ID: 900989539

View in Genome Browser
Species Human (GRCh38)
Location 1:6091995-6092017
Sequence GCCCTTGGGGTGGGGTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 371}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900989539_900989552 2 Left 900989539 1:6091995-6092017 CCCCAGGACCCCACCCCAAGGGC 0: 1
1: 0
2: 3
3: 47
4: 371
Right 900989552 1:6092020-6092042 GTGTCGATCTCCCTGGGCCTGGG 0: 1
1: 0
2: 0
3: 19
4: 146
900989539_900989549 -5 Left 900989539 1:6091995-6092017 CCCCAGGACCCCACCCCAAGGGC 0: 1
1: 0
2: 3
3: 47
4: 371
Right 900989549 1:6092013-6092035 AGGGCAGGTGTCGATCTCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 158
900989539_900989556 20 Left 900989539 1:6091995-6092017 CCCCAGGACCCCACCCCAAGGGC 0: 1
1: 0
2: 3
3: 47
4: 371
Right 900989556 1:6092038-6092060 CTGGGCCCCTGTCTGCCAACTGG 0: 1
1: 0
2: 0
3: 20
4: 209
900989539_900989550 -4 Left 900989539 1:6091995-6092017 CCCCAGGACCCCACCCCAAGGGC 0: 1
1: 0
2: 3
3: 47
4: 371
Right 900989550 1:6092014-6092036 GGGCAGGTGTCGATCTCCCTGGG 0: 1
1: 0
2: 0
3: 18
4: 88
900989539_900989551 1 Left 900989539 1:6091995-6092017 CCCCAGGACCCCACCCCAAGGGC 0: 1
1: 0
2: 3
3: 47
4: 371
Right 900989551 1:6092019-6092041 GGTGTCGATCTCCCTGGGCCTGG 0: 1
1: 0
2: 0
3: 16
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900989539 Original CRISPR GCCCTTGGGGTGGGGTCCTG GGG (reversed) Intronic
900118490 1:1038695-1038717 GGCCATGGGGTTGGGACCTGGGG + Intronic
900131226 1:1088193-1088215 GCCATGGGGGGGGGGTCCTGGGG - Intronic
900310867 1:2032582-2032604 GCCCTTGGGGCAGGAGCCTGGGG - Intergenic
900566853 1:3337559-3337581 GCCCTTGGGGTGGGAGCTGGGGG + Intronic
900688702 1:3966200-3966222 GGGCTTGGGGTAGTGTCCTGGGG + Intergenic
900989539 1:6091995-6092017 GCCCTTGGGGTGGGGTCCTGGGG - Intronic
901166895 1:7227843-7227865 GCCCTGGGTGAGGAGTCCTGGGG - Intronic
901858568 1:12059729-12059751 GTCCTTGTTGTGGGGTCGTGGGG - Intergenic
901932140 1:12602598-12602620 GCCCTGGGGGTGGGGGGCGGTGG - Intronic
902283949 1:15394250-15394272 GCCCTGGGGCTGGAGACCTGGGG + Intronic
902672584 1:17985094-17985116 GCCCCTGGGGACGGGACCTGTGG + Intergenic
902761144 1:18581502-18581524 GACCTTGGGGTGAGCTCTTGAGG - Intergenic
903673904 1:25052555-25052577 GTCCTGAGGGTGGGGCCCTGTGG + Intergenic
903681408 1:25099858-25099880 ACTCTGGGGGTGGGGTCCAGTGG - Intergenic
904464605 1:30700379-30700401 GCCCTTCTGGTGGAGTCCTAGGG + Intergenic
904680840 1:32228128-32228150 ACCCTTGGGGTGTGGTCTTGGGG + Intronic
906650511 1:47509240-47509262 GCCCTTTGGGTGGGGTGAGGTGG - Intergenic
907245048 1:53103162-53103184 GCCCCTGGGGTGGGGTGGGGAGG + Intronic
907870617 1:58439289-58439311 GCCCTGGGGGTGGTGACCAGTGG - Intronic
910677573 1:89830597-89830619 GCCCTCAGGGTGGGGTCATCAGG + Intronic
914255829 1:145960855-145960877 GCCCATGGGGGCGGGTCCTCAGG + Exonic
915340490 1:155174446-155174468 GTGCGTGGGGTGGGGTCTTGGGG - Intronic
916214578 1:162384292-162384314 GCCCCTGGGGTGGAGGCCAGAGG + Intronic
918366193 1:183810402-183810424 GTCCTTGTGGTGGGGCACTGAGG + Intronic
919751205 1:201039424-201039446 GCCCATGGGCAGGGTTCCTGGGG + Intergenic
920534555 1:206729176-206729198 GCTCTTGGGGAAGGGTGCTGAGG + Intronic
921172044 1:212558802-212558824 GCCCGAGGGGTGGGGGCCCGCGG - Intergenic
921696359 1:218215091-218215113 TGCCTTGGGGTGGGGACATGGGG + Intergenic
922783633 1:228272485-228272507 GTCCTTGGGGTGTGGGTCTGGGG + Intronic
922811229 1:228416642-228416664 GCCCGGGGCGTGGGGACCTGGGG + Intronic
923611977 1:235504127-235504149 GCCCTGCAGGTGAGGTCCTGGGG - Exonic
1065907617 10:30272212-30272234 GCCACTGGGGTGGGGTGGTGGGG - Intergenic
1066639818 10:37544604-37544626 GCCCCTGTGTTGGTGTCCTGTGG + Intergenic
1066681239 10:37938408-37938430 GCCTTTCTGGTGGGGACCTGGGG - Intergenic
1067211947 10:44266705-44266727 GCCCTGGGTGTTGGGTCCTGGGG - Intergenic
1068142134 10:53022691-53022713 TTCCTTGGGGTGGGGTGCTGGGG - Intergenic
