ID: 900991298

View in Genome Browser
Species Human (GRCh38)
Location 1:6099580-6099602
Sequence CTAAAGCCGCCCGCCAGCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900991297_900991298 -9 Left 900991297 1:6099566-6099588 CCTGTAGACTTTCTCTAAAGCCG 0: 1
1: 0
2: 0
3: 4
4: 69
Right 900991298 1:6099580-6099602 CTAAAGCCGCCCGCCAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 141
900991296_900991298 -8 Left 900991296 1:6099565-6099587 CCCTGTAGACTTTCTCTAAAGCC 0: 1
1: 0
2: 3
3: 12
4: 144
Right 900991298 1:6099580-6099602 CTAAAGCCGCCCGCCAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 141
900991290_900991298 26 Left 900991290 1:6099531-6099553 CCGGCCCTGTGCACAAGGATGCA 0: 1
1: 0
2: 0
3: 15
4: 189
Right 900991298 1:6099580-6099602 CTAAAGCCGCCCGCCAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 141
900991295_900991298 -7 Left 900991295 1:6099564-6099586 CCCCTGTAGACTTTCTCTAAAGC 0: 1
1: 0
2: 1
3: 9
4: 128
Right 900991298 1:6099580-6099602 CTAAAGCCGCCCGCCAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 141
900991294_900991298 1 Left 900991294 1:6099556-6099578 CCTCTCGGCCCCTGTAGACTTTC 0: 1
1: 0
2: 0
3: 5
4: 90
Right 900991298 1:6099580-6099602 CTAAAGCCGCCCGCCAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 141
900991291_900991298 22 Left 900991291 1:6099535-6099557 CCCTGTGCACAAGGATGCACTCC 0: 1
1: 0
2: 1
3: 5
4: 151
Right 900991298 1:6099580-6099602 CTAAAGCCGCCCGCCAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 141
900991292_900991298 21 Left 900991292 1:6099536-6099558 CCTGTGCACAAGGATGCACTCCT 0: 1
1: 0
2: 0
3: 13
4: 133
Right 900991298 1:6099580-6099602 CTAAAGCCGCCCGCCAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900991298 Original CRISPR CTAAAGCCGCCCGCCAGCCC AGG Exonic
900100824 1:961237-961259 CTGGAGCCGCCCGCCCGCCCTGG - Intronic
900991298 1:6099580-6099602 CTAAAGCCGCCCGCCAGCCCAGG + Exonic
901020900 1:6254914-6254936 CCACAGCCGCCTGCCAGCTCCGG - Exonic
903448443 1:23437093-23437115 CTTAAGCCTCCCTCCTGCCCCGG + Intronic
905375162 1:37514949-37514971 GTAAAGCCGGCGGCCAGCCGAGG - Intergenic
906074796 1:43044103-43044125 CTACAGGCGCCCGCCACTCCTGG - Intergenic
906503212 1:46357414-46357436 CTAAAGCCATCCGCCCGCCTTGG + Intronic
907222976 1:52921102-52921124 CTCCAGCCGCGCGCCCGCCCTGG - Intronic
909000294 1:70209830-70209852 CTCAAGCAGCCCACCTGCCCTGG + Intronic
910694304 1:89995383-89995405 CGGAGGCCGCCCGCCCGCCCCGG + Intronic
913482777 1:119304650-119304672 CTACAGGCGCCCGCCACGCCCGG - Intergenic
915732971 1:158067173-158067195 CTGAAGCGACCTGCCAGCCCAGG - Intronic
917861556 1:179149996-179150018 CTAAAGCAGCCCTCCCACCCTGG - Intronic
920166173 1:204037531-204037553 CCAAAGCCACCCGCCACCGCTGG - Intergenic
921380516 1:214519814-214519836 CTAAAGCCGTCCGCCCCCCTTGG - Intronic
922478798 1:225924471-225924493 CTCCAGGCGCCCGCCGGCCCAGG + Intergenic
922481113 1:225940688-225940710 CTGAGGCCCCCCTCCAGCCCAGG - Intronic
922528261 1:226323121-226323143 CTAGAGGAGCCCACCAGCCCAGG + Intergenic
923035417 1:230281680-230281702 CCAAAGCCGCCTCCCAGCTCAGG - Exonic
923499208 1:234550619-234550641 CTCAAGCCGCCAGAGAGCCCTGG + Intergenic
