ID: 900991546

View in Genome Browser
Species Human (GRCh38)
Location 1:6100468-6100490
Sequence CAATGGTGCCAGAGGGCAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 310}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900991539_900991546 -1 Left 900991539 1:6100446-6100468 CCGGACAGGGTCCTGCAGTGGCC 0: 1
1: 0
2: 2
3: 29
4: 202
Right 900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 310
900991536_900991546 4 Left 900991536 1:6100441-6100463 CCTTCCCGGACAGGGTCCTGCAG 0: 1
1: 0
2: 0
3: 16
4: 163
Right 900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 310
900991530_900991546 26 Left 900991530 1:6100419-6100441 CCCAGGTGGGGGTCGCCTGCTTC 0: 1
1: 0
2: 0
3: 10
4: 147
Right 900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 310
900991535_900991546 11 Left 900991535 1:6100434-6100456 CCTGCTTCCTTCCCGGACAGGGT 0: 1
1: 0
2: 3
3: 114
4: 1584
Right 900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 310
900991531_900991546 25 Left 900991531 1:6100420-6100442 CCAGGTGGGGGTCGCCTGCTTCC 0: 1
1: 0
2: 4
3: 11
4: 160
Right 900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 310
900991538_900991546 0 Left 900991538 1:6100445-6100467 CCCGGACAGGGTCCTGCAGTGGC 0: 1
1: 0
2: 2
3: 34
4: 265
Right 900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900991546 Original CRISPR CAATGGTGCCAGAGGGCAGG TGG Exonic
900089207 1:912305-912327 CACAGGTGCCAGCTGGCAGGTGG - Intergenic
900340197 1:2184892-2184914 CAAAGGTGGCAGGGGGGAGGGGG - Intronic
900919405 1:5661258-5661280 GAATGGTGCCAGGCTGCAGGTGG - Intergenic
900983821 1:6061498-6061520 CAATGGTGCCAGGGTTGAGGAGG - Intronic
900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG + Exonic
901069539 1:6510215-6510237 CAGGAGAGCCAGAGGGCAGGGGG - Intronic
901470097 1:9450097-9450119 AGATGGGGCCAGAAGGCAGGGGG + Intergenic
901632191 1:10653383-10653405 CAAAGGTGGCAGAGGGCTTGAGG + Exonic
903299442 1:22368151-22368173 CACAGGTGGCAGGGGGCAGGTGG - Intergenic
904312135 1:29635718-29635740 CCATGAAGCCTGAGGGCAGGTGG - Intergenic
904496690 1:30891228-30891250 CCATGGGGACAGAGGGCAGATGG - Intronic
904877090 1:33663507-33663529 AATTGGGGCTAGAGGGCAGGGGG + Intronic
905659391 1:39709794-39709816 AAATGGGGCCAGAGGTGAGGTGG - Intronic
906783358 1:48592181-48592203 TAATTGTGCAAGGGGGCAGGAGG - Intronic
909935828 1:81549608-81549630 CAATGGTGCCAGATTCCAGGAGG - Intronic
910858929 1:91724497-91724519 CATTGGTGCAAAAGGACAGGTGG - Intronic
911420853 1:97638696-97638718 CAATCGTGGCAGAAGGGAGGGGG + Intronic
912931375 1:113966224-113966246 CAATGATTCCAGAGGCCATGGGG + Exonic
914790813 1:150876326-150876348 CAAGGGAGCGAGGGGGCAGGTGG - Intronic
914804457 1:150982356-150982378 CAGAGGTGCCAGAGGTGAGGTGG - Exonic
914998659 1:152566589-152566611 CAATGGGGGAAGGGGGCAGGAGG - Intronic
915489246 1:156242306-156242328 CAATGCGGCCTGAGGGGAGGTGG - Intronic
916273426 1:162968329-162968351 CAAGGGTGCCTGAGGGCCAGGGG - Intergenic
916415928 1:164591962-164591984 CAAAAGTGCCACAGGGGAGGTGG - Intronic
916475282 1:165162987-165163009 CTCTGGTGCCGGAGGCCAGGAGG - Intergenic
917183162 1:172321623-172321645 CAATGATGTCACAGGGTAGGAGG - Intronic
