ID: 900992509

View in Genome Browser
Species Human (GRCh38)
Location 1:6104449-6104471
Sequence CCTCCGGAGGTGGGCAGGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 340}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900992496_900992509 -1 Left 900992496 1:6104427-6104449 CCCCAGGGGCAGCCCGGTTCCAC 0: 1
1: 0
2: 0
3: 29
4: 157
Right 900992509 1:6104449-6104471 CCTCCGGAGGTGGGCAGGGTAGG 0: 1
1: 0
2: 2
3: 29
4: 340
900992488_900992509 30 Left 900992488 1:6104396-6104418 CCAGGGACAGGGGAATGGGACAA 0: 1
1: 0
2: 3
3: 30
4: 321
Right 900992509 1:6104449-6104471 CCTCCGGAGGTGGGCAGGGTAGG 0: 1
1: 0
2: 2
3: 29
4: 340
900992495_900992509 0 Left 900992495 1:6104426-6104448 CCCCCAGGGGCAGCCCGGTTCCA 0: 1
1: 0
2: 0
3: 11
4: 239
Right 900992509 1:6104449-6104471 CCTCCGGAGGTGGGCAGGGTAGG 0: 1
1: 0
2: 2
3: 29
4: 340
900992498_900992509 -3 Left 900992498 1:6104429-6104451 CCAGGGGCAGCCCGGTTCCACCT 0: 1
1: 0
2: 1
3: 18
4: 164
Right 900992509 1:6104449-6104471 CCTCCGGAGGTGGGCAGGGTAGG 0: 1
1: 0
2: 2
3: 29
4: 340
900992497_900992509 -2 Left 900992497 1:6104428-6104450 CCCAGGGGCAGCCCGGTTCCACC 0: 1
1: 0
2: 2
3: 19
4: 139
Right 900992509 1:6104449-6104471 CCTCCGGAGGTGGGCAGGGTAGG 0: 1
1: 0
2: 2
3: 29
4: 340
900992493_900992509 5 Left 900992493 1:6104421-6104443 CCAGGCCCCCAGGGGCAGCCCGG 0: 1
1: 0
2: 4
3: 81
4: 584
Right 900992509 1:6104449-6104471 CCTCCGGAGGTGGGCAGGGTAGG 0: 1
1: 0
2: 2
3: 29
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900992509 Original CRISPR CCTCCGGAGGTGGGCAGGGT AGG Exonic
900163912 1:1237184-1237206 CCTTCCGAGGAGGACAGGGTGGG - Intergenic
900164951 1:1240836-1240858 CCTCCGGGACTGGGTAGGGTGGG + Intergenic
900399330 1:2466593-2466615 GCCCCGGATGTGGGCAGGGCAGG - Intronic
900404782 1:2487745-2487767 GCCCCAGAGGTGGGCAGGGTAGG + Intronic
900501726 1:3009148-3009170 CCACAGGAGGTGGGCATGGAAGG - Intergenic
900992509 1:6104449-6104471 CCTCCGGAGGTGGGCAGGGTAGG + Exonic
901082019 1:6588908-6588930 CCTCCGCAGGTGGGCCTGGCGGG - Exonic
901205600 1:7493969-7493991 CCTCCCGAGATGGGCAGGAGAGG - Intronic
901929860 1:12590202-12590224 CCTCTGGAGGTGCTGAGGGTGGG + Intronic
902169314 1:14598155-14598177 CCTCCTGGGGTGGGCAGCGCAGG + Intergenic
902222606 1:14976591-14976613 CCTCTGGGGCTGGGCAGCGTGGG - Intronic
902378307 1:16040722-16040744 CCCCCGGGGGAGGGCAGGGATGG - Intergenic
902395532 1:16130485-16130507 CCTATGGAGGTGGGCAGGGGAGG + Intronic
902550019 1:17213792-17213814 CCACAGGAGGCGGGCAGGGGTGG + Intronic
903010272 1:20324871-20324893 CCTCTGACGGTGGGCAGGTTGGG - Intronic
904198273 1:28802215-28802237 CCTCAGGAGGTGAGCAGGGGAGG + Intergenic
905166872 1:36088197-36088219 CTGCAGGAGGAGGGCAGGGTTGG + Exonic
905784608 1:40744237-40744259 TTTCCAGAGATGGGCAGGGTGGG - Intronic
906608980 1:47189327-47189349 CCCTGGGAGGTGGGCAGGGTGGG + Intronic
907726488 1:57025158-57025180 CCTCCGGGAATGGGCAGGGGAGG + Intronic
908474431 1:64473553-64473575 CCTACGAAGATGGTCAGGGTGGG + Intronic
911163917 1:94708772-94708794 CCTCCTGAGAGGGGAAGGGTGGG - Intergenic
912496199 1:110093726-110093748 ACTGCTGAGGTAGGCAGGGTAGG - Intergenic
913179079 1:116302079-116302101 CATCCAGAGGTTGGCTGGGTTGG + Intergenic
913689200 1:121262387-121262409 CCTCTGGAGGTGGAGAGGGAAGG + Intronic
913997786 1:143665663-143665685 CCTCCAGATGTGGGCTCGGTGGG - Intergenic
914148399 1:145017894-145017916 CCTCTGGAGGTGGAGAGGGAAGG - Intronic
