ID: 900981766

View in Genome Browser
Species Human (GRCh38)
Location 1:6049867-6049889
Sequence CACAGCTGCCTCTTTCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 247}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900981766_900981777 6 Left 900981766 1:6049867-6049889 CCCCCATGAAAGAGGCAGCTGTG 0: 1
1: 0
2: 2
3: 22
4: 247
Right 900981777 1:6049896-6049918 CTGGAGGTGGCCCCCCTCTCTGG 0: 1
1: 0
2: 2
3: 13
4: 179
900981766_900981783 19 Left 900981766 1:6049867-6049889 CCCCCATGAAAGAGGCAGCTGTG 0: 1
1: 0
2: 2
3: 22
4: 247
Right 900981783 1:6049909-6049931 CCCTCTCTGGGTGCACATATAGG 0: 1
1: 0
2: 0
3: 9
4: 108
900981766_900981778 7 Left 900981766 1:6049867-6049889 CCCCCATGAAAGAGGCAGCTGTG 0: 1
1: 0
2: 2
3: 22
4: 247
Right 900981778 1:6049897-6049919 TGGAGGTGGCCCCCCTCTCTGGG 0: 1
1: 0
2: 1
3: 21
4: 183
900981766_900981775 -7 Left 900981766 1:6049867-6049889 CCCCCATGAAAGAGGCAGCTGTG 0: 1
1: 0
2: 2
3: 22
4: 247
Right 900981775 1:6049883-6049905 AGCTGTGGGGCTCCTGGAGGTGG 0: 1
1: 0
2: 3
3: 71
4: 460
900981766_900981774 -10 Left 900981766 1:6049867-6049889 CCCCCATGAAAGAGGCAGCTGTG 0: 1
1: 0
2: 2
3: 22
4: 247
Right 900981774 1:6049880-6049902 GGCAGCTGTGGGGCTCCTGGAGG 0: 1
1: 0
2: 6
3: 66
4: 564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900981766 Original CRISPR CACAGCTGCCTCTTTCATGG GGG (reversed) Intronic
900981766 1:6049867-6049889 CACAGCTGCCTCTTTCATGGGGG - Intronic
905329363 1:37181565-37181587 CACAGCTGCCTCCCTCTTTGGGG + Intergenic
912514269 1:110208252-110208274 CCCAGCTGCCTCTCTCAGGCTGG + Intergenic
916066147 1:161137325-161137347 CACAGCTACCTCTGTCCTGATGG - Intergenic
916879028 1:169000886-169000908 CACAGATGTCTCTGTCCTGGTGG - Intergenic
917241087 1:172949528-172949550 CTCACCTGAGTCTTTCATGGAGG - Intergenic
917245887 1:172999715-172999737 CTCCTCTGCCTCTTTCATGGAGG - Intergenic
919811331 1:201410612-201410634 CACAGCTTCCTTTTTCCTGTGGG - Intronic
919970126 1:202570853-202570875 CACAGCTCCTTGTTGCATGGAGG + Intronic
920209826 1:204320147-204320169 ACCAGCTGCCTCTTCCCTGGGGG + Intronic
920227880 1:204451081-204451103 CCCAGCTGCCTCTACCCTGGGGG + Intronic
920684786 1:208101282-208101304 CACGGTGGCCTCTTTAATGGAGG - Intronic
921315136 1:213883228-213883250 CCCAGCTTCCTCTTTAAGGGTGG + Intergenic
921576613 1:216842563-216842585 CACATCTGCCTCTTACATTAAGG - Intronic
922793101 1:228321450-228321472 CACAGCTGCCTTGTCCATTGAGG - Exonic
923341729 1:233013436-233013458 CACAGCTGCCCCTTTCAAGAAGG + Intronic
924607579 1:245548348-245548370 TGCAGCTGCCTCTTTCAGGACGG - Intronic
1062856698 10:783427-783449 CACAGCTGCCTGTCTCAGAGTGG - Intergenic
1062892836 10:1077486-1077508 CAAAGGTGCCTCTTCCATGAGGG + Intronic
1063011023 10:2021543-2021565 CACATCTCCCTCTTTCGTGAGGG + Intergenic
1064440996 10:15353690-15353712 CACTGCTGCCTTTTTCCTGGAGG - Intronic
1065271260 10:24036103-24036125 AACAGCTGCCTCCTTCACTGGGG + Intronic