919937654 1:202265252-202265274 CCATGGTGACAGAGAGCATGGGG - Intronic
920156235 1:203954377-203954399 GAATGTTGAAAGAGGGCAGGAGG + Intergenic
921219533 1:212963326-212963348 CAGTGGCCCCAGTGGGCAGGGGG - Intronic
921670131 1:217916019-217916041 CCATGGGGCCAGATGGCATGGGG - Intergenic
922739211 1:228006357-228006379 CAATGGGGACAGCGGCCAGGTGG - Intergenic
923085955 1:230703787-230703809 GCATGGTGCCACATGGCAGGGGG + Intronic
923786351 1:237072174-237072196 CCATGGAGCCGGAGGGCACGAGG - Intronic
1063698159 10:8357491-8357513 CAATTTTGCCACGGGGCAGGGGG + Intergenic
1063842518 10:10088456-10088478 CAATGGTGCCAGGGAGCTGGAGG + Intergenic
1063960023 10:11299366-11299388 CAATGGTAGCAGGGGGCAAGAGG - Intronic
1063975039 10:11408317-11408339 CAAGGGTGGCTGAGGGCAGTGGG - Intergenic
1066167987 10:32808555-32808577 CCATGGTGCCAGCAGGTAGGTGG - Intronic
1066583156 10:36902441-36902463 CAATCATGGCAGAAGGCAGGGGG + Intergenic
1068696380 10:59972225-59972247 AAATGCAGCCAGAGGTCAGGTGG + Intergenic
1069776597 10:70930860-70930882 CAATGCTGGCACAGAGCAGGCGG + Intergenic
1070169794 10:73924271-73924293 AAATAGTGCCTGAGGGCAAGAGG - Intergenic
1071397270 10:85236753-85236775 GATTGATGCCAGAGGGCAGGAGG + Intergenic
1075258395 10:120943392-120943414 CCATGGTGCTGGGGGGCAGGAGG + Intergenic
1075709123 10:124521342-124521364 CTGAGGTGCCAGAGGGCTGGGGG - Intronic
1075719756 10:124577788-124577810 CAATGCTGCCAGAGTGGAGGAGG - Intronic
1076299110 10:129411319-129411341 TAATTGTGCCAGAGGCCAGCAGG - Intergenic
1076670316 10:132117424-132117446 CAAGGGCGCCAAAAGGCAGGTGG + Exonic
1076942851 10:133621347-133621369 CGATGCTGCCACAGGACAGGTGG - Intergenic
1077139178 11:1016062-1016084 CAATGGTGCTGGAGGCTAGGTGG + Exonic
1077310108 11:1884613-1884635 GAATGGTGCCAGGATGCAGGAGG - Intronic
1080844538 11:36015311-36015333 CAATGGGGGCAGGGGGCGGGGGG - Intronic
1080884477 11:36353800-36353822 GAATGGGGCCACAGAGCAGGAGG - Intronic
1081779004 11:45696919-45696941 AAGTGGTGTCAGAGGGGAGGAGG - Intergenic
1082778864 11:57270669-57270691 CAAGGGTTCCATGGGGCAGGCGG + Intergenic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1084197188 11:67530135-67530157 CCATGGAGCCAGAGGGCTGTGGG + Intergenic
1084315624 11:68343728-68343750 CACTGAGGCCTGAGGGCAGGAGG - Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1089232356 11:116990396-116990418 GAATGGGGCCAAAGGTCAGGAGG + Intronic
1089736577 11:120553854-120553876 CAATGCTGACAGAGTGGAGGGGG + Intronic
1091287447 11:134415532-134415554 AGATGCTGCCAGAGAGCAGGGGG + Intergenic
1091445252 12:541442-541464 CAATGGAGCGAGTGGGCAGAGGG + Intronic
1091816927 12:3445915-3445937 CAATGGGGCCAGGAGGTAGGTGG - Intronic
1092233741 12:6792701-6792723 CATTGCTGCCAAAGGCCAGGAGG + Intronic
1092377346 12:7966921-7966943 GAGAGGTGGCAGAGGGCAGGGGG + Intergenic
1094827882 12:34286663-34286685 AAATGGTGCCATAGGGAAGGGGG + Intergenic
1095130964 12:38541763-38541785 CAGAGGGGCCAGAGGGGAGGTGG + Intergenic
1095982659 12:47981937-47981959 AAATGGGGCCAGAGGGTAAGTGG - Intronic
1097982380 12:65747505-65747527 CAATGCTGCAGCAGGGCAGGAGG + Intergenic
1099812663 12:87604811-87604833 CAATCATGGCAGAAGGCAGGAGG + Intergenic