915759509 1:158296176-158296198 ACTCCTATGGTGGGCAGGGTGGG - Intergenic
916014796 1:160740456-160740478 CCTCTGGAGGAGGGCAGAGGGGG - Intronic
916386792 1:164282009-164282031 CCACTGAAGGTGGGCAGGGCAGG + Intergenic
916835612 1:168541958-168541980 CCTCAGAAGTTGGGCTGGGTGGG - Intronic
917450945 1:175146870-175146892 TCTTAGGAGGAGGGCAGGGTGGG - Intronic
917789621 1:178491181-178491203 GCACCGGCGATGGGCAGGGTAGG - Intergenic
917835978 1:178941963-178941985 CCTGTGAAGGTGGGCAGGATCGG - Intergenic
918847286 1:189633997-189634019 ATTCCAGAGGTGTGCAGGGTAGG - Intergenic
919859636 1:201730921-201730943 CCTACGGAAGTGTTCAGGGTTGG + Intronic
920476523 1:206280862-206280884 CCTCTGGAGGTGGAGAGGGAAGG + Intronic
920558645 1:206922925-206922947 CCATGTGAGGTGGGCAGGGTAGG - Intronic
920564636 1:206963706-206963728 CCTCCAGAGTTGGGCAGAGTGGG + Intronic
921065464 1:211619506-211619528 GCTCTGGAGGTGGGAAGGGCTGG - Intergenic
921416264 1:214890837-214890859 CCTGAGAAGGTGGGCATGGTAGG + Intergenic
922161249 1:223080535-223080557 CCTCCGGAGCAGCACAGGGTGGG - Intergenic
922572384 1:226641866-226641888 CCCCCTGAGGTGGGCACGGGTGG + Intronic
922616655 1:226964880-226964902 CCTCTGGAGGTGGGAGGGGGCGG + Intronic
922883177 1:228998114-228998136 ACTGTGGTGGTGGGCAGGGTAGG - Intergenic
922958767 1:229626477-229626499 GCACCGGAACTGGGCAGGGTTGG - Intronic
1062923590 10:1297920-1297942 CCTCCAGGTGTGGGCAGGGCTGG - Intronic
1063611107 10:7562828-7562850 TCTGTGGATGTGGGCAGGGTGGG + Exonic
1063677048 10:8150074-8150096 CCTCAGAAGGTGGCCAGGGAGGG - Intergenic
1065699237 10:28408905-28408927 CTGCAGGAGGTGGGCAGGTTTGG - Intergenic
1067064410 10:43095650-43095672 CCTGCTGAGCTGGGCAGGGTGGG + Intronic
1067080289 10:43208777-43208799 GCTCCGTGGCTGGGCAGGGTGGG - Intronic
1067081369 10:43214438-43214460 CCTACGAAGGGGGGCGGGGTGGG - Intronic
1067415216 10:46097450-46097472 CCTCCTGAGCTGGGCAGGCAGGG - Intergenic
1067435252 10:46272499-46272521 CCTCCTGAGCTGGGCAGGCAGGG - Intergenic
1068204434 10:53830935-53830957 CCTTTGGAGCTGGGCAGAGTGGG + Intronic
1069462909 10:68611831-68611853 GCTCGGGAGGTGGGGGGGGTGGG + Intronic
1069709340 10:70478877-70478899 GCTCCGGAGGTGGGCAGGCCAGG - Exonic
1069723061 10:70561752-70561774 CCTCCCAGGGTGGGCAGAGTGGG - Intronic
1071274750 10:84043196-84043218 CCTCCTCTGGTGCGCAGGGTGGG + Intergenic
1075568263 10:123520291-123520313 CCACCAGAGGTGGGGACGGTGGG + Intergenic
1075706712 10:124506635-124506657 CTTAGGGAGGTGGGGAGGGTAGG + Intronic
1077361260 11:2141079-2141101 CCTCAGGACGTGGACAGGGAGGG - Exonic
1081607507 11:44536692-44536714 CATCCGCGGGTGGGAAGGGTGGG + Intergenic
1082100742 11:48171050-48171072 AATCCAGATGTGGGCAGGGTTGG + Intergenic
1083261860 11:61527529-61527551 CATCCTGAGGAGGGCAGGGAGGG - Intronic
1084554825 11:69869350-69869372 CCTCAGGAGGTGGCCAGCCTGGG - Intergenic
1084587792 11:70073211-70073233 CCTGCCGAGGGGGACAGGGTCGG - Intergenic
1084816197 11:71648313-71648335 GCTCTGGAGGGGGGCAGGGTGGG + Intergenic
1084932891 11:72571076-72571098 CCGCTGGAGGTGGTGAGGGTCGG - Intergenic
1085170114 11:74442534-74442556 CCCTCTGAGGTGGACAGGGTAGG + Intergenic
1085812090 11:79692762-79692784 CCTCAGGAGGTTGGGAGGATAGG + Intergenic
1087377949 11:97367823-97367845 CCTTGGGTGGTGGGCAGGGTGGG + Intergenic
1087490654 11:98822935-98822957 CTTGGGGCGGTGGGCAGGGTGGG + Intergenic
1087958878 11:104323662-104323684 CATGAGGAGGTGAGCAGGGTTGG - Intergenic
1089586334 11:119512139-119512161 CGTGGGGAGGTGGGCAGGGGCGG + Intergenic