1068909039 10:62358683-62358705 CAATGCTGCCCCTTCCATGGTGG - Intergenic
1069627653 10:69878147-69878169 CTCTGCTGCGGCTTTCATGGGGG - Intronic
1069809527 10:71148130-71148152 CACAACTGCCTCCTTCAGGGAGG + Intergenic
1069963702 10:72095920-72095942 CATAGCTGGATCATTCATGGAGG - Intergenic
1070467810 10:76742219-76742241 CACAGCTGCCTGCTACCTGGGGG - Intergenic
1071436012 10:85648759-85648781 AACAGCTGCCTCTTTCCTTGGGG + Intronic
1073634886 10:105187575-105187597 CTCAGCAGCTTCCTTCATGGAGG + Intronic
1075011522 10:118874433-118874455 CACAGTTTCCTCTTTCAGGTTGG + Intergenic
1075024239 10:118972211-118972233 CACAGCTGTCTCTGCAATGGGGG + Intergenic
1075258851 10:120945759-120945781 GAGAGCTGCCCCTTTCATGGAGG - Intergenic
1078278447 11:9874559-9874581 CACAGTTGACTATATCATGGAGG - Intronic
1079591729 11:22191405-22191427 CAAAGGTGCGTCTTACATGGGGG - Intergenic
1080661497 11:34299934-34299956 CACTGCTGCCTCCTTCATAAAGG + Intronic
1081835464 11:46149812-46149834 CCCAGATGACTCTTTAATGGTGG + Intergenic
1083302488 11:61746190-61746212 CCCAGCTCCCTCTGTCAGGGTGG - Exonic
1084566719 11:69932813-69932835 CCCTGCTGACTCTTTCAAGGGGG + Intergenic
1085052148 11:73385309-73385331 CACAGCTTCCTCTTTCTCTGAGG + Intronic
1085284804 11:75352438-75352460 CACAGCTTCCTCTTCCTGGGCGG - Intergenic
1085452160 11:76640935-76640957 CACAGCTGCCTTTCTCACAGAGG + Intergenic
1088189782 11:107215687-107215709 CAGAGCTGCCCCTCTCATGTAGG - Intergenic
1088699996 11:112403261-112403283 CACAGCAGCCTTTTTCATATGGG - Intergenic
1089754573 11:120677132-120677154 CCCAGCTGTCTCTTCCCTGGTGG - Intronic
1091705919 12:2693307-2693329 GCCAGCTACCTCTTCCATGGGGG - Intronic
1092237652 12:6820112-6820134 CACTGCTGCCTCTTGAATGCAGG + Exonic
1092322200 12:7487920-7487942 CACAGTTGTCTCTATCCTGGGGG - Exonic
1092506118 12:9102053-9102075 AGCAGCTGCCTCTTTTAGGGTGG + Intronic
1096515129 12:52151530-52151552 CACAGCTGCCGCTGGCAAGGAGG + Intergenic
1099815426 12:87640537-87640559 CACAGCTGCCTGTTGCAAAGAGG - Intergenic
1100466420 12:94849536-94849558 CACAGCTGCCTCTCTGCAGGGGG - Intergenic
1102108684 12:110347882-110347904 CACAGCAGCATCTGCCATGGAGG - Intronic
1102465105 12:113125663-113125685 AACTGCTACCTCTTCCATGGAGG + Intronic
1103792040 12:123478760-123478782 CACAGTTGCCTTTTGCAGGGCGG - Intronic
1105268501 13:18846665-18846687 CACAGGTGTCTGTTTCATTGCGG + Intergenic
1106892193 13:34257740-34257762 CACATCTCCCTCTATCTTGGTGG - Intergenic
1107034393 13:35885140-35885162 CACAGATACCTCATTCCTGGTGG - Intronic
1107479358 13:40772384-40772406 CACAGTTCCCTGTTTCATGAGGG - Intergenic
1109246886 13:59965811-59965833 CACACCTGCCTTATTCATGCTGG + Intronic
1112835817 13:103512947-103512969 CACTGTTGCCACTTCCATGGTGG + Intergenic
1113707974 13:112446431-112446453 CACACCTGCCTCCTGCATGGTGG - Intergenic
1113898040 13:113778005-113778027 CACAGCTGCCTGTGCCAGGGTGG + Intronic
1114393157 14:22331824-22331846 CACAGCTGTCTCTGCCCTGGTGG - Intergenic