1100241404 12:92713492-92713514 CCAAGGTGGCAGAGGCCAGGTGG - Intergenic
1100479338 12:94962699-94962721 GGATGGTGTCAGAAGGCAGGAGG + Intronic
1102569401 12:113818381-113818403 TACTGGGGCCAGTGGGCAGGGGG + Intronic
1103216905 12:119208672-119208694 CCATGGTGCCCGAATGCAGGAGG + Intronic
1104877284 12:132044328-132044350 CAGGGGGGCAAGAGGGCAGGAGG - Intronic
1105424805 13:20285072-20285094 AAATGGTGCAACAGGGCTGGTGG + Intergenic
1105454093 13:20525146-20525168 CGATGTTTCCAGAGGGGAGGTGG - Intronic
1105894593 13:24707379-24707401 TGATGGTGCCAATGGGCAGGGGG - Exonic
1106466550 13:30019077-30019099 CTATGGGGCCAAAGGACAGGAGG + Intergenic
1108633840 13:52313191-52313213 CCATGGTGCCAGAGCTCTGGAGG + Intergenic
1108634259 13:52316884-52316906 CCATGGTGCCAGAGTTCTGGAGG + Intergenic
1109968505 13:69734258-69734280 CAATGGTGGCAGAAGGCCAGGGG - Intronic
1112643719 13:101306128-101306150 GAATGGTGCCCGAGGCCAGTTGG + Intronic
1113804533 13:113105746-113105768 CAAGGGTGACAGAGGGATGGGGG - Intergenic
1113873466 13:113579362-113579384 CAACGGTGGGAGGGGGCAGGGGG - Intergenic
1114532291 14:23403512-23403534 CCATGGGGGCAGAGGGCAGGGGG + Intronic
1117707459 14:58486099-58486121 CTATGATGGCAGGGGGCAGGAGG - Intronic
1117737009 14:58777728-58777750 CCATGGGGTCAGAGGGCAAGGGG + Intergenic
1118768450 14:68925740-68925762 TAATGGTGCCAGGGGGTGGGAGG + Intronic
1118908684 14:70043259-70043281 CAAGGGTGAGAGAGGCCAGGTGG + Intergenic
1120856770 14:89219299-89219321 CAATGGTGGCAGACGGCAAAGGG - Intronic
1122074667 14:99228456-99228478 ACATGGTGGCAGAGGGCAGGAGG + Intronic
1122461842 14:101902497-101902519 CAATGATGCAAAAGGACAGGTGG - Intronic
1125765605 15:42133549-42133571 CACTCGTGGCAGAGGGCAAGGGG + Intergenic
1125769792 15:42157498-42157520 CAAAGGTGACAGAGGTGAGGCGG + Intergenic
1126599540 15:50415142-50415164 AAATGGTGACAGAGGGAAGAGGG - Intergenic
1128724987 15:69981909-69981931 CAAAGGGGCCTGTGGGCAGGTGG - Intergenic
1129177813 15:73852691-73852713 TAATGCTGCCAGTGGGGAGGTGG - Intergenic
1129358888 15:75012130-75012152 CAATAGAGACAGAGGGGAGGAGG - Intronic
1129605368 15:77022441-77022463 CACTGGTGACAGATGGCAGTAGG + Intronic
1129889943 15:79065394-79065416 CAGGGATGCCAGTGGGCAGGTGG + Intronic
1131539014 15:93260640-93260662 CTGAGGTGCCAGAGGGCACGCGG + Intergenic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132782887 16:1637941-1637963 CAAAGGTGACAAAGGACAGGAGG - Intronic
1132854831 16:2040069-2040091 CAGTGCTGACAGAGGGCGGGCGG + Intronic
1133482423 16:6184022-6184044 CAATCGTGCCAGAAGGCAAAAGG + Intronic
1134093001 16:11401496-11401518 CAAGGCTGCAAAAGGGCAGGTGG + Intronic
1137028490 16:35501062-35501084 CAATGGAGGCAGATGGCTGGTGG + Intergenic
1137731183 16:50691750-50691772 CTCTGGTGCCAGAGGAAAGGGGG + Intergenic
1138237804 16:55399933-55399955 CAATGGTGACCGTGGCCAGGGGG - Intronic
1139120458 16:64009852-64009874 CAAGAGTACCATAGGGCAGGTGG - Intergenic
1139639659 16:68281952-68281974 CAAGGGTGACAGTGAGCAGGAGG + Intronic
1141306147 16:82865708-82865730 CAATGGTGTAACAGGGCTGGTGG - Intronic
1141437947 16:84011477-84011499 CAATGGGGCTAGAGGGCCGGGGG + Intronic