1089607053 11:119647551-119647573 CCAGAGGAGGTGGGCAGGCTGGG - Intronic
1090250533 11:125247777-125247799 TCTCCAGAGGTGCGCAGGATAGG + Intronic
1091221256 11:133931234-133931256 ACTCGGGAGGAGGGCAGCGTGGG - Intronic
1091353521 11:134916191-134916213 CCTCAGGAGGAGGGCAGGGTGGG - Intergenic
1091705738 12:2691752-2691774 CCGTCGCAGGTGGGCAGGGACGG - Intronic
1092426798 12:8381730-8381752 GCTCTGGAGGGGGGCAGGGCGGG - Intergenic
1092840658 12:12538027-12538049 TCTCCAGAGGTGGGCCTGGTTGG - Intronic
1094667552 12:32536439-32536461 GCTCAGGAAGTGGGCAGGGATGG - Intronic
1096252123 12:50040150-50040172 CCTCTGGCGGTGGGTAGGGGCGG - Intergenic
1096741348 12:53696118-53696140 CCCCCGGGGGCGGGGAGGGTGGG - Intergenic
1097224995 12:57471777-57471799 CATCCTGAGGTGGGCAGGCTAGG + Exonic
1098262762 12:68687340-68687362 GCTCCTGGGGTGGGCGGGGTAGG + Intronic
1100844661 12:98645590-98645612 CCTCCGAAGGTTGGCGAGGTGGG - Exonic
1102214496 12:111150749-111150771 CCTCGGGGGGTGGGAGGGGTGGG + Intronic
1102257628 12:111425338-111425360 CCACTGCAGGTGGGCAGCGTGGG + Intronic
1102458641 12:113086915-113086937 CTTCAGGTGGGGGGCAGGGTGGG - Intronic
1102910977 12:116713977-116713999 GCTCCTGAGGTTGGAAGGGTAGG - Exonic
1103865542 12:124049235-124049257 CCTCAGGAGGTGGGGTGGGGAGG - Intronic
1103900673 12:124302285-124302307 CCTCCTGAGATGGGCAGGCCTGG - Intronic
1104754128 12:131258376-131258398 CCTGGGGAGCTGGGCGGGGTAGG + Intergenic
1104778734 12:131406066-131406088 CCTGGGGAGGTAGGTAGGGTCGG - Intergenic
1105210662 13:18254954-18254976 CCTGAGGAGGTGGGGAGGGAGGG + Intergenic
1105813877 13:24016231-24016253 ACTCCAGGGGTGGGCAGGGATGG - Intronic
1108615580 13:52128957-52128979 CTTCGGGAGCTCGGCAGGGTGGG - Intronic
1111672497 13:91348156-91348178 CCGGCGGAGGGGGGCAGGGCCGG + Intergenic
1113200755 13:107866190-107866212 CCCGGGGAGGGGGGCAGGGTGGG + Exonic
1118543650 14:66859279-66859301 CTTCCGGAGCTGGGGATGGTGGG - Intronic
1118615007 14:67569248-67569270 ACACCCAAGGTGGGCAGGGTGGG + Intronic
1118820060 14:69339206-69339228 CCTGAGGAGGTTGGCAGGGGAGG + Intronic
1122310710 14:100792368-100792390 GCTCTGGAGAGGGGCAGGGTGGG - Intergenic
1122772570 14:104103864-104103886 TCTCGGGGAGTGGGCAGGGTTGG + Intronic
1122786259 14:104164518-104164540 CCTGCAGAGGTGGGGTGGGTGGG + Intronic
1122813415 14:104300225-104300247 CCGGTGGAGGAGGGCAGGGTGGG + Intergenic
1123019597 14:105391513-105391535 CTCCTGGGGGTGGGCAGGGTGGG - Intronic
1123031026 14:105451137-105451159 CCCCCTGGGATGGGCAGGGTGGG - Intronic
1126309571 15:47300425-47300447 CCTGGGGGGGTGGGCAGTGTTGG + Intronic
1128750860 15:70148037-70148059 TCTAAGGAGATGGGCAGGGTTGG + Intergenic
1129107948 15:73322172-73322194 TCTCCGGGGCTGGGCAGGGGTGG - Exonic
1129744997 15:78012255-78012277 CCTCCTGAGCTGTGCAGGGATGG - Intronic
1130106891 15:80935541-80935563 CTTCCTAAGATGGGCAGGGTTGG + Intronic
1130967906 15:88710678-88710700 CTTGGGGAGGAGGGCAGGGTTGG + Intergenic
1132639464 16:971061-971083 CCTTCGGCCGTGGGCAGGGCCGG - Intronic
1132640846 16:977653-977675 CCGCAGGAGGAGGGCCGGGTTGG + Intronic
1132715469 16:1288045-1288067 ACTCCAGGCGTGGGCAGGGTTGG - Intergenic
1132781691 16:1630023-1630045 TCTTCTGAGGTGGACAGGGTTGG + Intronic
1132996381 16:2825654-2825676 GCCACGGAGGTGGACAGGGTCGG + Intronic
1136092163 16:27928341-27928363 CCTGAGGAGCTGGGCAGAGTTGG - Intronic
1136413719 16:30091403-30091425 CCTCCCGGGGTGGGGAGGGAGGG - Intronic