1119638587 14:76296700-76296722 CAGCTCTGCCTCTTTCAAGGTGG + Intergenic
1121484814 14:94306403-94306425 GAAAGCTGCCTGTGTCATGGAGG - Intronic
1121628151 14:95401903-95401925 CCATGCTGCCTCTTTCATGGTGG - Intergenic
1121698860 14:95936445-95936467 CTCAGCTGCCTCTTCCAGAGGGG - Intergenic
1122598035 14:102907155-102907177 CACACCTGCCTCCCTCAGGGTGG - Exonic
1122864096 14:104595751-104595773 CACAGATGCCTCCGTGATGGGGG - Intronic
1122865576 14:104602529-104602551 CACACCTGTCTCATTCAGGGAGG + Intronic
1123131923 14:105994242-105994264 CAAAGCTTCCTCTGCCATGGTGG + Intergenic
1123160799 14:106276486-106276508 CACAGCTGCCTCATTCCTCAGGG + Intergenic
1123176621 14:106425299-106425321 CACAGCTGCCTCCTCCCTCGGGG + Intergenic
1123195196 14:106609702-106609724 CACAGCTGCCTCCTTCCTCAGGG + Intergenic
1123208524 14:106737050-106737072 CACAGCTGCCTCCTTCCTCAGGG + Intergenic
1123481809 15:20639404-20639426 CACAGCTGCCTCCTTCCTCAAGG + Intergenic
1123636204 15:22360961-22360983 CACAGCTGCCTCCTTCCTCAAGG - Intergenic
1128260296 15:66228430-66228452 CCCAGCTGCCTCTTTCTCTGGGG - Intronic
1128667332 15:69548076-69548098 CACAGCTCCCCCATTCCTGGTGG - Intergenic
1129194763 15:73957131-73957153 CTCAGCTGCAACTTTCAGGGTGG - Intergenic
1131993659 15:98114007-98114029 CACAGCTTACTCATCCATGGTGG - Intergenic
1132877062 16:2144652-2144674 CAGAGCTGGCTCTTCCAGGGAGG - Intronic
1133270187 16:4607519-4607541 CAGCGCTGCCTCATGCATGGCGG + Intergenic
1134007145 16:10825649-10825671 CACTGCTGCCTGTTTCACAGAGG + Intergenic
1134233813 16:12450090-12450112 CAAAGCCACCTCTTACATGGTGG - Intronic
1135474609 16:22763130-22763152 CAAAGCTGCCTCTTTCCTTGGGG + Intergenic
1135505185 16:23030201-23030223 CCCAGCTGCCTATCTCAGGGAGG + Intergenic
1135900453 16:26454701-26454723 CACAGCTGATTCTGTCATGGTGG - Intergenic
1136297468 16:29311901-29311923 CACCTCTGCGTCTTTCTTGGTGG + Intergenic
1137330264 16:47487601-47487623 CACAGAGGCCTCTTTGAGGGTGG - Intronic
1140271565 16:73470823-73470845 CACGGCTACCTGTTTCCTGGGGG + Intergenic
1140720485 16:77767069-77767091 CAGAGCTGGCTCTTCAATGGAGG - Intergenic
1142059019 16:88017978-88018000 CACCTCTGCGTCTTTCTTGGTGG + Intronic
1143124309 17:4631845-4631867 CACAGCTGCCTCCTTCCTTAGGG + Intronic
1143886580 17:10069375-10069397 CAAAGCTTCCTCTTCCATGTTGG + Intronic
1145288172 17:21522033-21522055 CACAGCTGCCTGTCCCATGTGGG - Intergenic
1146505891 17:33405212-33405234 CATATCTGCCTCCTCCATGGGGG - Intronic
1148821489 17:50362341-50362363 CACAGCTAACTATTTGATGGTGG + Intronic
1151206874 17:72514314-72514336 CAAAGGCGCCTCTTACATGGTGG - Intergenic
1151971716 17:77460761-77460783 CACAGCTGCATCTTGCATCCGGG + Intronic
1152293034 17:79451618-79451640 CACGGATGCCTCTTGCATTGAGG - Intronic
1152385531 17:79972048-79972070 CACAGCAGCATCATTCATGATGG + Intronic
1154419522 18:14213336-14213358 CACAGGTGTCTGTTTCATTGCGG - Intergenic
1155517236 18:26636237-26636259 CCCATCTGTCTATTTCATGGCGG + Intronic
1157517373 18:48320586-48320608 CACAGCTGCTGCTCTCCTGGGGG + Intronic