1141595761 16:85095918-85095940 CAATGGTCCCGGAGTACAGGTGG - Intergenic
1142114160 16:88347802-88347824 CAATGGTCCCAGGAGGCGGGTGG - Intergenic
1143712623 17:8744887-8744909 CAATGGGGGCAGGGGGCAGGGGG - Intronic
1144026010 17:11276298-11276320 CAAAGGTGGCGGAGGGGAGGTGG + Intronic
1145302729 17:21652596-21652618 CAGAGGAGACAGAGGGCAGGAGG - Intergenic
1145347574 17:22050592-22050614 CAGAGGAGACAGAGGGCAGGAGG + Intergenic
1145416012 17:22714736-22714758 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1146186411 17:30727342-30727364 CAAAGGGGCCAGAGGGCACTTGG + Intergenic
1147685412 17:42284046-42284068 CATGGGAGCCAGAGGGGAGGTGG - Intergenic
1148047285 17:44751892-44751914 CAATGGTGAGGAAGGGCAGGGGG - Exonic
1148081121 17:44968135-44968157 CAATGGTGCCGGCGGGCAGGGGG + Intergenic
1148138607 17:45312011-45312033 CTATGGAGGCAGGGGGCAGGAGG - Intronic
1148769325 17:50057704-50057726 CAGTGGGGTCAGAGGCCAGGTGG - Intronic
1149391746 17:56198491-56198513 GAATGGGGCCACACGGCAGGAGG - Intronic
1149606025 17:57925896-57925918 CACAGGTGGCAGAGGACAGGCGG - Intronic
1150168990 17:62971902-62971924 CAATTTTTCCAGAGGGTAGGGGG - Intergenic
1150294845 17:64002132-64002154 TAATGGAGCAAGAGGGGAGGGGG + Exonic
1151344787 17:73494901-73494923 CACTGGTGCCAGAGGACATGGGG - Intronic
1151462323 17:74261735-74261757 GAATGGGGCCACAGGGCAGCCGG + Exonic
1151572223 17:74932562-74932584 AGGTGGGGCCAGAGGGCAGGGGG - Intronic
1152107716 17:78340848-78340870 CAAGGGGGCAAGAGGGCAGCTGG + Intergenic
1154092438 18:11378272-11378294 GAATGCTGCCTGAGCGCAGGAGG + Intergenic
1154188832 18:12210295-12210317 CAAGGGTCCCTGAGGGCAGTGGG + Intergenic
1154503188 18:15006586-15006608 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1155298378 18:24406478-24406500 AAATGGTGCCATCTGGCAGGAGG - Intergenic
1156023596 18:32627070-32627092 GAAAGGTGACAGAGGGCTGGTGG + Intergenic
1156057054 18:33019224-33019246 CAATGTTGGCAGAAGGCTGGTGG + Intronic
1156919346 18:42501502-42501524 CAATGGTGCCTGTCAGCAGGTGG + Intergenic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1157855550 18:51101508-51101530 CAATGGTGCCCCAGGGCCGAGGG - Intergenic
1159960729 18:74554159-74554181 CAATGCTGGAAGAGGGCATGTGG - Intronic
1160538371 18:79607315-79607337 CCATGGGGCCAGAGGGACGGAGG + Intergenic
1161776257 19:6263849-6263871 CACTGGTGCCAGAAGGCTGAAGG + Intronic
1161948811 19:7455758-7455780 CAATCATGGCAGAAGGCAGGAGG + Intronic
1162856913 19:13475763-13475785 CAATGGAGGCAGGGGGCAGAAGG + Intronic
1162972435 19:14188709-14188731 CAAAGGAGCCAGAGGGCACTTGG - Intronic
1166355083 19:42222425-42222447 TATTAGTGCCAGAGGGCAGGTGG - Intronic
1167284586 19:48591858-48591880 CAATAGAGACAGAGAGCAGGTGG + Intronic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1168374353 19:55863414-55863436 CAATGGTGGCAGAAGGCAAAGGG + Intronic
1168630125 19:57949902-57949924 CAGTGCTGGCTGAGGGCAGGAGG + Intergenic
925140917 2:1549410-1549432 CAAGGGTGGGTGAGGGCAGGAGG - Intergenic
926041429 2:9676305-9676327 CCATTGAGGCAGAGGGCAGGTGG - Intergenic
928105867 2:28470256-28470278 GAATGGTGCCAAAGGCCAGGTGG - Intronic
928221840 2:29409775-29409797 CAAGGGAGCAAGAAGGCAGGTGG - Intronic