1136927491 16:34388549-34388571 CCTCCGCCGGTGGGCAAGGAGGG - Intergenic
1136977083 16:35023257-35023279 CCTCCGCCGGTGGGCAAGGAGGG + Exonic
1137685178 16:50381817-50381839 CCTCCTGGGATGGGGAGGGTGGG + Intergenic
1138005918 16:53337495-53337517 TCTCAGAAGCTGGGCAGGGTGGG + Intergenic
1139939205 16:70592336-70592358 CCTCAGGAGGCGGTCAGGGTGGG - Intronic
1141124317 16:81389479-81389501 TCTGCGGAGGTGGGCAGAGCAGG - Exonic
1141825846 16:86479846-86479868 CATGCTGAGGTGGGCAGGGAAGG + Intergenic
1141964539 16:87432921-87432943 CCTCTGCAGGCGGGAAGGGTGGG - Intronic
1142240311 16:88941734-88941756 CCTGCGGAGGGGGAGAGGGTGGG - Intronic
1142808284 17:2383204-2383226 CTTCCTGAGGTGGGGTGGGTAGG - Intergenic
1142852896 17:2712686-2712708 CTTCCCGAGGTGGGCTGGGAGGG + Intergenic
1143116687 17:4585155-4585177 CCTCCGGAGTTGGAGAGGGCGGG + Intronic
1143378389 17:6480535-6480557 GCTCCGGAGCTGGGAAGGGTGGG - Intronic
1144316727 17:14069253-14069275 CCGGGTGAGGTGGGCAGGGTTGG - Intergenic
1144581271 17:16460871-16460893 CCTAGGGAGGTGGGAAGGGACGG - Intronic
1144729532 17:17518540-17518562 CATCCAGAGGTGGTCAGGGGAGG - Intronic
1145208047 17:20995050-20995072 CCTCCGGAGCTGGGCAGTATTGG - Intergenic
1145915733 17:28573014-28573036 ACTCTGGAGGTGGAGAGGGTGGG - Intronic
1146012188 17:29205049-29205071 TCTCAAGAGGTGGGTAGGGTTGG - Intergenic
1146678924 17:34793188-34793210 CCTCCGGAGTAGGGTGGGGTAGG - Intergenic
1147579846 17:41622088-41622110 CCTCATGAGGGAGGCAGGGTAGG + Intronic
1147891481 17:43720595-43720617 GCTCCGGAGGTGGGGTGGGAAGG + Intergenic
1148124041 17:45227944-45227966 CCTCCTGAGGGGGGCAGGGAGGG - Intronic
1148177970 17:45584452-45584474 CCTCTGGGGGTCGGCGGGGTTGG + Intergenic
1148262356 17:46194040-46194062 CCACCAGAGTTGGGCGGGGTGGG + Intronic
1148778428 17:50108736-50108758 CCTCAGGAGGTGGGAGGGGCTGG - Intronic
1148794190 17:50189329-50189351 GCTCCGGAGGTGTGCAGAGCTGG - Intronic
1148852592 17:50562007-50562029 CCTCCAGATGTGGTCAGGGGAGG + Intronic
1149461786 17:56834551-56834573 GCTCCCGAGGTGGGGCGGGTTGG + Intronic
1150223311 17:63509254-63509276 ACCCAGGAGGTGGGCAGGGATGG - Intronic
1150768248 17:68019917-68019939 CCTCCGGAGCTGGGGATTGTGGG - Intergenic
1151451457 17:74200655-74200677 CCTTCAGAGGTGGCCAGAGTGGG + Intergenic
1151678087 17:75610175-75610197 CCTCCGGCGGCGGGCAGCTTTGG + Intergenic
1151876190 17:76869304-76869326 TGTCCCGAGTTGGGCAGGGTTGG + Intronic
1151928016 17:77213034-77213056 CCTCCGTAGGTGGGGTGGGCTGG + Intronic
1152095299 17:78268825-78268847 CGGCAGGGGGTGGGCAGGGTGGG - Intergenic
1152166355 17:78710150-78710172 CCCCCTGAGGTGGGGAGGGGAGG + Intronic
1152325477 17:79633432-79633454 CGTAGGGAGGTGGGCTGGGTGGG + Intergenic
1152581663 17:81168054-81168076 CCTCCTGAGCTGGGGAGGGGAGG - Intergenic
1152740880 17:82017852-82017874 CCTACTGAGGTGGGCAGGGCGGG + Intergenic
1152744876 17:82034021-82034043 CCTCCGGCGGGGGCCAGGGAAGG - Exonic
1152892935 17:82892691-82892713 GCCTCGGAGGTGGGCAGGCTTGG + Intronic
1153451621 18:5237313-5237335 CTTCGGGTGGTGGGCAGGCTCGG - Intergenic
1153799635 18:8658017-8658039 CCTCCAGAGATGGGCAGGATTGG - Intergenic
1153913771 18:9727128-9727150 CCTGGGGAGATGGGCTGGGTAGG + Intronic
1153995079 18:10433756-10433778 GCTCCGGAGGTGACCTGGGTGGG - Intergenic
1155389116 18:25315036-25315058 CCTCAGGGGGTGGGGAGGGCTGG - Intronic
1156912523 18:42427138-42427160 CCTTCAGAGGTTGGCAGAGTAGG - Intergenic
1157240936 18:46008869-46008891 CCCCAGGGGGTTGGCAGGGTAGG - Intronic