1157862648 18:51154576-51154598 CACAGCTTTTTCTTTCATGTTGG - Intergenic
1158519422 18:58158857-58158879 CACAGTTGCCTCTTACACAGCGG - Intronic
1159007717 18:63027309-63027331 CACTGCTGCCTCTTTTTTTGGGG + Intergenic
1160533407 18:79578210-79578232 CGCAGGTGCCTCTTGCTTGGGGG + Intergenic
1161347848 19:3777018-3777040 CACTTCTGCTTCTTTCATGATGG - Intergenic
1161436081 19:4263868-4263890 CACAGCTGACTCATCCAAGGTGG + Intronic
1164536480 19:29089676-29089698 CACAGCTGTCTCTTTGACAGTGG + Intergenic
1164641609 19:29830186-29830208 GACAGCTTACTCTTTCATGATGG + Intergenic
1164792637 19:31001374-31001396 CACAGCTGCCTCTGTCCGGCAGG + Intergenic
1166719014 19:44986960-44986982 CACAGCTGCCCCCTTCAGTGGGG + Intronic
1166744118 19:45131918-45131940 CACAGGTGTCCCTTTCAGGGAGG + Intronic
1167539407 19:50075565-50075587 CCCAGCTCCTTCTTTCAGGGTGG + Intergenic
1167630304 19:50622293-50622315 CCCAGCTCCTTCTTTCAGGGTGG - Exonic
1167773672 19:51540932-51540954 CACAGCCGCCTCTTGAATAGTGG - Intergenic
1167779297 19:51587246-51587268 CACATTTGCCACATTCATGGAGG - Exonic
1168544618 19:57240382-57240404 CAGACCTGCCTCTGTCCTGGGGG - Intergenic
1168604053 19:57743898-57743920 CAAATCTGCCTCTTTGATGATGG - Intronic
926008237 2:9389291-9389313 CTCAGCAGCCTCCTTCATGTGGG - Intronic
926224102 2:10955148-10955170 CACAGCTGTCTCTGCCCTGGAGG - Intergenic
930514406 2:52388170-52388192 CACAGCTGCCTCTTCTCTAGAGG + Intergenic
931758335 2:65394377-65394399 CACAGCTGCCTCTATCCGAGTGG - Intronic
931968880 2:67564427-67564449 CAGAGCTGCAGCTTTCACGGGGG - Intergenic
933594016 2:84263827-84263849 CACAGTTCCCTATTTCTTGGAGG - Intergenic
933897555 2:86825241-86825263 CACACCTGCCCCTTTTATGTGGG - Intronic
934512021 2:94953097-94953119 CACAGCTGCCTCCTTCCTCGAGG + Intergenic
934584089 2:95474358-95474380 CTCAGCTGACTTTTTCATAGTGG + Intergenic
934595363 2:95602356-95602378 CTCAGCTGACTTTTTCATAGTGG - Intergenic
934787408 2:97023178-97023200 CTCAGCTGACTTTTTCATAGTGG + Intergenic
936484105 2:112911874-112911896 CACAACTGCCTTTGTCATGTTGG - Intergenic
936633149 2:114226318-114226340 CAAAGGTGCATCTTACATGGTGG - Intergenic
937731171 2:125231762-125231784 CACAGCTGCCTCTTTAAGTAAGG + Intergenic
937877585 2:126837091-126837113 CAAAGCTGCCATTTTCAGGGAGG - Intergenic
938116104 2:128603837-128603859 CACAGCCCCCTCTCTCAGGGTGG + Intergenic
938609190 2:132929590-132929612 CACAGCTGCCTTCTTCATCTAGG + Intronic
940413456 2:153393136-153393158 CACAGCTGCATCTGTCCTTGTGG + Intergenic
940846005 2:158642937-158642959 AACAGATGTCTTTTTCATGGAGG + Intronic
945509688 2:210685611-210685633 CTCAGCTTCCTCTCTCATGTGGG + Intergenic
947449918 2:230198319-230198341 CAGAGCTGCCTCCTGCAAGGGGG + Intronic
947536882 2:230945288-230945310 GGCAGCTGCCTCCTGCATGGAGG + Intronic
947637109 2:231685745-231685767 CCCGGCTGCCTCTTCCCTGGTGG - Intergenic
948420683 2:237858595-237858617 CACAGCTGTCTCTTTTGTGGTGG - Intergenic