931253630 2:60553030-60553052 CAATGGTTCCAGATGGGATGAGG + Intronic
931642889 2:64396898-64396920 CAATGGTGTCAAAGTGCATGGGG - Intergenic
932174351 2:69585969-69585991 GGGTGGTGCCAGAGGGAAGGTGG - Intronic
933181456 2:79231400-79231422 CAATCATGGCAGAGGGCAAGAGG - Intronic
934554130 2:95278490-95278512 CAATGGTGGGAGAGGGATGGGGG + Intronic
935419488 2:102852766-102852788 TAATCTTGCCAGAGGGCAGTTGG + Intergenic
936813514 2:116432191-116432213 CAATCATGGCAGAAGGCAGGAGG + Intergenic
937074087 2:119088435-119088457 CACAGTTGCCAAAGGGCAGGAGG - Intergenic
937078079 2:119121514-119121536 CACTCATGCCAGATGGCAGGTGG + Intergenic
937294108 2:120799363-120799385 CATAGTTGCCACAGGGCAGGTGG + Intronic
937961781 2:127465581-127465603 CAATCATGGCAGAAGGCAGGAGG - Intronic
938410153 2:131056896-131056918 CAATGGTGCCAGGGGCCAGAGGG + Intronic
938502369 2:131836756-131836778 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
938824957 2:134995444-134995466 CAGTGGATCCAGAGAGCAGGTGG + Intronic
942731754 2:179067641-179067663 CAATGATGGCAGAAGGCAGGGGG - Intergenic
943247502 2:185473948-185473970 CAATGCTGACGGAGGGCAGGAGG - Intergenic
943786069 2:191880478-191880500 CACTAGAGCCAGAGGTCAGGAGG + Intergenic
944844662 2:203656807-203656829 CAATCATGCAAGAGGGCAAGAGG - Intergenic
945188117 2:207160310-207160332 GAATGGTGCCAGAGGGTGAGGGG - Intronic
946144019 2:217715016-217715038 CAATGGTGGCAGGGGGTGGGGGG + Intronic
947067102 2:226239980-226240002 CACTGGTGGGAGGGGGCAGGTGG + Intergenic
1169109482 20:3022668-3022690 CACTGTAGCCAGAGAGCAGGGGG - Exonic
1171519319 20:25764127-25764149 CAGAGGAGACAGAGGGCAGGAGG - Intronic
1171557605 20:26092364-26092386 CAGAGGAGGCAGAGGGCAGGAGG + Intergenic
1172272409 20:33662273-33662295 CAATGTTGCCAGGGCCCAGGGGG + Exonic
1173279872 20:41618436-41618458 CAATGGCGCGACAGGGAAGGCGG - Exonic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175881608 20:62262631-62262653 TACTGGTGTCAGGGGGCAGGAGG - Intronic
1176104557 20:63379801-63379823 TAATGGTGGCAGGGGGCAGATGG + Intergenic
1176267535 20:64218190-64218212 CAATGGTGCCAGTGGAGAGGGGG + Intronic
1177524693 21:22276273-22276295 CAACTGTGCCAGACAGCAGGAGG + Intergenic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1181000500 22:19985842-19985864 CCAGGCTCCCAGAGGGCAGGAGG + Intronic
1181105360 22:20571410-20571432 ACATGGTGCCACAGGGCAGGTGG - Intronic
1181434517 22:22902599-22902621 CGAAGGTCCCAGTGGGCAGGAGG - Intergenic
1181459947 22:23079925-23079947 ACATGGAGGCAGAGGGCAGGAGG + Intronic
1181533687 22:23531112-23531134 CACTGGGTCCTGAGGGCAGGTGG + Intergenic
1182067818 22:27442916-27442938 ACAGGGTGCCAGAGGGGAGGTGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182446588 22:30393242-30393264 CTGTGGTGCCAGGGGGAAGGGGG - Intronic
1182593467 22:31399860-31399882 TAATCGTGGCAGAGGGCAGTCGG - Intronic
1183000875 22:34857605-34857627 CACTGGGGCCTGAGGGGAGGTGG - Intergenic
1183206468 22:36422932-36422954 CTATGGTCCCAGGAGGCAGGCGG + Intergenic
1183264010 22:36814681-36814703 CACTAGTACCAGAGGGCTGGGGG + Intronic