1067462188 10:46466024-46466046 CTCCAGCCGCCCGCCTGCCCCGG + Intergenic
1067625008 10:47918574-47918596 CTCCAGCCGCCCGCCTGCCCCGG - Intergenic
1072197799 10:93131569-93131591 CTGCAGCCGCCCACCTGCCCAGG + Intergenic
1073288804 10:102403260-102403282 CCAAACCCTCCAGCCAGCCCCGG - Exonic
1076327841 10:129642208-129642230 CTACGCCCGCCCGCCCGCCCAGG - Intronic
1076633910 10:131870450-131870472 CTGAAGCCACCCTCCAGCCAGGG + Intergenic
1077676143 11:4194266-4194288 CCAAAGCTGCCCTCCTGCCCAGG + Intergenic
1078189233 11:9077898-9077920 TCAGAGCCGCCCACCAGCCCTGG + Intronic
1079514233 11:21248109-21248131 CTCAAGCCATCCACCAGCCCTGG - Intronic
1082049247 11:47757352-47757374 CTACAGGCGCCCGCCACGCCCGG + Intronic
1085453519 11:76653195-76653217 TGAAAGCAGCCCCCCAGCCCTGG - Intergenic
1089384389 11:118058429-118058451 CCAAAGCTGCCCACCTGCCCAGG - Intergenic
1092867647 12:12778161-12778183 CTCAAGCAGTCCGCCAGCCTTGG + Intronic
1093954227 12:25197702-25197724 CTCAAGCCATCCTCCAGCCCTGG + Intronic
1096460915 12:51821155-51821177 CTCAGGCCGCCCGCCTACCCGGG - Intergenic
1096791471 12:54047660-54047682 CCTAAGCCGCTCGCCAGCCTCGG - Intronic
1097995392 12:65882400-65882422 ACAAAGCAGCCCGCCCGCCCTGG + Intronic
1098387665 12:69935846-69935868 ATAGAGCAGCCCCCCAGCCCTGG - Intronic
1103995931 12:124830083-124830105 CTGGAGCCACCCACCAGCCCTGG + Intronic
1111820932 13:93214401-93214423 CTAAAGGGGCACGCCAGTCCTGG - Intergenic
1114411465 14:22504542-22504564 CTACAGGCGCCCGCCACGCCTGG - Intergenic
1114562712 14:23604782-23604804 CTAAAGCAGCCAGCCAGGCTGGG - Intergenic
1114611213 14:24042096-24042118 CTAAAGCCATCCGCCTGCCTCGG - Intergenic
1119258847 14:73224729-73224751 CTACAGGCGCCCGCCACGCCCGG + Intergenic
1121629869 14:95414173-95414195 CTGAAGCCCCCCTCCAGCCTGGG + Intronic
1121715290 14:96069598-96069620 CAAAAGCCTCCTGCCTGCCCAGG - Intronic
1122691066 14:103532397-103532419 CTAAAGCCCCAGGCTAGCCCTGG - Intronic
1122971050 14:105152381-105152403 CTGAGGCCGCCCGCCGGCCCTGG - Intronic
1123448621 15:20346517-20346539 CTACAGCTGCCAGCCTGCCCTGG - Intergenic
1123703768 15:22936036-22936058 CTCAAGCAGTCCTCCAGCCCTGG - Intronic
1123997160 15:25726915-25726937 CTACAGGCGCCCGCCACGCCCGG - Intronic
1124369175 15:29093777-29093799 CTGCAGAGGCCCGCCAGCCCAGG + Intronic
1124826059 15:33096833-33096855 CTAAAGCAATCCGCCAGCCTTGG + Intronic
1131118358 15:89808094-89808116 CTAAAGGCACCCACAAGCCCGGG + Intronic
1131343054 15:91620963-91620985 CTCAAGCAGTCCTCCAGCCCTGG - Intergenic
1132537476 16:489838-489860 TTGAAGCCGCCCGTCAGCCCTGG + Intronic
1132603186 16:782928-782950 CTCATGCCGCCTGCCAGGCCAGG - Intronic
1133999455 16:10771305-10771327 CTCAAGCAGCCCGCCTGCCTTGG - Intronic
1136467571 16:30455608-30455630 CTACAGGCGCCCACCACCCCTGG + Intergenic
1137329094 16:47472416-47472438 CTCAAGCAGCCCGCCTGCCTTGG - Intronic
1139493918 16:67302293-67302315 CAAGTGCCACCCGCCAGCCCAGG - Intronic
1140924586 16:79570256-79570278 CTAACCCCTCCCTCCAGCCCTGG + Intergenic
1148861044 17:50604488-50604510 CTGAAGCCTCTCGGCAGCCCCGG - Intronic
1149906069 17:60527470-60527492 CTACAGGCGCCCGCCACCACGGG - Intergenic
1152581457 17:81167057-81167079 CACAAGCCACCCGCCTGCCCTGG - Intergenic