1157414931 18:47494353-47494375 CTTCAGGAGATGGACAGGGTAGG - Intergenic
1157496670 18:48161722-48161744 CCTCCGGAGCGGGGCGGGGCTGG - Intronic
1157728382 18:49983049-49983071 TCTCCAGAGTTGGGCAGGTTTGG - Intronic
1157820075 18:50760680-50760702 CCACCAGAAGTGGGAAGGGTTGG - Intergenic
1160391214 18:78534770-78534792 CCTCCTGGGAAGGGCAGGGTGGG + Intergenic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160788762 19:913226-913248 CGCCCGGAGGCGGGCAGGGGCGG + Exonic
1160992343 19:1864856-1864878 CCGCCGGAGCTGGGAAGGGGCGG - Intergenic
1161180463 19:2877647-2877669 CCTACGAATGTGGGCAGTGTGGG + Exonic
1161849755 19:6732225-6732247 CCTCCGGAGCAGGGCGGGGAGGG - Intronic
1162259463 19:9520757-9520779 CTTCCAGAGCTGGGCAGGGTGGG + Intergenic
1162385475 19:10358135-10358157 TCTCCTGAGGTGGGCAGGAGAGG + Exonic
1162644152 19:12036195-12036217 CGTCCGGCGGTGGGCTGGGGGGG + Intronic
1162796262 19:13089172-13089194 TCATTGGAGGTGGGCAGGGTGGG + Intronic
1163555942 19:17992958-17992980 CCCCGGGAGGTGGGCAGGGTTGG + Intronic
1164574967 19:29400672-29400694 ACTGGGGAGGTGGGCAGGGCAGG + Intergenic
1165143856 19:33719239-33719261 CAGCCGGGGGTGGGCCGGGTGGG + Intronic
1165335961 19:35169783-35169805 CCTTCAGGGGCGGGCAGGGTTGG - Exonic
1165763023 19:38333600-38333622 CCTGCGGGGGTGGGCTGGGGTGG + Intergenic
1165948413 19:39458879-39458901 CCTCTGGAGGTGGGCAAGGAAGG + Exonic
1166979298 19:46623427-46623449 CCTCCGGAGCTGGGAGGAGTGGG - Intronic
1168340903 19:55622429-55622451 CCGAGGGAGGCGGGCAGGGTGGG - Exonic
925010238 2:479455-479477 TCTGCTGAGGTGGGCAGGGCTGG - Intergenic
925252519 2:2451953-2451975 ACTCAGGAGGTGCACAGGGTGGG - Intergenic
925368420 2:3326453-3326475 CCTCCTTAGGTGGGCATGGTGGG - Intronic
925385074 2:3456315-3456337 CCTCCTGGGGTGGGCCGTGTGGG + Intronic
925666114 2:6258038-6258060 CCCCCGCAGGAGGGCAGGGGTGG - Intergenic
925809604 2:7686178-7686200 CAGCCGAAGGTGGACAGGGTGGG + Intergenic
926712860 2:15896603-15896625 GCTCCGGAGCTGGGCACGCTGGG + Intergenic
927248006 2:20973536-20973558 CCTGCTGGGGTGGACAGGGTGGG + Intergenic
927514249 2:23662702-23662724 GCTCGGGAGGTGAGCTGGGTGGG - Intronic
927706185 2:25297849-25297871 CCCCAGGAGGTGGACAGGGCAGG + Intronic
928097418 2:28413141-28413163 TCTCCGAAGGTGGGCAGGAAGGG - Exonic
930059254 2:47274716-47274738 CCTCCCCAAGTGGGCAGGCTGGG + Intergenic
932202643 2:69845411-69845433 GCTTGGGTGGTGGGCAGGGTGGG - Intronic
933646826 2:84819955-84819977 CCTCCGTACTTGGGCAGGATTGG - Intergenic
935011513 2:99141054-99141076 GCTGCGGAGGTGCGCGGGGTGGG - Intronic
936042728 2:109161927-109161949 CCTCCTGGGGAGGGGAGGGTTGG + Intronic
936618998 2:114075640-114075662 AATCCGGAGGTGGGCAGTGAGGG - Intergenic
936976292 2:118224979-118225001 CCTCTGGAGGAGGTCGGGGTGGG + Intergenic
938116334 2:128605258-128605280 CCGCAGGAGGTGGCCAGCGTAGG + Intergenic
944544142 2:200782359-200782381 CCTCCTCAGATGGGCAGGGCCGG + Intergenic
946006020 2:216525611-216525633 CCCTCAGAGGTGGACAGGGTGGG - Intronic
947539327 2:230964326-230964348 CCCACGGAGGTGGGGAGGCTCGG + Intergenic
948177479 2:235955299-235955321 CATCAGCACGTGGGCAGGGTGGG + Intronic
948770738 2:240250249-240250271 TCTCAGGAGGTGGGAAGGGGAGG - Intergenic
1169345324 20:4823941-4823963 CCGCTGGAGGTGGGCTTGGTAGG - Intergenic
1171191686 20:23163499-23163521 CCTGCAGGGGTGGTCAGGGTGGG + Intergenic
1171291807 20:23986645-23986667 CCTAGGGAGGTGGGGAGGGAGGG + Exonic
1172135036 20:32681150-32681172 GCTCCTGGGGTGGGCAGTGTTGG - Intergenic