1069594164 10:69659868-69659890 GCACTGGGGGAGGGGCCCTGGGG - Intergenic
1069598325 10:69687013-69687035 GGCATTGGAATGGGGTCCTGGGG + Intronic
1069957918 10:72062956-72062978 GCCCTTGTCGTGGGATGCTGGGG - Intronic
1071743183 10:88385717-88385739 TTCCTTCGGGTGGGGCCCTGTGG + Intronic
1072027459 10:91475911-91475933 ACCCTGGAGGTGGGGACCTGAGG + Intronic
1072788057 10:98297540-98297562 GCCCTGGGGGTGGGGGTCTAAGG + Intergenic
1073121102 10:101123066-101123088 GCCAGTGGGGTGGGATGCTGGGG - Intronic
1076545610 10:131244169-131244191 GCCCGTGGGGTGGAGGCCCGGGG + Intronic
1076794397 10:132791604-132791626 GCCCCTGCCGAGGGGTCCTGTGG - Intergenic
1076810598 10:132884606-132884628 CCCCTTGGGGTGGGCTCAGGAGG - Intronic
1077077682 11:708807-708829 CCCCTTGGGGTGCAGGCCTGGGG + Intronic
1077121557 11:911106-911128 GCCCTTGGCGTGGGGCCGCGCGG + Intronic
1077165014 11:1130962-1130984 TCCCTCTGGGTGGGGGCCTGGGG + Intergenic
1077174177 11:1181198-1181220 CCCCTGGGGCTGGGGTCCGGGGG + Intronic
1077226016 11:1439493-1439515 GCCGGTGCAGTGGGGTCCTGGGG + Intronic
1077459227 11:2700427-2700449 GCCCTCGGTGTGGAGGCCTGTGG + Intronic
1078870075 11:15335255-15335277 GCCCTTGTGGTTGGGGCTTGGGG + Intergenic
1079111866 11:17609767-17609789 GCCTGTGGGTGGGGGTCCTGGGG - Exonic
1083212603 11:61197724-61197746 GAGCCTGGGGTGGGGTCCCGGGG + Intergenic
1083724244 11:64620061-64620083 GTCCTTAGCCTGGGGTCCTGGGG - Intronic
1084043322 11:66555217-66555239 GGCCTTGGGCTGGGGTGGTGGGG - Intronic
1084509569 11:69594824-69594846 GCCCGTGGAGTGGGTTCCTGGGG - Intergenic
1084856623 11:71992948-71992970 CTTCTTGGGGTGGGGTCTTGGGG - Intronic
1085417499 11:76329112-76329134 GGCCCTGGAGCGGGGTCCTGGGG - Intergenic
1085719081 11:78897417-78897439 AACCTGGGGGTGGGGGCCTGGGG + Intronic
1085735742 11:79037340-79037362 GGCCTTGGGTTGAGGTGCTGGGG + Intronic
1088908333 11:114171430-114171452 GCCCTTTGGACGGGGCCCTGGGG + Intronic
1089280013 11:117367294-117367316 ACCCTTGAGGTGCTGTCCTGTGG + Intronic
1090423309 11:126590484-126590506 GCCCTTGAGGTGGGGACCGCTGG - Intronic
1091870086 12:3882301-3882323 GGCCTTGGGGTAGGGACATGTGG + Intergenic
1092000977 12:5032149-5032171 GCCCTTGGGGTGGCGGCAGGTGG + Intergenic
1092107248 12:5930604-5930626 GCACTTGAGGAGGGGTCCAGGGG - Intronic
1092384651 12:8026928-8026950 CATCTTGGGGTGGGGTCTTGGGG - Intergenic
1095327911 12:40920299-40920321 GCCTGTGGGGTGGGGGCATGGGG - Intronic
1096537743 12:52286277-52286299 TCCCTGGGTGTGGGGTCTTGCGG - Exonic
1097076537 12:56399043-56399065 GGTGTTGGGGTGGGATCCTGAGG - Intergenic
1099064712 12:77960067-77960089 GGCCATGGTGTGAGGTCCTGGGG + Intronic
1100554928 12:95683966-95683988 GCCCTTTGGTTGGGGTGATGAGG + Intronic
1101817510 12:108157021-108157043 GCTTATGGGGTGGGGTCCTGGGG - Intronic
1103726116 12:122998158-122998180 GGCCTTAGGGTGGGGGCCTGGGG - Intronic
1103748227 12:123140702-123140724 GCCTCTGGGGTGTGGTCCTGGGG - Intronic
1103942819 12:124510189-124510211 GCCTGTGGGGTGGGGGCTTGGGG - Intronic
1104084628 12:125462893-125462915 GCCCTTGGGTCTGGGTCATGAGG - Intronic
1104845484 12:131844792-131844814 TCCCGTGGCGTGGGGTCCCGTGG + Intronic
1104923185 12:132301655-132301677 GCCCTTGGAGGAGGGACCTGGGG + Intronic
1105016026 12:132787400-132787422 GGCCTTGGGGAGGGTTCCTGGGG - Intronic
1105016048 12:132787462-132787484 GCTCTTGGGGAGGGGTCCTGGGG - Intronic
1105245332 13:18645205-18645227 GCCCGTGGGGCTGGTTCCTGTGG + Intergenic
1107286821 13:38802549-38802571 GCCATTGGGGTGGGCTGTTGTGG - Intronic
1109594601 13:64533657-64533679 GCCCCTGGGATGGGGGCCTGAGG + Intergenic
1109649855 13:65310815-65310837 GCGCTTGGGGTGGGGCCCCCAGG + Intergenic
1110318151 13:74134154-74134176 GCGCTTGGGGTGGGGTGGGGTGG + Intergenic
1110737261 13:78951568-78951590 GCCTCTGGGATGGTGTCCTGGGG - Intergenic
1112505928 13:99975539-99975561 GCCCTTGGGCTGGGGTTCAAAGG - Intergenic
1113152724 13:107282674-107282696 GCCCCTGTGATGAGGTCCTGCGG + Intronic