1152706826 17:81848042-81848064 CTATAGGCGCCCGCCACCACCGG + Intronic
1154250691 18:12741955-12741977 CTACAGGCGCCCGCCACGCCCGG + Intergenic
1154967208 18:21371642-21371664 CTACAGGCGCCCGCCACGCCCGG - Intronic
1157171414 18:45409831-45409853 CTAAAACCACCCTCCAACCCCGG - Intronic
1157407331 18:47433147-47433169 CTAAAGCTGCCCCACAGCCACGG - Intergenic
1158938518 18:62385718-62385740 CTAAAGCAGTCCTCCAGCCTCGG + Exonic
1161217520 19:3101733-3101755 CTGAAGCCCCCCGACAGCCTGGG - Intronic
1161298866 19:3533174-3533196 TCAGAGCCGCCAGCCAGCCCAGG - Intronic
1161625139 19:5322155-5322177 CTAAAGGCTCACGCCAGCTCAGG - Intronic
1164032455 19:21419759-21419781 CTGAAGTCTCCCTCCAGCCCAGG - Intronic
1164580062 19:29429446-29429468 CTGAAGCTGCCCTCCACCCCAGG - Intergenic
1165183631 19:33996442-33996464 CTACAGGCGCCCGCCACGCCTGG + Intergenic
1165533267 19:36421722-36421744 CTAAAGCTGCCGCCCAGCACGGG - Intergenic
925021486 2:573056-573078 CTAAGGACGCCTGACAGCCCAGG - Intergenic
925980358 2:9171817-9171839 CTCAAGCGACCCGCCTGCCCCGG + Intergenic
929990630 2:46783391-46783413 CTAAAGCCCCTCTCCACCCCAGG + Intergenic
933788978 2:85868542-85868564 CTCAAGCCACCCACCAGCCTTGG + Intronic
934978733 2:98823255-98823277 CTCAAGCCGCCCGGCCACCCCGG - Exonic
936569442 2:113602374-113602396 CTCAGCCCGCCCGCCCGCCCGGG - Intergenic
938343221 2:130549112-130549134 CGAAGGACGCCAGCCAGCCCCGG + Intronic
938346612 2:130571610-130571632 CGAAGGACGCCAGCCAGCCCCGG - Intronic
938946741 2:136219323-136219345 CTTAAGCCTCTCGGCAGCCCCGG + Intergenic
940986186 2:160054200-160054222 CTCAAGCTGTCCTCCAGCCCCGG - Intronic
942454799 2:176130323-176130345 TTAGCGCCGCCCGCCCGCCCGGG + Exonic
948035675 2:234856593-234856615 CTCAGGCCATCCGCCAGCCCTGG - Intergenic
948298259 2:236880871-236880893 CTACAGGCGCCCGCCACCACGGG - Intergenic
948511164 2:238466253-238466275 CTAGAGCCGCCCTGGAGCCCAGG - Intergenic
1169345172 20:4823380-4823402 CTGAAGCAGCCCCCCAGCCGCGG - Intronic
1172278161 20:33692204-33692226 CTCAAGTCTCCCCCCAGCCCTGG + Intergenic
1174330422 20:49813015-49813037 CTCAGGCCGCCCTCCGGCCCCGG + Intronic
1176194687 20:63831574-63831596 CCCCAGCCCCCCGCCAGCCCAGG - Intergenic
1179881100 21:44293673-44293695 CTAGACCCGCCGTCCAGCCCTGG + Intronic
1179912033 21:44455656-44455678 GTAAAGCCCCCGCCCAGCCCTGG + Intronic
1182578701 22:31291133-31291155 CGGCCGCCGCCCGCCAGCCCCGG + Intronic
1185037867 22:48489265-48489287 CTCCAGCCGCCCGCCGACCCGGG - Intergenic
951699970 3:25486429-25486451 CTTAAGCCACCCTACAGCCCTGG + Intronic
953985109 3:47435813-47435835 CTCAAGCAGCCCTCCAGCCTGGG - Intronic
956417888 3:69052218-69052240 CGACAGCCTCCCGCGAGCCCGGG + Exonic
960263042 3:115589919-115589941 CTCATGCACCCCGCCAGCCCAGG + Intergenic
960747713 3:120908299-120908321 CTCTAGCCGCCTGCCAGCCCGGG - Exonic
961558389 3:127712122-127712144 ATAAAGCGGCCCCCCAGCCCGGG - Intronic
968092966 3:195909582-195909604 CTCACACCGCCCGCCCGCCCCGG + Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968656155 4:1779318-1779340 CTCATGTCACCCGCCAGCCCGGG - Intergenic
968812693 4:2807159-2807181 GACAAGCCGCCGGCCAGCCCTGG - Intronic
971686605 4:29777732-29777754 CTACAGGCGCCCGCCACGCCTGG + Intergenic