1183270740 22:36861143-36861165 CGATGGTCCCAGGGAGCAGGTGG - Exonic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1184606292 22:45576561-45576583 CTATAGTGCCACAGGTCAGGGGG - Intronic
949948301 3:9207774-9207796 CAATTCTCCAAGAGGGCAGGCGG + Intronic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
950450884 3:13064853-13064875 CAGAGCTGCCAGAGGGCATGTGG - Intronic
951520730 3:23608951-23608973 CCAGGTTGCCACAGGGCAGGCGG - Intergenic
952406396 3:33008786-33008808 CAAAGGGGCAAGGGGGCAGGTGG + Intronic
953246339 3:41198000-41198022 CTATGGTGACAGACGGCAGTTGG + Intronic
954746341 3:52789627-52789649 CAATGGAGCAAGAGGGCATCCGG - Intronic
954964793 3:54600743-54600765 TAATGAAGCCAGAGCGCAGGAGG - Intronic
955476626 3:59342907-59342929 AATTGGTGGCAGAGGGCGGGGGG - Intergenic
956460690 3:69468724-69468746 CAAAGATGACAGAGGACAGGGGG + Intronic
956576682 3:70759987-70760009 CACTCCTGCCAGAGGGCAGTTGG - Intergenic
957589824 3:82181665-82181687 CAATGCTGTCAGTGGGGAGGAGG - Intergenic
958789072 3:98630392-98630414 CCAAGGTGGCAGGGGGCAGGTGG - Intergenic
960559987 3:119073437-119073459 CCATGGTGCCATGGAGCAGGTGG + Intronic
961637488 3:128342468-128342490 TAAGGGTGCCAGAGAGCAAGAGG + Intronic
961768195 3:129228676-129228698 AAATGGAGCAAGAGGGCTGGAGG - Intergenic
962375156 3:134852964-134852986 CCATACTGTCAGAGGGCAGGTGG + Intronic
962731163 3:138284871-138284893 CTATGGTGCCAGGGGGCTAGAGG - Intronic
965389222 3:168084217-168084239 CAATGATGGCAGAGGGCAAAGGG - Intronic
965975292 3:174613549-174613571 CTATGGTGCCAGTGGTCATGGGG - Intronic
966608992 3:181849806-181849828 AAATGGTGGCAGAGTGCAGAAGG + Intergenic
966821796 3:183930637-183930659 CAATGGAGGCAGAGGCCAGAGGG + Intronic
967006366 3:185386889-185386911 GAATCCTGTCAGAGGGCAGGGGG + Intronic
968661950 4:1802313-1802335 CAGTGGTGCCCCAGGACAGGAGG + Intronic
968948849 4:3679867-3679889 CAATGTTTTCAGAGGACAGGAGG + Intergenic
970157113 4:13152724-13152746 CAATCATGCCAGAAGGCAAGGGG + Intergenic
971191055 4:24429584-24429606 CAAAGCAGCCTGAGGGCAGGAGG + Intergenic
971299302 4:25428641-25428663 CAATCATGGCAGAAGGCAGGAGG + Intergenic
973838969 4:54841740-54841762 AAATGGTGCCACAGGGCTGGTGG - Intergenic
980108207 4:128608471-128608493 CAACGGTTCCAGAAGGCATGTGG + Intergenic
982878930 4:160686206-160686228 CAATGGTGGCACAGGGCAGGGGG - Intergenic
983479958 4:168260724-168260746 GAATTGTGCCACAGAGCAGGAGG - Intronic
984067228 4:175062939-175062961 CAATGGTGCTTGAGGGCAATTGG - Intergenic
984880292 4:184404828-184404850 CCAGGGTGACAGAGTGCAGGAGG + Intronic
985309063 4:188577520-188577542 CAATCATGACAGAGGGCAGAGGG + Intergenic
985318965 4:188687797-188687819 AAAGGGTGGCAGAGGGCAGGAGG - Intergenic
985664748 5:1176287-1176309 CAGTGATGCCAGAGCCCAGGAGG - Intergenic
987141463 5:14951166-14951188 GAATGGGGCCACAGAGCAGGAGG + Intergenic
989261568 5:39424764-39424786 AAATGGAGCCAGAGGGAAGAAGG + Intronic
990164661 5:52981367-52981389 AAATGGAGCCAAAGGTCAGGAGG + Intergenic
991625527 5:68596912-68596934 GAATGGGGCCACACGGCAGGAGG - Intergenic
995893233 5:116981126-116981148 CAAGTGTCCCAGAGGGCACGTGG + Intergenic
997842671 5:137256477-137256499 ACATGGTGACAGAGGGCAAGAGG + Intronic