1113523050 13:110954081-110954103 GCCCCTTGGCTGGGATCCTGGGG - Intergenic
1113702319 13:112396728-112396750 GCCCCTTGGCTGGGATCCTGGGG + Intronic
1113866291 13:113527804-113527826 GCTCTTTGGTTAGGGTCCTGCGG + Intronic
1113886307 13:113660368-113660390 AACCTTTGGGTGGGCTCCTGAGG - Intergenic
1114614989 14:24063497-24063519 GTCCTGGAGGTGTGGTCCTGGGG - Exonic
1119721015 14:76890517-76890539 GCCCATGGGGTGAGGAACTGAGG - Intergenic
1121369953 14:93347520-93347542 GCCGTTGGGGGAGGTTCCTGTGG + Intronic
1121438737 14:93935556-93935578 GCCCTCTGAGTGAGGTCCTGGGG + Intronic
1121797324 14:96745941-96745963 GCTCTTGGACTGGGATCCTGTGG + Intergenic
1122859122 14:104574407-104574429 GCCCTGAGTGGGGGGTCCTGAGG + Intronic
1122902353 14:104787087-104787109 GGCTTTGGGGTGGGATCCTTGGG - Intronic
1122925240 14:104896355-104896377 GCTCTTGGGGCGGGGACCAGGGG - Exonic
1125931705 15:43604778-43604800 GCCCTTTGGTTGGATTCCTGGGG - Exonic
1125944809 15:43704258-43704280 GCCCTTTGGTTGGATTCCTGGGG - Intergenic
1128452441 15:67813516-67813538 GCCTGTGGGCTGGGCTCCTGTGG - Intergenic
1129157489 15:73727913-73727935 GCCCTTGTGGCTGGGCCCTGAGG + Intergenic
1129361893 15:75029566-75029588 GCCCTGGGGGTGGGGTGATGGGG - Intronic
1130711088 15:86281692-86281714 GCCCTTGAGGTGTATTCCTGTGG + Intronic
1131093636 15:89642169-89642191 GGCCTCAGGGTGGGGTGCTGGGG - Intronic
1131134121 15:89920325-89920347 GGCCCTGGGCTGGGGACCTGGGG + Intergenic
1132025176 15:98399166-98399188 GCCCTTGAGTTGGGGTGCAGTGG + Intergenic
1132285347 15:100658518-100658540 GGCCTCGGGGTGGGGACCTGAGG - Intergenic
1132545928 16:533440-533462 GCACTCGGGCTGGGGTCCGGGGG + Intronic
1132671722 16:1104704-1104726 GCCTTTGGGGAGGTGCCCTGTGG + Intergenic
1132706463 16:1245650-1245672 GCCCGTGTGGTGGGGTCGCGTGG + Intergenic
1132719568 16:1309224-1309246 TTCCTTGGGGTCAGGTCCTGGGG - Exonic
1133041768 16:3064818-3064840 GCCTTTGGGATGGTTTCCTGGGG - Intergenic
1133815617 16:9195237-9195259 GGTCTTGGGGTGAGGGCCTGGGG + Intergenic
1134635077 16:15785945-15785967 CCACTTGGGGTGGGGACCTGGGG - Intronic
1134820663 16:17244252-17244274 TCCCTGGGGGTGGGGCCTTGGGG + Intronic
1136621407 16:31431180-31431202 AGCATTGGGGTGGGGTCCAGTGG + Intergenic
1137594860 16:49716768-49716790 GCCAGTGGGCTGGGGTGCTGGGG + Intronic
1138330812 16:56213992-56214014 GGCTTGGGGGTGGTGTCCTGTGG + Intronic
1138632162 16:58306170-58306192 GGGCTGGGGGTGGGGACCTGGGG + Intronic
1139947068 16:70648710-70648732 GCCCAGGGGCTGGGGTGCTGAGG + Intronic
1140409795 16:74734690-74734712 GCCCAGGAGGAGGGGTCCTGGGG - Intronic
1141614483 16:85202682-85202704 GCCCCTTGGGAGGGGCCCTGGGG + Intergenic
1141925158 16:87163527-87163549 GCCCTTGAGGTGTGGTGCTTGGG - Intronic
1142027090 16:87820151-87820173 GTCCCCTGGGTGGGGTCCTGGGG + Intergenic
1142113104 16:88342434-88342456 GCCATTGGAGTGGGGAGCTGAGG - Intergenic
1142129995 16:88428076-88428098 GCCCCGGGGCTGGGGGCCTGGGG - Exonic
1142140011 16:88468687-88468709 GCCATGGGGGTGGGGCTCTGGGG - Intronic
1142184568 16:88688422-88688444 ACCTTTGGGGTGGGGTCCCAGGG + Intergenic
1142367405 16:89657432-89657454 GCCCTGGGGATGGGGTCCCGGGG + Intronic
1143620170 17:8076040-8076062 GGCCTTGGGGAAGGGGCCTGGGG - Intronic
1144084784 17:11798861-11798883 GCCATTGGGGTGGGGGACTGGGG - Intronic
1144497285 17:15756766-15756788 GGGCCAGGGGTGGGGTCCTGCGG - Intergenic
1144652342 17:17014860-17014882 GAGCCAGGGGTGGGGTCCTGCGG + Intergenic
1144668305 17:17116859-17116881 GCCCTTGCCTTGGGGCCCTGGGG - Intronic
1144813791 17:18019186-18019208 TCCCTGGGGGTGGGGTGGTGGGG - Intronic
1146054259 17:29573385-29573407 TCCCTAGGGCGGGGGTCCTGGGG + Intergenic
1146952562 17:36916912-36916934 GGCCCTGGGGTGGGGTGCAGCGG - Intergenic
1147541458 17:41363732-41363754 TGCCTCGGGGTGGGGTCCGGTGG + Exonic
1147907420 17:43832452-43832474 TCCCTTTGGGTTGGGTCTTGGGG - Intronic
1147972998 17:44229811-44229833 GCAGTTGGGGTGGGTTCGTGAGG + Intergenic