992597797 5:78363350-78363372 CTACAGGCGCCCGCCACCACCGG + Intronic
999229067 5:150050937-150050959 TTAAAGGCCCCAGCCAGCCCTGG + Intronic
1001530440 5:172457607-172457629 CTATAGGCGCCCGCCATGCCTGG + Intergenic
1002713352 5:181208809-181208831 CTATAGGCGCCCGCCACCCCCGG - Intergenic
1003169412 6:3709396-3709418 CTCAAGCCATCCCCCAGCCCTGG + Intergenic
1003879480 6:10467032-10467054 CTACAGGCGCCCGCCAGGCCTGG + Intergenic
1005645020 6:27829710-27829732 CTAAAGCTGTCTGCCAGCCTTGG + Intergenic
1005977678 6:30812647-30812669 CTACAGGCGCCCACCACCCCCGG + Intergenic
1006149775 6:31980718-31980740 CGACAGGCGCCCGCCGGCCCAGG - Exonic
1006259038 6:32853348-32853370 TCAAAGCAGCCAGCCAGCCCTGG + Exonic
1015859064 6:137656538-137656560 CTTAACCCGCCCCCCGGCCCCGG + Intergenic
1015994831 6:138987494-138987516 CCTAAGCCGCCCGCCGGCCCCGG + Intronic
1019190061 6:170246430-170246452 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190101 6:170246533-170246555 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190166 6:170246705-170246727 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190192 6:170246774-170246796 CTGCAGCCGCCCCCCAGCTCCGG + Intergenic
1019190217 6:170246843-170246865 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190231 6:170246878-170246900 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190284 6:170247015-170247037 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019620097 7:1987677-1987699 CCACGGCCGCCCGGCAGCCCCGG + Intronic
1020787775 7:12591716-12591738 CTAAAGAAGCCTGCTAGCCCTGG + Intronic
1027156660 7:75773095-75773117 CAAATGCCCCCAGCCAGCCCTGG - Intronic
1033164436 7:139027437-139027459 CTCAAGCAGTCCTCCAGCCCTGG - Intronic
1039471521 8:37816189-37816211 CTCAAGCCGTCCTCCAGCCTCGG - Intronic
1041399650 8:57428528-57428550 CTACAGGCGCCCGCCACCCCCGG + Intergenic
1042545857 8:69950729-69950751 CTAAAGCAGTCCTCCAGCCTTGG + Intergenic
1049603802 8:143519973-143519995 CTAGGGCCGCCCCCCAGGCCTGG + Intronic
1051369105 9:16343258-16343280 CTAAAACCTCCCGGCAGGCCCGG - Intergenic
1057317011 9:93976001-93976023 CTCAAGGCCCCTGCCAGCCCTGG + Intergenic
1059061551 9:111038733-111038755 CTAAGGCCACCCCCCAGCCCCGG - Intergenic
1059119672 9:111630956-111630978 TTAAAGCCAGCCACCAGCCCCGG - Intergenic
1060470813 9:123946692-123946714 CTCAAGCAGTCCGCCTGCCCTGG - Intergenic
1060700853 9:125747772-125747794 CGAAAGCCGGCCGCCCGCCCCGG + Intronic
1062300789 9:135867434-135867456 CAAAAACCGCACGCCAGCCTAGG + Intronic
1062574451 9:137199915-137199937 CTCCACCCGCCCCCCAGCCCCGG - Exonic
1187254115 X:17626469-17626491 CTGCAGCCCCCAGCCAGCCCTGG + Intronic
1187904522 X:24053687-24053709 CTACAGGCGCCCGCCACCACGGG + Intergenic
1187981309 X:24760509-24760531 CTAAAGCCACCAGGCAGCCGAGG - Intronic
1190098295 X:47500390-47500412 CTAAAGCCTTGCTCCAGCCCTGG - Intergenic
1190323228 X:49190750-49190772 CTCAAGCGGCCCGCCCGCCTCGG + Intronic
1190716663 X:53109986-53110008 CTCAAGCCATCTGCCAGCCCCGG + Intergenic
1191947014 X:66545272-66545294 CTAAATCCTCCCTCCAGCACTGG + Intergenic
1197018665 X:121659242-121659264 CTCCAGCCGCTGGCCAGCCCTGG + Intergenic
1199736886 X:150693588-150693610 CTCCTGCCGCCCGCCGGCCCCGG - Exonic