1171152688 20:22841864-22841886 CTCACCTGCATGTTTCATGGTGG + Intergenic
1171182399 20:23100461-23100483 CACAGCTGCATCTTTCACGGAGG + Intergenic
1171847504 20:30285974-30285996 CAGAGCTGTCTCTTGCATGGCGG - Intergenic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1172709417 20:36909365-36909387 CACAGCTGGTTCTTTAATGTGGG - Intronic
1173326453 20:42037907-42037929 CACAGCTGCTGCTTTCCAGGAGG + Intergenic
1174693169 20:52529928-52529950 CACAGCTTCCACTTTCATCTGGG + Intergenic
1175482962 20:59324427-59324449 CCCCGCTGCCTCTTTCAGGAAGG + Exonic
1176853780 21:13945960-13945982 CACAGGTGTCTGTTTCATTGCGG + Intergenic
1178483875 21:33004718-33004740 CACAGGTTCCTGTTCCATGGGGG + Intergenic
1180120837 21:45747148-45747170 CAAAGGTGCATCTTACATGGTGG + Intronic
1180564874 22:16654516-16654538 AACAGATGCCAGTTTCATGGGGG - Intergenic
1181942925 22:26492712-26492734 AAAAGCTGCCTCTTTGGTGGTGG - Exonic
1182867299 22:33614783-33614805 CACAGCTGACAGTCTCATGGAGG - Intronic
1183347364 22:37315240-37315262 CTCAGCTTCCTCCATCATGGAGG + Exonic
1184164303 22:42718842-42718864 CCCAGCTGCCTCCTTCTTTGGGG - Intronic
1184259023 22:43304026-43304048 CCCAGCTGCGTCCTTCACGGGGG - Intronic
1184816147 22:46872656-46872678 CAAAGCTGCCTGTTTCATTAGGG - Intronic
1185148387 22:49151272-49151294 CCCACCTGCCCCTTTCATGGGGG - Intergenic
1185219055 22:49619946-49619968 CACAGCTTCCCCTTTCATCCCGG - Intronic
949857966 3:8479135-8479157 CAAAGGTGCGTCTTACATGGTGG + Intergenic
950726224 3:14918721-14918743 AACAGCAGCCTCCTTCAGGGTGG - Intronic
951111329 3:18807829-18807851 CAGTATTGCCTCTTTCATGGAGG + Intergenic
951122461 3:18944597-18944619 CACCCCTGTGTCTTTCATGGTGG - Intergenic
951241777 3:20294873-20294895 ATCAGCTCCCTCTTTCCTGGGGG + Intergenic
952722192 3:36545121-36545143 CACAGCTGCCCTTCTCAGGGAGG + Intronic
953379090 3:42453248-42453270 TGCACCTGCCTCTATCATGGTGG + Intergenic
953504147 3:43467301-43467323 CACTGCTGCCTCATTCATAACGG + Intronic
953739589 3:45525920-45525942 GTCAGATGCCTCTTTCATAGGGG + Intronic
955484495 3:59422116-59422138 CACAGTTTGCTCTTGCATGGTGG - Intergenic
956761592 3:72448605-72448627 CACAGCTGCCTCCTTAGGGGAGG + Intergenic
957042248 3:75344840-75344862 CACTGCTGCCTTTGTCCTGGTGG + Intergenic
960386426 3:117026693-117026715 TACAGCTGCGTCTGACATGGTGG - Intronic
960614833 3:119586838-119586860 CACAGCTGCCCTATTCATTGAGG - Intronic
960802386 3:121552536-121552558 CACAGCTGCCCCCTCCTTGGAGG + Intergenic
961158331 3:124700125-124700147 AAAAGGTGCCTCTTGCATGGTGG - Intronic
963479889 3:145858940-145858962 CACAACTGCATCTTGCATTGGGG - Intergenic
964070211 3:152622628-152622650 CACAGCTGTCTATTTCATCATGG - Intergenic
964137565 3:153362049-153362071 CACAGGTTTCTATTTCATGGTGG + Intergenic
965265153 3:166532946-166532968 AACACCTCCGTCTTTCATGGTGG + Intergenic
966237412 3:177717637-177717659 CATAGATGCCTCATTCCTGGTGG + Intergenic
966251118 3:177866245-177866267 CACAGCTGCCCCTTTCCTCAGGG - Intergenic