1172477221 20:35248075-35248097 CCTAAGGAGGTGGGAAGGGAGGG + Intronic
1172604271 20:36204042-36204064 CCTGTGGAGGTGGTCATGGTAGG + Intronic
1172758037 20:37301275-37301297 CCTCCGGAGGTGAGAAGTCTAGG - Exonic
1173337162 20:42122008-42122030 ACTCAGAAGGTTGGCAGGGTAGG + Intronic
1173860857 20:46282746-46282768 CCCCCGGGGGAGGGAAGGGTGGG + Intronic
1174395183 20:50242901-50242923 CCTCAGGAGGTCAGCAGGGCTGG - Intergenic
1174396510 20:50250286-50250308 CCTCGAGAGGTGCCCAGGGTAGG - Intergenic
1175389957 20:58620758-58620780 CCTTCGGTGGTGGGAAGGGATGG + Intergenic
1175836713 20:62000765-62000787 CATCGGGAGGTGGGCTGGGGTGG + Intronic
1175979348 20:62729238-62729260 CTCCGGGAGGAGGGCAGGGTGGG + Intronic
1176089575 20:63312926-63312948 GCTCACGAGGTGGGCAGGGGTGG + Exonic
1176148332 20:63575252-63575274 CCTCGGGAGGTCGGCTGGGTGGG + Intergenic
1178891289 21:36523042-36523064 CCTGGGGAGGTGGGGAGGGGTGG - Intronic
1178934677 21:36850986-36851008 CCACAGGTGATGGGCAGGGTGGG + Intronic
1179179911 21:39036228-39036250 CCACTGCAGGTGGTCAGGGTAGG - Intergenic
1180780724 22:18517931-18517953 CCTGAGGAGGTGGGGAGGGAGGG + Exonic
1181020774 22:20101068-20101090 GCTGAGGAGGTGGCCAGGGTGGG - Intronic
1181199619 22:21209568-21209590 CCTGAGGAGGTGGGGAGGGAGGG + Intronic
1181400141 22:22646290-22646312 CCTGAGGAGGTGGGGAGGGAGGG - Intronic
1181649223 22:24249500-24249522 CCTGAGGAGGTGGGGAGGGAGGG + Intergenic
1181702113 22:24627388-24627410 CCTGAGGAGGTGGGGAGGGAGGG - Intronic
1181867542 22:25870752-25870774 ACTCTGGAGGGGGGCAGGGCTGG + Intronic
1182134363 22:27887551-27887573 CCTGGGGAGGTGGGGTGGGTGGG - Intronic
1182149609 22:28018780-28018802 CCGCCAGAGGTGCGCATGGTGGG + Intronic
1182900595 22:33895102-33895124 TCTACAGAGGTGGGCAGAGTTGG + Intronic
1183099496 22:35575186-35575208 CCTCCAGAGGGGAGCAGGGATGG + Intergenic
1183264331 22:36816335-36816357 CCTCCTTAGGCGGGCAGGGGAGG - Intronic
1183360318 22:37379919-37379941 CCTCCGAGGGGGGGCAGGGGTGG - Intronic
1183464943 22:37974964-37974986 GCTCAGGAGGAGGGAAGGGTTGG - Intronic
1184293528 22:43510206-43510228 CCTAGGGAGGTGTGCAGGGCAGG + Intergenic
1184643165 22:45882865-45882887 CCTAGGGAGGAGGGCAGGGATGG + Intergenic
1185326608 22:50228718-50228740 GCTGTGGAGGTGGGCATGGTGGG - Intronic
952087188 3:29838225-29838247 CCTACTGAGGAGGCCAGGGTGGG + Intronic
953982690 3:47420514-47420536 CCTCCAGAAGAGGGCAGGGCAGG + Intronic
954672868 3:52299856-52299878 CCCAGGGAGGAGGGCAGGGTAGG + Intergenic
954868317 3:53748305-53748327 CTGCAGGAGGTGGGCAGGCTGGG + Intronic
954894756 3:53965889-53965911 CCTTCAGAGGTGGGCACTGTAGG + Intergenic
955227520 3:57073393-57073415 CCACTGGAGTTGGGCAGCGTGGG + Exonic
955413141 3:58668739-58668761 CCTCAGCAGGTGGTCAGGGAAGG + Intergenic
955601970 3:60655220-60655242 CAGCTGGAGGTGGGAAGGGTGGG + Intronic
956807393 3:72828794-72828816 GCTACAGAGGTAGGCAGGGTCGG + Intronic
957071486 3:75571046-75571068 GCTCTGGAGGAGGGCAGGGCGGG - Intergenic
961332615 3:126151876-126151898 TGTCCAGAGGTGGTCAGGGTGGG - Intronic
961463001 3:127064764-127064786 CCTCAGGACGGGGGCAGGGGTGG + Intergenic
964482740 3:157159347-157159369 CATCCGGAAATGGGCAGAGTAGG - Intronic
967904122 3:194486845-194486867 CGGCGGGAGGTGGGCAGGGGAGG + Intronic
968074091 3:195806667-195806689 CCTCCGTCGGTGGGCTGGGCTGG + Intronic
968663066 4:1806731-1806753 CCTCCGGGGCTGGGCGGGGGAGG + Intronic
968897434 4:3412959-3412981 CCTCCTGACGTGAGCAGTGTGGG - Intronic
