAAGAAGAGGATGCTGGGGTGGG + Intergenic
1001926120 5:175638524-175638546 GAGGAACTGCATGGCTGGGTTGG - Intergenic
1001977129 5:176009319-176009341 GAGGCACAGCATGCCACGGTGGG - Intronic
1002240298 5:177834461-177834483 GAGGCACAGCATGCCACGGTGGG + Intergenic
1002450349 5:179315061-179315083 GGGGAGGAGGAGGCCGGGGTGGG - Intronic
1002580430 5:180206942-180206964 AAGGAAGAAGATGCAGGGGTGGG + Intronic
1005769119 6:29047862-29047884 GAGAAACAGTATGCCTGGATTGG - Intergenic
1006197483 6:32254846-32254868 GAGGAAGAGGATGATGGGGTGGG + Intergenic
1006904456 6:37523634-37523656 GGGGAAGAGGAGGCCAGGGTTGG + Intergenic
1006984330 6:38167175-38167197 GAGGGAGAGGATGCCGGGCTGGG - Intergenic
1007372084 6:41432555-41432577 GTGGAGCAGGAGGCTGGGGTGGG - Intergenic
1007811029 6:44485782-44485804 GGGGATCAGGATGCTGGGGCAGG - Intergenic
1011636671 6:89380978-89381000 GAGGAACAGTATTCTGGGGAAGG - Intronic
1012042945 6:94233805-94233827 TGGGTACAGGATGCAGGGGTTGG - Intergenic
1015511010 6:134038014-134038036 GAGGATCAGGGTGCAGGGGAGGG - Intronic
1017802497 6:157910121-157910143 GAGCAGCAGGATGCAGGAGTTGG + Intronic
1019073511 6:169368663-169368685 GGGAAGCAGGATGCCCGGGTGGG + Intergenic
1019434761 7:1017025-1017047 GAGGACCAGGGTGCGTGGGTGGG - Intronic
1019512684 7:1425949-1425971 GAGGGGCAGGATGGTGGGGTGGG - Intergenic
1020808829 7:12826311-12826333 GAGGAAGAGGATGAGGGGGAAGG - Intergenic
1021381311 7:19969976-19969998 GAGGAATTGGATGTCGGGGGGGG - Intergenic
1022563021 7:31369480-31369502 CAGGCACAGGATGCCGGGTGGGG + Intergenic
1023335416 7:39164376-39164398 GAGGGACAGGGTGGCAGGGTAGG + Intronic
1024299534 7:47876575-47876597 GAGGAGCAGGAGGGAGGGGTCGG + Intronic
1024493753 7:50017843-50017865 TAGGTACAGGATGCCGGGTATGG + Intronic
1024785352 7:52901169-52901191 GAGGAACAGAATGGAGGGATCGG + Intergenic
1029261071 7:99303241-99303263 GAGGACCAGGCTGCCTGGGCAGG + Intergenic
1029686093 7:102149266-102149288 GAGAAACAGTATCCCGGAGTAGG - Intronic
1029896646 7:103990213-103990235 GAGGGACAGGGGGCCTGGGTGGG - Intergenic
1034859262 7:154582009-154582031 GAGGAAAAGGAGGCTGTGGTAGG - Intronic
1035923198 8:3700775-3700797 GAGGACCAGGATGCAAGGGTGGG + Intronic
1037712327 8:21364745-21364767 GAGGAACAGGCTGCTGGGCAGGG + Intergenic
1038267933 8:26050453-26050475 GAGGAAAAGGCAGCCGGGTTGGG - Intergenic
1038394903 8:27239408-27239430 GAGAAACATGAGGCCGGGGTTGG - Intronic
1039380043 8:37076501-37076523 GAGGAACGAGATGACGGGGATGG - Intergenic
1047858331 8:128936969-128936991 CAGGAAAGGGAGGCCGGGGTGGG + Intergenic
1048380618 8:133861987-133862009 GATGAAGAGGATGCAGGGCTAGG + Intergenic
1049241848 8:141541824-141541846 GAGGAAGAGGCTGCAGGAGTGGG - Intergenic
1049272446 8:141703109-141703131 GTGGAACAGGCTGCAGGGGGAGG - Intergenic
1049371250 8:142268566-142268588 AAGGGACTGGATGCTGGGGTAGG - Intronic
1049895156 9:105964-105986 AAGGAACAATATCCCGGGGTGGG - Intergenic
1050297128 9:4216791-4216813 GAAGAACAGGATGTGGGGGAGGG + Intronic
1053737653 9:41111703-41111725 AAGGAACAATATCCCGGGGTGGG - Intergenic
1054690696 9:68319616-68319638 AAGGAACAATATCCCGGGGTGGG + Intergenic
1055780504 9:79816088-79816110 GAGGAAGAGCATGGTGGGGTGGG - Intergenic
1056885778 9:90442379-90442401 GAGAAGCAGGATGGAGGGGTCGG - Intergenic
1057438667 9:95065457-95065479 GAGGAAAAGGGGGCCTGGGTGGG - Intronic
1057739776 9:97701201-97701223 GAGGACCAGGATAAGGGGGTGGG - Intergenic
1060110639 9:120904221-120904243 GAGGCACAGGATGTGGGGGCTGG + Exonic
1060269061 9:122128408-122128430 GAGGAGGAGGATGCCGGGGTGGG - Intergenic
1060343626 9:122798241-122798263 GAGGATCAGGATGATTGGGTAGG - Intergenic
1060960965 9:127680407-127680429 GAGGAACGGGATGCTGGAGGGGG - Intronic
1060967850 9:127721491-127721513 GAGGAGCAGGTGGGCGGGGTGGG + Intronic
1061654222 9:132076175-132076197 GAGGATCAGGGTGCTTGGGTGGG - Intronic
1185459469 X:328200-328222 GGGGAACAGGATGGGGGGGCGGG - Intergenic
1187402929 X:18978346-18978368 GAGGAAAAGGCTGCTGGGGAGGG - Intronic
1192174713 X:68878472-68878494 GAGGAACTGGTGGCTGGGGTAGG + Intergenic
1192580873 X:72280186-72280208 GAGAAGCAGGCTGCGGGGGTGGG + Intronic
1198999864 X:142622587-142622609 GATGAACAGGGTGCTGTGGTGGG + Intergenic
1199599802 X:149535214-149535236 GAGGAAAAGGAGGAGGGGGTGGG - Intergenic
1199650838 X:149945038-149945060 GAGGAAAAGGAGGAGGGGGTTGG + Intergenic
1200032314 X:153306689-153306711 GAGGACCCGGATGCTGGGGAGGG + Intergenic