1148451228 17:47778969-47778991 GGTCTTGGGGTGGGGGGCTGGGG - Intergenic
1149596679 17:57868410-57868432 GCTCCTGGGGTGGCGTCCTCAGG - Intronic
1151645445 17:75427836-75427858 GCCTTGGGGGTGGGGGCTTGGGG - Intergenic
1151965495 17:77429125-77429147 GCTCCTGGGGTGGGGACTTGGGG + Intronic
1152097261 17:78279259-78279281 GGCCTTGGGGCAGGTTCCTGGGG + Intergenic
1152305725 17:79519246-79519268 GCCCTGGGGGTGGGGGCGTGGGG - Intergenic
1152897756 17:82923010-82923032 GGCCTTGGGATGGGTTCCCGGGG + Intronic
1152911964 17:83010119-83010141 GCCCCTGGTGTGGGGTGCTGTGG + Intronic
1154388765 18:13918753-13918775 GGGCCTGGGGTGGGGTCCTGGGG - Intergenic
1154443614 18:14414742-14414764 GCCCGTGGGGCTGGTTCCTGTGG - Intergenic
1155822636 18:30397646-30397668 GACCTTGCAGTGGGGTACTGTGG - Intergenic
1156525629 18:37765004-37765026 TCCCTTGGGGTGGGTCACTGTGG + Intergenic
1156595457 18:38543100-38543122 GACCATGGGGTTGGGTCATGTGG + Intergenic
1158452628 18:57580734-57580756 CCCCGTGGGGTGGGGTGCAGTGG - Intronic
1158520852 18:58170664-58170686 CCCCTTGGGCTGGGGTGATGAGG - Intronic
1158520863 18:58170705-58170727 CCCCTTGGGCTGGGGTGATGAGG - Intronic
1158520937 18:58171033-58171055 CCCCTTGGGCTGGGGTGATGAGG - Intronic
1158520984 18:58171238-58171260 CCCCTTGGGCTGGGGTGATGAGG - Intronic
1158521013 18:58171361-58171383 CCCCTTGGGCTGGGGTGATGAGG - Intronic
1158521034 18:58171443-58171465 CCCCTTGGGCTGGGGTGATGAGG - Intronic
1158632962 18:59132145-59132167 GCGGTTGGGGTGGAGCCCTGGGG + Intergenic
1159102580 18:63971855-63971877 GCCCCTGGGGTGGGTTTCTATGG - Intronic
1160500893 18:79400665-79400687 GCGCTCGCGGCGGGGTCCTGGGG + Intronic
1160540406 18:79617495-79617517 TCCCGGGGGGCGGGGTCCTGGGG - Intergenic
1160930198 19:1566806-1566828 GCCCCGGGTGTGGGGTCCAGCGG - Intronic
1161089730 19:2353781-2353803 GCCCGTGGGGCGGGGTTTTGGGG + Exonic
1161090900 19:2359824-2359846 GCCCTGGGGGCGAGGTGCTGAGG - Intergenic
1161108113 19:2454723-2454745 TGCCATGGGTTGGGGTCCTGGGG - Intronic
1161208720 19:3055630-3055652 GGCCTTGGGGAGGGGTTGTGAGG - Intronic
1161251154 19:3281049-3281071 GCTCCTGGGGTGGGGGCCCGTGG + Intronic
1161966181 19:7550459-7550481 GGCCTAGGGGTGGGGACCTGGGG + Intronic
1162013273 19:7830568-7830590 GCTCCTGGGGAGGGGTCCGGAGG - Intronic
1162057651 19:8074285-8074307 GCCTGGGGGGTGGGGTCGTGTGG + Intronic
1163034789 19:14564349-14564371 GGCCTTGGGGTGGGGCTCGGTGG - Intronic
1163400541 19:17089586-17089608 GCCCTGGGGGTGGGGGTCAGTGG - Intronic
1163729413 19:18940771-18940793 GGACCTGGGGTGGGGTACTGGGG - Intronic
1164793964 19:31011553-31011575 GGCCTGGGGGTGGGGACCTCTGG - Intergenic
1165232622 19:34396536-34396558 TCCCATGGGCTGGGGTCATGTGG + Intronic
1165489622 19:36115680-36115702 GCCATGGGGGCGGGGTCCGGAGG + Intronic
1166106860 19:40601798-40601820 GCTTTTGGGGTTGGGTCCTGAGG + Intronic
1166709473 19:44927433-44927455 CCCCTTGGGGTGGGATCCCGGGG - Intergenic
1167146011 19:47681112-47681134 GCCTGTGGGGTGGGGGCCTGCGG - Exonic
1167261803 19:48462970-48462992 CCTCTAGGTGTGGGGTCCTGCGG + Intronic
1167266952 19:48487970-48487992 GACCATGGTGTGGGGGCCTGAGG - Intronic
1167565801 19:50255942-50255964 GCCCTAGCTGTGGGTTCCTGAGG + Intronic
1167621882 19:50565305-50565327 GCCCTTGCCTTGTGGTCCTGTGG - Intronic
1168242507 19:55094566-55094588 GGGCTTTGGGTGGGCTCCTGAGG - Intronic
1168276150 19:55279807-55279829 GACTTTGGGGAAGGGTCCTGTGG - Intronic
925633118 2:5915521-5915543 CACCTTGCGGTGGGGCCCTGGGG + Intergenic
925893482 2:8454674-8454696 GCCCATGTGGTGAGGGCCTGCGG - Intergenic
926681150 2:15665157-15665179 GCCCTGGGGGTGCGGCCATGAGG + Intergenic
927840300 2:26437425-26437447 GCCCTTGCGGAGGGAACCTGGGG - Intronic
928336646 2:30404224-30404246 CACCTTGGCCTGGGGTCCTGTGG + Intergenic
928694467 2:33835088-33835110 GGCCTTGGGTTGGGGGCTTGGGG + Intergenic
931694987 2:64864987-64865009 GTCTCCGGGGTGGGGTCCTGGGG - Intergenic