968897467 4:3413064-3413086 CCTCCTGACGTGAGCAGTGTGGG - Intronic
968942907 4:3648412-3648434 GCTGCGGAGGCGGGCGGGGTCGG - Intergenic
969015093 4:4098737-4098759 GCTCTGGAGGGGGGCAGGGCGGG - Intergenic
969575389 4:8033523-8033545 CCTCGGCAGGTGGACAGGGCTGG - Intronic
971195932 4:24471826-24471848 CCCGCGGAGGTGGGGGGGGTGGG - Intergenic
973782375 4:54300582-54300604 GCTGTTGAGGTGGGCAGGGTGGG + Intergenic
973825326 4:54699219-54699241 TTTCCAGAGGTGAGCAGGGTAGG + Intronic
976501716 4:85797818-85797840 CATTCTGAGGAGGGCAGGGTTGG - Intronic
979745365 4:124206048-124206070 GGTCAGGAGGTGGGGAGGGTGGG + Intergenic
985580667 5:693755-693777 CCTCCTGGGGTGGGGTGGGTTGG + Intergenic
985595291 5:785087-785109 CCTCCTGGGGTGGGGTGGGTTGG + Intergenic
987251816 5:16108233-16108255 CCACCAGAGCTGGGCAGGGCTGG + Intronic
988643622 5:33069284-33069306 CCTCTAGAGGTAGGTAGGGTTGG + Intergenic
989431787 5:41364074-41364096 CCTCCAGGGGTGGGCATGGGGGG + Intronic
991471152 5:66970266-66970288 GCTCCAGAGGAGGACAGGGTGGG + Intronic
992910798 5:81394180-81394202 CCTCTGGAGCTGGGCGGGGAGGG - Intergenic
997979557 5:138460270-138460292 CCACAGGGGCTGGGCAGGGTTGG + Intergenic
998173486 5:139885998-139886020 TCTCGGAAGGTGGGCTGGGTGGG + Intronic
999188206 5:149728543-149728565 CCTTGTTAGGTGGGCAGGGTGGG + Intergenic
999195635 5:149779768-149779790 CCTCCGGAGGTGGCAAGGTTAGG + Intronic
999283271 5:150379060-150379082 CCACAGGAGGTGTGGAGGGTTGG + Intronic
999404179 5:151292512-151292534 CCTTGTGAGGTAGGCAGGGTGGG - Intronic
1001677186 5:173528468-173528490 CATGATGAGGTGGGCAGGGTTGG + Intergenic
1002299310 5:178248413-178248435 CCCCGGGTGGTGGGCAGTGTGGG + Intronic
1006401742 6:33821748-33821770 CCTGGGGAGGTGGGCAGGCTGGG - Intergenic
1006454885 6:34125975-34125997 CCTCAGGAGGTGCTCAGGGGAGG - Intronic
1006512057 6:34526702-34526724 CATCCTGAGGTGGGCAGGGGTGG + Intronic
1006639891 6:35484466-35484488 CTCGAGGAGGTGGGCAGGGTAGG + Intronic
1007807010 6:44457980-44458002 GCTCCGCAGGTGGGGAGGGGAGG + Intergenic
1008320344 6:50104413-50104435 TATGGGGAGGTGGGCAGGGTGGG + Intergenic
1012050978 6:94343568-94343590 TCTGGGGAGGTGGGCAGTGTTGG + Intergenic
1012429638 6:99151174-99151196 CCACTGGAGGTGAGAAGGGTGGG - Intergenic
1012499693 6:99875085-99875107 CCTCCCACGGTGGGCAGAGTGGG - Intergenic
1012906508 6:105073012-105073034 CTTCAGGAGGTGTACAGGGTAGG + Intronic
1012947810 6:105486736-105486758 CCTCCAGAGCGGAGCAGGGTCGG - Intergenic
1014110626 6:117616402-117616424 CCCCATGAGGTGGGCAGGATGGG + Intergenic
1018686589 6:166308322-166308344 CCCCAGGAGGAGGGGAGGGTGGG - Exonic
1018851684 6:167644936-167644958 CCCCTGCAGGTGGGCAGGGTGGG - Intergenic
1018924657 6:168197815-168197837 CCTGTGGGGGTGGGGAGGGTGGG + Intergenic
1019208014 6:170378793-170378815 CTTCCGGTTGTGGGCAGGGTGGG + Intronic
1019552525 7:1610300-1610322 CCTCCGGGGGTGTCCAGGCTGGG - Intergenic
1019571201 7:1713285-1713307 CCTTCTGAGGTGGGCCGGGCTGG - Intronic
1019574501 7:1729934-1729956 CCCCAGGAGGTGGGCGGGGGTGG + Intronic
1019666618 7:2255076-2255098 CCTCCGGCGGGGAGCACGGTGGG + Exonic
1019701012 7:2475077-2475099 CCTGCTGGGGTGGGCAGTGTGGG + Intronic
1019931753 7:4228139-4228161 CCTTCTGAGGTGGACAGGATTGG + Intronic
1020025744 7:4898651-4898673 CTTCAGGAGGTGGCCAAGGTGGG + Intergenic
1020272982 7:6607894-6607916 ACTCCGCAGGTGCGCACGGTAGG - Intronic
1021976411 7:26015027-26015049 CCTCCTTAAGTGGGGAGGGTGGG - Intergenic