967100341 3:186210685-186210707 CACAGGTGCCTCCTCCAGGGAGG + Intronic
971519530 4:27531520-27531542 CAAAGCTGTCTCTTTATTGGAGG + Intergenic
971786365 4:31108613-31108635 CACAGCTGCTATTTTTATGGGGG + Intronic
972095389 4:35341711-35341733 CACCCCTGCATCTTTGATGGTGG - Intergenic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
976718048 4:88144362-88144384 CTCTGCTGCCTCTTTCGTGCTGG + Intronic
978554015 4:109959187-109959209 TACAGCTGCATCTCTCACGGAGG - Intronic
980346997 4:131634388-131634410 AACAGGTGCTTCTTACATGGTGG - Intergenic
980853054 4:138406855-138406877 CACAGCAGACTCTTTTGTGGGGG - Intergenic
986066710 5:4241087-4241109 CAACGCTGCCTCTTTCATGGTGG - Intergenic
986573596 5:9190348-9190370 CACAGTGCCCTCCTTCATGGAGG - Exonic
987552695 5:19404528-19404550 CACAGTCACCTCATTCATGGAGG - Intergenic
987841377 5:23226370-23226392 AACAACTGCTTCATTCATGGTGG - Intergenic
988596349 5:32595150-32595172 AACAGCTGCCTCTCCCTTGGGGG - Intronic
989293602 5:39797266-39797288 CATTGCTTCCTATTTCATGGAGG - Intergenic
989517448 5:42359797-42359819 CACAGAGGCCTTTTTCTTGGAGG + Intergenic
990977589 5:61573061-61573083 CTGAGCTGCCTGTTTCCTGGAGG - Intergenic
991976036 5:72184338-72184360 CACATCTGCCTCTTACTAGGTGG + Intronic
992326327 5:75663655-75663677 AACAGCTGCCTCTTCCTTTGTGG + Intronic
994844904 5:104976058-104976080 CAAAGGTGCCTCTTCCATGAGGG + Intergenic
995069450 5:107901853-107901875 CACAGCCCCCACTTTCACGGAGG - Intronic
995872253 5:116755971-116755993 CACAGCAGCCCCTTTCATCATGG + Intergenic
997532680 5:134591894-134591916 AGCAGCTTCCTCTTTCGTGGTGG - Intergenic
1000961594 5:167607277-167607299 AACAGCTGCCCCTTTCAGTGGGG - Intronic
1002801481 6:526409-526431 CACATCTGCCTTTTTCTTTGTGG + Intronic
1003447946 6:6201659-6201681 AACATTAGCCTCTTTCATGGAGG - Intronic
1003592582 6:7448207-7448229 CACAGCTGCCTGATTCCCGGTGG + Intergenic
1003808994 6:9758798-9758820 CACATCTGCTTCTTTCCTGTGGG - Intronic
1004430469 6:15538140-15538162 CACAGCTGACTCCTTAAAGGGGG + Intronic
1005809791 6:29506811-29506833 CACAGCAGCCTCTGTCATATGGG - Intergenic
1005951338 6:30633627-30633649 CACAACTGCCTCTGACATGGTGG - Intronic
1006562888 6:34928798-34928820 CAGAGCTGCCATTTTCAAGGTGG + Intronic
1007020805 6:38519122-38519144 CACAGCATCCTCTTGCATGTGGG + Intronic
1012028929 6:94033297-94033319 CACTGTTCCTTCTTTCATGGTGG - Intergenic
1012401002 6:98843022-98843044 CACAGTTGCCTCTGCCATGCAGG - Intergenic
1013664698 6:112335500-112335522 CACAGCAGCCTCCTAAATGGTGG - Intergenic
1014160613 6:118163665-118163687 CGCAGCTCCATCTTTCATGTGGG + Intronic
1016295130 6:142565672-142565694 CACAGTTGCCGCTTTAATGATGG + Intergenic
1016601216 6:145863129-145863151 CATAGCTGCCTCTTTCAGGCTGG - Intergenic
1019402834 7:866397-866419 CACAGCTGCCACTCTCGTGACGG - Intronic
1023624831 7:42105804-42105826 CAGAGCTGCCTCTTTGCTTGAGG - Intronic
1024150955 7:46570653-46570675 CAAAGCTGTCTGTTTCATGGGGG + Intergenic
1025129691 7:56368914-56368936 CACACCTTCCTCTCTCAGGGTGG + Intergenic