998397023 5:141825273-141825295 CAATGCAGTCAGAGGGAAGGGGG + Intergenic
999086824 5:148899656-148899678 CTATGGTGACAGAGGACACGAGG + Intergenic
999578002 5:153002108-153002130 TTATGGTGCCAGAGATCAGGGGG - Intergenic
999875929 5:155805720-155805742 CGATGGTGCCAGTGGAGAGGAGG + Intergenic
1001231107 5:169989522-169989544 CTATGGTCCCAGAAGGCAGAGGG + Intronic
1002269062 5:178057874-178057896 CGATGGTGCCACGGGACAGGTGG + Intergenic
1002779341 6:354300-354322 CCAAGGTCCCAGAGAGCAGGCGG - Intergenic
1004193675 6:13486420-13486442 AAGTGGTGCCAGGAGGCAGGAGG + Intronic
1005282755 6:24291914-24291936 CAATGGGGTGAGAGGGCAGGAGG + Intronic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1005870860 6:29973849-29973871 CAGTGGTTCCAGGGGCCAGGGGG + Intergenic
1006612135 6:35300483-35300505 CGATGAGGCCAGAGGGTAGGAGG + Intronic
1011930121 6:92701088-92701110 CACTGCTGGCAGAGGGCAGGAGG + Intergenic
1012447774 6:99324029-99324051 CCATGGGGGCACAGGGCAGGAGG + Intronic
1013191406 6:107806911-107806933 CAACTCTGCCAGCGGGCAGGCGG - Intronic
1016050771 6:139527809-139527831 CAGGGGTGACAGGGGGCAGGTGG + Intergenic
1019311585 7:364437-364459 CAGTGGTGACAGTGGGGAGGGGG - Intergenic
1019626545 7:2018778-2018800 CACTGGTGGCAGAGGCCGGGCGG - Intronic
1019660163 7:2219667-2219689 CAAGGGGGGCAGAGGGCAGGGGG + Intronic
1023285633 7:38616023-38616045 CACTGCTCCCAGAGGACAGGAGG + Intronic
1024248530 7:47488858-47488880 CAATGGTGCCTGGGGACAGGGGG + Intronic
1024606280 7:51025060-51025082 CAATGGGGCCAGAGGGTTGGAGG - Intronic
1025177138 7:56807689-56807711 CAATGGTGCCAGTTGGGGGGCGG + Intergenic
1025694654 7:63768697-63768719 CAATGGTGCCAGTTGGGGGGCGG - Intergenic
1026062194 7:67036542-67036564 CACTAGAGCCAGAGGTCAGGAGG + Intronic
1026716154 7:72790906-72790928 CACTAGAGCCAGAGGTCAGGAGG - Intronic
1026735672 7:72947014-72947036 CAATGGGGCCAAAGGGTAGCTGG - Intronic
1026772511 7:73211440-73211462 CATCGGTGACAAAGGGCAGGTGG + Intergenic
1026786014 7:73301945-73301967 CAATGGGGCCAAAGGGTAGCTGG - Intergenic
1026875487 7:73876953-73876975 CAATGGAATCGGAGGGCAGGCGG - Intergenic
1027013376 7:74764839-74764861 CATCGGTGACAAAGGGCAGGTGG + Intergenic
1027074662 7:75181194-75181216 CATCGGTGACAAAGGGCAGGTGG - Intergenic
1027108050 7:75417997-75418019 CAATGGGGCCAAAGGGTAGCTGG + Exonic
1029794989 7:102884805-102884827 TAATGATGCCAGGGGCCAGGAGG - Intronic
1032358143 7:131229318-131229340 CACTGGGGCCTGTGGGCAGGTGG - Intronic
1032989834 7:137381400-137381422 CAAAGCTGCCAGCTGGCAGGTGG - Intronic
1034215840 7:149404974-149404996 CACTGCTGACAGAGGGCGGGAGG + Intergenic
1035453580 7:158995414-158995436 CACTGGCCCCCGAGGGCAGGAGG - Intergenic
1036614754 8:10379579-10379601 CCAGGGTGCCAGAGGGGAAGAGG - Intronic
1037359040 8:18053948-18053970 CAATCGTGGCAGAAGGCAAGAGG + Intergenic
1037876339 8:22550720-22550742 GACTGGTGCCAGAGGCCACGAGG - Intronic
1038529456 8:28306140-28306162 GAGTGGGGGCAGAGGGCAGGTGG - Intergenic
1039193630 8:35005329-35005351 TGATGATGCCATAGGGCAGGTGG - Intergenic
1039578422 8:38644188-38644210 GAATGGTGCCAGAGGAATGGTGG + Intergenic
1039952234 8:42181429-42181451 CATTGGGGTCAGAGGGCATGAGG + Intronic
1041639523 8:60181499-60181521 CACTGGGGCCTGTGGGCAGGTGG + Intergenic