932589888 2:73059011-73059033 GACCTTGGGGAGGGACCCTGTGG - Intronic
932863885 2:75321536-75321558 GGCCTTGGGGTGGGATCAGGTGG + Intergenic
933764586 2:85698109-85698131 GCCCCTGGGGTCGGGAGCTGGGG + Intronic
933969165 2:87456248-87456270 GCGCTGGGGGTGGGGGACTGGGG + Intergenic
933970209 2:87463885-87463907 TCCCTTGGGCTGGGGGCCTCAGG + Intergenic
934056063 2:88252696-88252718 GCCACTGGGGAAGGGTCCTGGGG - Intergenic
934475074 2:94588273-94588295 GGCCTGGGGTTGGGGTCCTGGGG + Intergenic
934898807 2:98140951-98140973 GCCATTGGTGAGGGGGCCTGGGG - Intronic
936323572 2:111486611-111486633 TCCCTTGGGCTGGGGGCCTCAGG - Intergenic
936324626 2:111494260-111494282 GCGCTGGGGGTGGGGGACTGGGG - Intergenic
936457142 2:112683673-112683695 GCCCTTGCTGTGGGCTCCTCGGG + Intergenic
936462020 2:112721163-112721185 GCACCTGGGGTGGGGGCCAGGGG + Intergenic
938314799 2:130318083-130318105 CCCCATGGGTTGGGGTCCTCAGG + Intergenic
938403015 2:131009136-131009158 GACATTGTGGTGGTGTCCTGTGG + Intronic
938540278 2:132279610-132279632 GGGGGTGGGGTGGGGTCCTGTGG - Intergenic
938960407 2:136335679-136335701 GCCATAGGGCTGGGTTCCTGAGG + Intergenic
939805927 2:146776023-146776045 GGTGTTGGGGTTGGGTCCTGAGG - Intergenic
940987400 2:160062722-160062744 GCCTTTGGGGTGGGGACAGGCGG + Intergenic
942080572 2:172396214-172396236 ACCCCTGGGGAGGGGTGCTGGGG - Intergenic
947618943 2:231576408-231576430 GCTCCAGGGGTGGGTTCCTGTGG - Intergenic
947857453 2:233333713-233333735 GCCCTTGGGGTTGGGCTCAGAGG - Intronic
947949654 2:234136170-234136192 GCCCGTGGGGCAGGGTCCAGCGG - Intergenic
948153626 2:235764661-235764683 GCCCGTGGGGTGGGGGCATCTGG + Intronic
948153637 2:235764688-235764710 GCCCGTGGGGTGGGGGCATCTGG + Intronic
948153648 2:235764715-235764737 GCCCGTGGGGTGGGGGCATCTGG + Intronic
948153659 2:235764742-235764764 GCCCGTGGGGTGGGGGCATCTGG + Intronic
948710961 2:239825300-239825322 GCCTGTGGGGAGGGGACCTGGGG + Intergenic
948866217 2:240776098-240776120 GCCTCTGGGGTGGCGGCCTGGGG - Intronic
1169730221 20:8778108-8778130 GCCCAAGGGTTGGGGCCCTGGGG - Intronic
1170032610 20:11958622-11958644 TTCCTTTAGGTGGGGTCCTGGGG + Intergenic
1170892224 20:20385712-20385734 CTCCTTGGCGTGGGGTCCTCAGG - Intergenic
1171044519 20:21797696-21797718 ACACTGAGGGTGGGGTCCTGTGG + Intergenic
1171344398 20:24455051-24455073 CCAACTGGGGTGGGGTCCTGGGG - Intergenic
1171365190 20:24618113-24618135 GCCCGGGGAGGGGGGTCCTGAGG + Intronic
1171444944 20:25196306-25196328 GGCATTGGGGTGGTGTCCCGAGG + Intronic
1171869204 20:30512614-30512636 GGGGGTGGGGTGGGGTCCTGTGG - Intergenic
1171942489 20:31344933-31344955 GCCCATAGGGAGGGATCCTGAGG - Intergenic
1172090948 20:32432214-32432236 GCACATGGGGTGGGGTCCAGGGG + Intronic
1172110033 20:32539123-32539145 GCCCTTGGGCTGGGACCCAGAGG - Intronic
1173464671 20:43271515-43271537 GTCCTTGGCCTGTGGTCCTGAGG - Intergenic
1174332605 20:49831947-49831969 GTCCTTGGGAGGGGGTCCTCAGG + Intronic
1174577681 20:51548178-51548200 GGCCCTGGGGTGGGGTCATGTGG - Intronic
1174719043 20:52791116-52791138 CCCCTTGGGGTGGGATCAAGGGG + Intergenic
1175397925 20:58680123-58680145 ACCCTTGGCGTTTGGTCCTGAGG + Intronic
1175401270 20:58701237-58701259 GCCCTGGGGGTGGGGTGGGGTGG + Intronic
1175803451 20:61814050-61814072 GCACCTGGGGTGGGCTCCTCTGG - Intronic
1175895017 20:62332340-62332362 CCCCTTGGGGTGGGGACCTGAGG + Intronic
1176040149 20:63060920-63060942 GCCCTGGGGGTGGGGGGCTCTGG + Intergenic
1176075843 20:63247904-63247926 GCCCTGGGGGCGGGGTGCAGTGG - Intronic
1176383198 21:6123976-6123998 GCCACTGGGGAAGGGTCCTGAGG - Intergenic
1176452474 21:6876496-6876518 GCCCGTGGGGCTGGTTCCTGTGG + Intergenic
1176830647 21:13741545-13741567 GCCCGTGGGGCTGGTTCCTGTGG + Intergenic
1177767990 21:25480465-25480487 TCACTTGGGTTGGGGTCATGGGG - Intergenic
1179133846 21:38661855-38661877 TCCCTTGGGGTGGGGGGCGGGGG - Intergenic
1179585275 21:42370486-42370508 GCCCTGGGGTTGGGGTCCTCAGG + Intergenic