1028543656 7:91973637-91973659 CAAAGCTGCTTTTTTCTTGGTGG + Intronic
1029717120 7:102335525-102335547 CACTGATTTCTCTTTCATGGAGG + Intergenic
1031340998 7:120601503-120601525 CACAGCTGACTCTATCATGTAGG + Intronic
1031518144 7:122727066-122727088 CAAAGCTGTGTCTTTCATGAGGG - Intronic
1032982630 7:137301371-137301393 CACAGCTGTCTCCTTCCTGATGG - Intronic
1033425986 7:141244767-141244789 CACACCTTCCTCTTTCATCCTGG - Intronic
1033493031 7:141863081-141863103 CACCGCTGCCCCTTTTATGCTGG + Intergenic
1034432221 7:151046770-151046792 CACTGCTGCCTCTTCCAGGCTGG - Intronic
1037235985 8:16720000-16720022 CAAAGCCACCTCTTACATGGTGG - Intergenic
1038586269 8:28791684-28791706 CACAGCTGCCTCTTCCTTCATGG + Intronic
1039237496 8:35517925-35517947 CACAGGTGCCCCTTTCATAAGGG + Intronic
1040891622 8:52323382-52323404 GTTAGCTGCCTCTTTCAAGGAGG - Intronic
1042774988 8:72420202-72420224 CACACCTGCATCTTTCCGGGAGG + Intergenic
1043649926 8:82578674-82578696 CACAGCTGCCACTCTATTGGAGG - Intergenic
1043679744 8:83008432-83008454 CATGGCTGCCTCTTTCTTGGGGG + Intergenic
1047361740 8:124175430-124175452 CCCAGCTGCCTCTTTCAGGCTGG + Intergenic
1049357214 8:142194920-142194942 CACAGGTGCCTTGTTCATGTGGG + Intergenic
1049626763 8:143626844-143626866 AACAGCTGCCTCTATCATCACGG - Intergenic
1049755373 8:144309162-144309184 AGCAGCCGCCTCTTCCATGGGGG + Intronic
1050426767 9:5519277-5519299 CACAACTGCCTCATTTATTGGGG - Intronic
1051854283 9:21545042-21545064 CTCAGCTTCCTTTTTCATAGTGG - Intergenic
1054159820 9:61665983-61666005 CAAAGCTGCTTCTCACATGGCGG + Intergenic
1056893096 9:90514393-90514415 CTCAGCTGCCTCTTTCCTTCTGG - Intergenic
1057086150 9:92212724-92212746 CACACTTGGCTCTTTCATTGTGG - Intronic
1057165374 9:92921294-92921316 CACAGCTGCCTCCTTCCTTAGGG - Intergenic
1057175270 9:92992751-92992773 CACAGCAGCCTCGTTCACAGTGG + Intronic
1057358004 9:94347546-94347568 TACAGCTGCATCTGACATGGTGG + Intergenic
1057480184 9:95439206-95439228 CACAGCTTCCACTTACATGGCGG - Intergenic
1057649744 9:96910071-96910093 TACAGCTGCATCTGACATGGTGG - Intronic
1060009068 9:120027419-120027441 CAGAGCTACCTCCTTGATGGGGG - Intergenic
1060443395 9:123663433-123663455 CACAGGTCACTCTTTTATGGCGG - Intronic
1060470014 9:123940755-123940777 CCCAGCTCCTTCCTTCATGGAGG - Intergenic
1061289286 9:129641699-129641721 CACTCCTGCCCCTTGCATGGCGG - Intronic
1186228704 X:7429317-7429339 CTCAGCTGCCCATTTCATGGCGG + Intergenic
1187046622 X:15653679-15653701 CACAGTTGCATCTGACATGGTGG + Intronic
1187091955 X:16106328-16106350 CAAAGCCGCGTCTTACATGGTGG + Intergenic
1192767180 X:74152659-74152681 CACAGGTGCCTCCTTGAGGGTGG + Intergenic
1198594345 X:138219946-138219968 CACAGCAGCCTCTGCCATGCTGG - Intergenic
1199173494 X:144758068-144758090 CACAGCTGCATCTTCAATTGAGG - Intergenic
1199471791 X:148203862-148203884 CATAGCTGCCTAGATCATGGAGG + Intergenic
1201986717 Y:19976651-19976673 CACAACTCGGTCTTTCATGGAGG + Intergenic