1044277767 8:90322126-90322148 CAGTGGAGTCAGTGGGCAGGAGG + Intergenic
1045523745 8:102925971-102925993 CAATGGTGGTAGAGGGGTGGAGG + Intronic
1045793307 8:106012144-106012166 CTATGCTGCCAGAGGGCTGATGG + Intergenic
1046962563 8:120126004-120126026 CTTTGGTGCCAGAAGCCAGGAGG + Intronic
1047748611 8:127863923-127863945 CAGTGATGCCAGCGGGCATGGGG - Intergenic
1048522723 8:135171504-135171526 CACTGGTGAGAGAGGACAGGAGG + Intergenic
1049182612 8:141230793-141230815 AAATGCTGCCAGAGAGCATGTGG + Intronic
1050191223 9:3028685-3028707 CAAGGGGGCCAGAGTGCTGGCGG + Intergenic
1050581443 9:7061636-7061658 CAATGAGGCAGGAGGGCAGGTGG + Intronic
1050993026 9:12175694-12175716 CAATGGTGAGAGATGGCAGTCGG - Intergenic
1051871313 9:21740784-21740806 TAATGGAGCCAGAGGACAGGCGG + Intergenic
1052857754 9:33417632-33417654 CAGAGGTGAGAGAGGGCAGGAGG - Intergenic
1056876618 9:90339329-90339351 TGATGGGGCCAGAGGGCTGGAGG + Intergenic
1057267116 9:93625136-93625158 TAGTGGTGCCAGAGGGTGGGAGG - Intronic
1061202030 9:129143529-129143551 GAAGGGTGCCAGAGGCCAGCGGG + Intronic
1061246779 9:129404727-129404749 CACTGGGTCCTGAGGGCAGGTGG - Intergenic
1061812592 9:133171088-133171110 CAAGGATGTCAGAGGCCAGGAGG - Intergenic
1061927633 9:133813749-133813771 CAAAGTTGGCAGAGGGCAGATGG + Intronic
1061952734 9:133945368-133945390 GAATGGGGCCAGAGAGGAGGGGG + Intronic
1062107253 9:134762458-134762480 CCATGGGGCCAGAGCACAGGAGG + Intronic
1062133291 9:134911958-134911980 CAATCATGCCACAGGGCAGTGGG + Intronic
1062309442 9:135928237-135928259 CACAGGTGCCACAGAGCAGGAGG - Intergenic
1062364887 9:136203803-136203825 CAATGGAGCCGGAGTGCTGGGGG - Intronic
1186688115 X:11946803-11946825 CACTGATGGCTGAGGGCAGGAGG - Intergenic
1188038892 X:25349298-25349320 GAATGGTGCCAAGGGGCAGGGGG - Intergenic
1188857667 X:35217445-35217467 CAAAGGTGCTAGAATGCAGGGGG - Intergenic
1189114503 X:38328849-38328871 CATTGGTGCCAGAGAGGAGCAGG + Intronic
1190116500 X:47629128-47629150 CAATGCTTCCAGTGTGCAGGAGG + Intronic
1190228294 X:48562277-48562299 CAATGCTGCCAGAGATGAGGAGG + Exonic
1190526020 X:51330804-51330826 CAATGGTGGCAGAAGGCAGAGGG + Intergenic
1192219264 X:69186123-69186145 CAATGTTGTCAGAGGGGAGGAGG + Intergenic
1192546253 X:72017355-72017377 CAATGTTGCCAGCTGGCAGCAGG + Intergenic
1192639213 X:72846900-72846922 CAAGGGTGGCACAGGGCTGGAGG - Exonic
1192642498 X:72873905-72873927 CAAGGGTGGCACAGGGCTGGAGG + Exonic
1195427427 X:104750287-104750309 CAATGAAGCCAAAGGGCAGTTGG + Intronic
1199843658 X:151675336-151675358 GAAAGGTGCCAGAAGGCAGTAGG - Intronic
1200068349 X:153515646-153515668 CTGTGGTGCCTGAGGGCATGGGG + Intergenic
1200139109 X:153889096-153889118 CAGTGGTGGCCAAGGGCAGGGGG - Intronic
1200180997 X:154150642-154150664 CGAAGGGGCCTGAGGGCAGGAGG - Exonic
1200186640 X:154187756-154187778 CGAAGGGGCCTGAGGGCAGGAGG - Intergenic
1200192292 X:154224894-154224916 CGAAGGGGCCTGAGGGCAGGAGG - Exonic
1200198047 X:154262698-154262720 CGAAGGGGCCTGAGGGCAGGAGG - Exonic
1201772790 Y:17632925-17632947 CAATGACACCTGAGGGCAGGTGG - Intergenic
1201828765 Y:18273062-18273084 CAATGACACCTGAGGGCAGGTGG + Intergenic