1179740269 21:43414263-43414285 GCCACTGGGGAAGGGTCCTGAGG + Intergenic
1179999599 21:44989315-44989337 CCCCCTGGGTGGGGGTCCTGGGG + Intergenic
1180008639 21:45035078-45035100 GCTCTTTGGATGTGGTCCTGGGG - Intergenic
1180056051 21:45359744-45359766 GCCCTTGCGGGGGGGTTCTCTGG - Intergenic
1180916846 22:19494757-19494779 GCCCTTGAGGTGGGTCCCGGGGG + Intronic
1180955693 22:19740258-19740280 GTATTCGGGGTGGGGTCCTGGGG - Intergenic
1181103927 22:20560681-20560703 GTCCCTGGGGTTGGGTGCTGTGG - Intronic
1181174364 22:21027441-21027463 GCCCTGGGGGTGGGAGGCTGTGG + Exonic
1182434282 22:30320386-30320408 GCCCTGGGTGTGGGGACCTCAGG + Intronic
1183038921 22:35161669-35161691 GGCCTTGGATCGGGGTCCTGTGG + Intergenic
1185410258 22:50678062-50678084 GTCCCTGGGGTGGGGGTCTGCGG + Intergenic
949855096 3:8453940-8453962 GCCCTGGTGGTGGTGTGCTGGGG - Intergenic
949966813 3:9363613-9363635 GTGCTTGGGGTGGGGGCCGGGGG - Intronic
950184398 3:10936403-10936425 GTCCCTGGGGTGTGGCCCTGGGG - Intronic
950482829 3:13255188-13255210 TCCCTTGGGCTGGGGTGCTGGGG - Intergenic
950560051 3:13715867-13715889 GCCTTTGGGGTGGGGGCCATGGG + Intergenic
954663666 3:52239148-52239170 GCCGCTGGGGGCGGGTCCTGCGG - Exonic
956119784 3:65954778-65954800 GCCCTGGGGGTTGGGGCCTGTGG - Intronic
958917404 3:100064876-100064898 GGCCTGGGGGTGGGGTGGTGGGG + Intronic
960500939 3:118437470-118437492 GTCCCTGGGGTTGGGCCCTGTGG + Intergenic
961157292 3:124691021-124691043 ACCCTTGGGCTAGGGCCCTGAGG + Intronic
961389260 3:126542655-126542677 GCTCTTGAAGAGGGGTCCTGGGG - Exonic
961492039 3:127263128-127263150 GCCTTAAGGGTGGGGCCCTGAGG - Intergenic
961554574 3:127689288-127689310 GGCCTGGAGGTGGGATCCTGTGG + Exonic
961791670 3:129380895-129380917 TCCCCTGGGGTGGGGGCTTGAGG + Intergenic
961805693 3:129487846-129487868 TCCCCTGGGGTGGGGGCTTGAGG + Intronic
963684970 3:148421752-148421774 GTCCTTGGGGTCAGTTCCTGGGG + Intergenic
963956664 3:151261656-151261678 GCCTCTGGGGAGGGGTCCAGTGG + Intronic
968600013 4:1504296-1504318 GTCCTTGGGGTGGGGTCACTGGG + Intergenic
969327739 4:6453479-6453501 GCCCCTGGGGTGGGGTGGGGTGG - Intronic
969410069 4:7022227-7022249 GCTCTTGGAGTGGAGTCCAGGGG + Intronic
969606617 4:8205233-8205255 CCCCATGGGGAGGGGTCCTGTGG + Exonic
969686016 4:8674706-8674728 ACCCGTGGGGTGGGGCCCTGTGG + Intergenic
970629209 4:17923008-17923030 GGTGTTGGGGTTGGGTCCTGAGG - Intronic
972312725 4:37895917-37895939 CCCGTTGGGGTGGAATCCTGTGG + Intronic
975112588 4:70643727-70643749 GCCCTTGGGCTTGTATCCTGTGG - Exonic
975415770 4:74102613-74102635 GGCTTTGGGTTGTGGTCCTGCGG + Intergenic
977988538 4:103414951-103414973 GCTGTAGGGGTGGGGTCCTCAGG + Intergenic
978559891 4:110021999-110022021 GGCCCTGGGGTGGGGCACTGAGG - Intergenic
979306959 4:119156872-119156894 GCCCTTGGGGAGGGGCTGTGTGG + Intronic
982209529 4:153023254-153023276 GCCCTCAGGGTGGGGTCTAGGGG + Intergenic
982416498 4:155139591-155139613 GGCCTGGGGGTGGGGTTCTAGGG - Intergenic
984316521 4:178137989-178138011 TCCCATGAGGTGGGGTCCTGTGG - Intergenic
985728282 5:1526902-1526924 GCCCAGGGGGTGGGGAGCTGGGG + Intergenic
986233603 5:5887367-5887389 GCCCTCGAGGACGGGTCCTGTGG + Intergenic
987364357 5:17135552-17135574 GCCATGGTGGTGGGCTCCTGTGG + Intronic
987965277 5:24864652-24864674 GCCCTTGGCCTGGGGGCCGGGGG + Intergenic
989195720 5:38714343-38714365 GCCCACAGGGTGGTGTCCTGGGG - Intergenic
991618258 5:68518603-68518625 CCCTTTGGGGTTTGGTCCTGAGG + Intergenic
997625511 5:135328211-135328233 GCCCTTGGGGTGAGGCAGTGAGG + Intronic
998993492 5:147845095-147845117 GCCATTGGAGTGGGGTTTTGTGG + Intergenic
999237705 5:150109029-150109051 CTCCTTGGGATGGGGTTCTGGGG - Intronic
999648928 5:153746656-153746678 GCTCTGGGGGTGGGGGCCTCTGG + Intronic
1001828327 5:174764561-174764583 GCCCTTGGGTGGGTGTCCAGGGG - Intergenic
1002196679 5:177504962-177504984 GCCCTGGGTGTGGGGGGCTGAGG + Intronic
1002404687 5:179020947-179020969 GGGGTTGGGGTGGGGTGCTGAGG - Intergenic
1002640355 5:180627849-180627871 GCCCTTGGGGCAGAGTCCTGAGG - Intronic
1005738776 6:28772371-28772393 GCCCTTCTGGTAGGGACCTGAGG + Intergenic
1005987754 6:30884752-30884774 GCTCTTGGGGTGGGGGCGCGCGG + Intronic
1006373596 6:33659689-33659711 GCCATGTGGGTGGGGCCCTGTGG - Intronic
1006514046 6:34536295-34536317 GCCCTGAGGGTGGGGTCCCATGG + Intergenic
1006682272 6:35805635-35805657 GGCCCTGGGCTGGGGTCCCGTGG - Exonic
1006787285 6:36677145-36677167 GGGCTTAGAGTGGGGTCCTGAGG + Intronic
1007359580 6:41345516-41345538 GCCCTTGGTGGCGGGTGCTGGGG - Intronic
1007629044 6:43262719-43262741 GCCGCTGGCGTGGGGTCCTTGGG + Intronic
1007637519 6:43308193-43308215 GGCCTTGGGGTTGGCTACTGAGG + Intronic
1009806159 6:68604359-68604381 GCTGTTGGGGGTGGGTCCTGTGG - Intergenic
1011745781 6:90406660-90406682 TCCCTGGGGCTGGAGTCCTGGGG + Intergenic
1011914745 6:92489264-92489286 GTCCTTGAGGTGGGGGCATGGGG + Intergenic
1015881924 6:137878777-137878799 GCCCTTGGCGTGGAACCCTGAGG + Exonic
1017057879 6:150454229-150454251 CCCCTTGGGGTTGGCTGCTGCGG + Intergenic
1017208688 6:151831546-151831568 GCCCTTTGGGTGGGCTCCCAAGG + Intronic
1018966982 6:168497089-168497111 GCCCTGGGGCTGCCGTCCTGGGG + Intronic
1019153463 6:170023859-170023881 GCCCTGGAGGTGGGGTCCCCCGG + Intergenic
1019310390 7:357604-357626 GCCCTGCGGGTGGGGCCCTGGGG + Intergenic
1019354059 7:569853-569875 GCCCTCGGGGTCTGGCCCTGGGG - Intronic
1019370486 7:660479-660501 TCTGTTGGGGTGGGGACCTGTGG - Intronic
1019371129 7:662496-662518 TCTGTTGGGGTGGGGACCTGTGG - Intronic
1021521600 7:21543737-21543759 GCACGTGGGGAGGAGTCCTGCGG - Intronic
1024047516 7:45595305-45595327 GCCCCTAGGGTGGGGCCCAGGGG + Intronic
1024590088 7:50873335-50873357 GCCCTTTGGATGGGGTTTTGTGG - Intergenic
1024985874 7:55192631-55192653 GGCCTGGGGGACGGGTCCTGGGG + Intronic
1025057264 7:55775212-55775234 GGCCATGGGGTGGGGTCGGGTGG + Intergenic
1026614423 7:71888825-71888847 GAGCTTGGGGTGGGGTGCTTTGG + Intronic
1028215069 7:88121623-88121645 GCCCATGTGGTGAGGTACTGAGG - Intronic
1028343964 7:89757730-89757752 GGCCTTGGGGTAGAGACCTGTGG - Intergenic
1028905274 7:96147003-96147025 GCCCTTGGCTTTGAGTCCTGTGG - Intronic
1029112870 7:98222566-98222588 GTCCTGGAGGTGGGGCCCTGGGG - Intronic
1029201783 7:98844020-98844042 GGCATGGGGGTGGGCTCCTGCGG + Intergenic
1029495774 7:100895020-100895042 GAACTTGGGGAGGGGGCCTGGGG + Intronic
1030049019 7:105521966-105521988 CCTCTTGGGGCGGGGCCCTGGGG + Intronic
1030315454 7:108109717-108109739 CCCCTTGGAGTGGGGACCTGTGG + Intronic
1031676249 7:124615885-124615907 GGCCTTGGGGGTGGGTCCTGAGG - Intergenic
1032488628 7:132307149-132307171 GCCCTTGGTGTGGGGTTGTAGGG - Intronic
1033137306 7:138796208-138796230 GCTCTCGGTGTGGGGACCTGGGG - Intronic
1033314750 7:140288017-140288039 GCCTTTGGGGTGGGGTGGGGGGG - Intergenic
1033504535 7:141986590-141986612 TCCCTTGGGGTAGGGGACTGAGG + Intronic
1034548456 7:151804759-151804781 GCACTTGAGGTGGCATCCTGTGG + Intronic
1034949621 7:155288173-155288195 GCCCCTGGGGTGTGCTGCTGGGG - Intergenic
1035096442 7:156360008-156360030 GTCCTTGGCGTGGGGTCCTGGGG + Intergenic
1035325243 7:158061716-158061738 GTCCTTCAGGTGTGGTCCTGGGG - Intronic
1035662754 8:1360087-1360109 GCCCTTTGTGTGGGGTTCGGAGG + Intergenic
1036236415 8:7043063-7043085 ACCCTTGGGTTGGGGCGCTGTGG + Intergenic
1036634259 8:10538269-10538291 GCGTTGGGGGTGGGGTGCTGTGG - Intronic
1039380589 8:37081286-37081308 GTCCTTGGGGTGCTGTCCTCTGG + Intergenic
1039437184 8:37567664-37567686 GCCCTGGGGGTGGGGGCCCCGGG + Intergenic
1040598147 8:48859845-48859867 GACCCTCGGGTGGGTTCCTGAGG + Intergenic
1040909446 8:52503023-52503045 GCCCTTCAGGTGGCATCCTGAGG - Intergenic
1041457200 8:58074098-58074120 GGCAGTGGGGTGGGGTCCGGAGG - Intronic
1046803192 8:118451383-118451405 GCCCTTGAGTTGGAGTCATGTGG - Intronic
1046918163 8:119699366-119699388 GTCCCTGTGGAGGGGTCCTGGGG - Intergenic
1047523924 8:125616382-125616404 GGCCTTGAGCTGGGGGCCTGTGG + Intergenic
1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG + Exonic
1052854978 9:33401489-33401511 GGCCTGGGGCTGGGGTCCTGGGG - Intronic
1052998793 9:34565941-34565963 GCAGTTGGGGTGGGGGGCTGCGG + Intronic
1053275947 9:36783389-36783411 GCCCATGGGGTGGGGTGGGGTGG + Intergenic
1053682998 9:40497818-40497840 GGCCTGGGGTTGGGGTCCTGGGG - Intergenic
1053932980 9:43126132-43126154 GGCCTGGGGCTGGGGTCCTGGGG - Intergenic
1054280716 9:63127110-63127132 GGCCTGGGGTTGGGGTCCTGGGG + Intergenic
1054296098 9:63333318-63333340 GGCCTGGGGTTGGGGTCCTGGGG - Intergenic
1054394114 9:64637813-64637835 GGCCTGGGGTTGGGGTCCTGGGG - Intergenic
1054428764 9:65143026-65143048 GGCCTGGGGTTGGGGTCCTGGGG - Intergenic
1054501616 9:65878517-65878539 GGCCTGGGGTTGGGGTCCTGGGG + Intronic
1055554862 9:77463744-77463766 GTCCTTGGTGGGGGTTCCTGGGG - Intronic
1056435257 9:86569643-86569665 TCGTTTGGGGTGGGGTCTTGGGG + Intergenic
1056771063 9:89478769-89478791 GGCCTTGGGGTGGGGTGGGGTGG - Intronic
1057494967 9:95553516-95553538 GCCCGTGGGGTGGGGGGCCGCGG - Intergenic
1057557671 9:96100568-96100590 GTGCTGGGGGTGGGGGCCTGGGG - Intergenic
1057786104 9:98088156-98088178 GCCCCTGGGGCGGGGTCTTGGGG + Intronic
1058868689 9:109184081-109184103 ACCCTTGGGGTGAAGTCTTGGGG + Intronic
1059424191 9:114210619-114210641 GCCCCTGGGGTGGTGGCCTCGGG + Intronic
1060475109 9:123980940-123980962 GCCCTAGGGCTGGGGTCCCCGGG + Intergenic
1060946801 9:127574517-127574539 GGTCTTGGGCTGGGCTCCTGCGG - Intronic
1061052620 9:128205176-128205198 GCCCTTGGGGAAGGGGCCCGTGG - Intronic
1061418839 9:130462394-130462416 GCCCTGGTGCTGGGGTCTTGGGG + Intronic
1061425049 9:130493523-130493545 GCTTCTGGGATGGGGTCCTGGGG - Intronic
1061913445 9:133737255-133737277 TCCCTTGGGATGGGGCACTGGGG - Intronic
1061932965 9:133842795-133842817 GCCCTGGGCGTGGGGTCCCATGG - Intronic
1061968895 9:134032990-134033012 GCCCTTGGGGGGTGGTCGGGTGG - Exonic
1062019255 9:134308691-134308713 TCCCATGGTGTGGGCTCCTGTGG - Intergenic
1062039286 9:134396704-134396726 GAGCTTGGGGTAGGGTCCCGTGG - Intronic
1062232450 9:135489426-135489448 GCCCTTTGGGTGGCTTTCTGTGG + Intergenic
1062267344 9:135693247-135693269 GCCCTGGGGTAGGGGTGCTGTGG - Intergenic
1062324589 9:136005993-136006015 GCTCTGGGGCTGGTGTCCTGGGG - Intergenic
1062326559 9:136015269-136015291 GCCCCTGGGGTTGGGCTCTGGGG - Intronic
1062365695 9:136207978-136208000 GGCCTTGGGCTGTGGACCTGGGG - Exonic
1062423987 9:136497684-136497706 GACGCTGGGGTGGGGTCCTGAGG - Intronic
1062526105 9:136978665-136978687 GCTCTTGGGGCGGGGTCGTGAGG + Intronic
1062577311 9:137214736-137214758 GCCCTTGGGGTGGGGGCCCAGGG - Intronic
1062580824 9:137228534-137228556 ACCTCTGGGGTGGGCTCCTGGGG + Intronic
1062582454 9:137234565-137234587 GGGCTCGGGCTGGGGTCCTGTGG + Intronic
1203516707 Un_GL000213v1:8019-8041 GCCCGTGGGGCTGGTTCCTGTGG - Intergenic
1185543894 X:926371-926393 GCCCTTCCTCTGGGGTCCTGTGG - Intergenic
1185764530 X:2714995-2715017 GTCCTTGGGGAGGGGTCTAGAGG + Intronic
1186094867 X:6089629-6089651 CCCTTTGGGGTGGGGTCATAAGG - Intronic
1192074760 X:67982281-67982303 GCACCTGGGCTGAGGTCCTGTGG - Intergenic
1192354123 X:70383880-70383902 GGCTTTGGGGTGGGGTGATGGGG + Intronic
1192546201 X:72017062-72017084 GTCTGTGGGTTGGGGTCCTGTGG + Intergenic
1192564465 X:72152033-72152055 GCCCCTGGGATGGGCTCCTTGGG + Intergenic
1193978201 X:88149808-88149830 GCCATGGGTGTGGGGTCCTCTGG - Intergenic
1199559285 X:149146174-149146196 TCCCTTGGGGTCAGGCCCTGGGG + Intergenic
1199708504 X:150451412-150451434 GCCCTGTGGGTGTGGGCCTGGGG + Intronic
1199967962 X:152835448-152835470 GCCTGGGGGGTGGGGGCCTGGGG - Intronic
1200041019 X:153369430-153369452 GCCCTTGATCTGGGGTCCAGGGG - Intergenic
1200142166 X:153907756-153907778 GCCCTGGGGGTGGGAAGCTGAGG + Exonic
1200793978 Y:7323886-7323908 GCCCTTGGTGAAGGGGCCTGAGG + Intergenic