1022389005 7:29927482-29927504 CCTCTGGATGTGGGGAGGGTAGG - Intronic
1023448778 7:40259155-40259177 CCTGGGGAGGAGGGCAGGTTAGG + Intronic
1023986638 7:45100993-45101015 GCTTAAGAGGTGGGCAGGGTAGG - Intronic
1024281966 7:47725628-47725650 CCTGCGGAGCTGGGAAGGGCAGG + Intronic
1026949747 7:74339082-74339104 CCCCCTGGGCTGGGCAGGGTGGG + Intronic
1027238272 7:76310935-76310957 CCTGGGGCGGTGGGCAGGGAGGG - Intergenic
1028827505 7:95290357-95290379 CCTCTGGAGGAGAGCAGGGCAGG - Exonic
1032263745 7:130356238-130356260 CCTCCCGGGTTGGGCAGGGGAGG - Intronic
1032644413 7:133806623-133806645 ACTCCAGAGGTGGGCAGGCAAGG - Intronic
1033558342 7:142508240-142508262 ACTGCGGAGGTGGGAAAGGTGGG - Intergenic
1034800238 7:154051782-154051804 TCTCCGGAGGAGGGCAGGAAAGG - Intronic
1035394485 7:158526259-158526281 CCGCCACAGGTGGGCAGGGAGGG - Intronic
1035754936 8:2023884-2023906 CCGCGGGAGCTGGGCAGGGATGG + Intergenic
1036211420 8:6844060-6844082 CCTCAGGAGGCCGGCATGGTGGG + Intergenic
1036897913 8:12650523-12650545 GCTCTGGAGGGGGGCAGGGCGGG - Intergenic
1037667117 8:20979497-20979519 TCTCAGGAGGTGGGCAGGAGGGG - Intergenic
1038017635 8:23528954-23528976 CTGCAGGAGGTGGGCAGGGAGGG - Exonic
1043395307 8:79829643-79829665 CCCCCAGAGGGGGGCAGGGGAGG - Intergenic
1048416607 8:134234022-134234044 CTTTTGGAGGTGGGGAGGGTGGG + Intergenic
1048443488 8:134476933-134476955 CCCCCTGGGGTGGGCAGTGTGGG - Intergenic
1049334340 8:142074815-142074837 CCTCCGTGGGTGGGCAGTGCAGG - Intergenic
1049534667 8:143173148-143173170 TCACTGGAGCTGGGCAGGGTAGG - Intergenic
1049618859 8:143588886-143588908 CCACCCCAGGTGGGCAGGGGAGG + Intronic
1049646934 8:143739722-143739744 CCTCGGGAGGAGGCCCGGGTGGG + Intergenic
1053129745 9:35608275-35608297 CTTACGGATGGGGGCAGGGTGGG - Intronic
1053613039 9:39734592-39734614 CCTCCGTAGGTGGGGAGAGAAGG - Intergenic
1053871081 9:42492534-42492556 CCTCCGTAGGTGGGGAGAGAAGG - Intergenic
1054240476 9:62607810-62607832 CCTCCGTAGGTGGGGAGAGAAGG + Intergenic
1054554609 9:66642332-66642354 CCTCCGTAGGTGGGGAGAGAAGG + Intergenic
1056816405 9:89804532-89804554 CCACCGGATGGGGTCAGGGTAGG - Intergenic
1057555957 9:96087587-96087609 CCTCGGGAGTTGGGCTGGGCAGG + Intergenic
1059145681 9:111897137-111897159 CCGCAGGAGGAGGACAGGGTGGG - Exonic
1059961737 9:119571828-119571850 CTTGGGGAGGTGGGCTGGGTGGG + Intergenic
1060114115 9:120927634-120927656 CCTCAACAGGTGGGCAGGGCAGG + Exonic
1060172036 9:121469799-121469821 CCTCCTGGGGTGTGCAGGGCAGG - Intergenic
1060270080 9:122133906-122133928 TCTCAGGAGGTGGGGAGGGATGG - Intergenic
1060812649 9:126618786-126618808 GCTCCGGAAGGGGGGAGGGTCGG + Intronic
1061086856 9:128404666-128404688 CCCCAGGAGGGGAGCAGGGTGGG - Intergenic
1061406658 9:130396105-130396127 TCTAAGGGGGTGGGCAGGGTGGG - Intronic
1061615466 9:131776086-131776108 TCTCAGGAGGTGGGCTGGGTGGG - Intergenic
1061822821 9:133238266-133238288 CCCCCAGAGCTGGGCAGGGTTGG + Intergenic
1062126686 9:134867739-134867761 CCTCTGGAGAGGGGCAGTGTGGG - Intergenic
1062134361 9:134916940-134916962 CCTCTGGAGAGGGGCAGTGTGGG + Intronic
1062281798 9:135755178-135755200 AGTCGGGAGGGGGGCAGGGTAGG - Intronic
1062395908 9:136352730-136352752 CCTCCAGAGCTGGGCCAGGTGGG - Intronic
1186407020 X:9313203-9313225 TCTCAGGAGGTGGGCAGGGCCGG - Intergenic
1186492564 X:9985594-9985616 CCTCAAGAGGTGGGCAAGATTGG + Intergenic
1187332237 X:18351568-18351590 CCTCTCGGGGTGGGGAGGGTAGG - Intronic
1198480592 X:137036177-137036199 CCTCCAGATGTGAGCAGAGTAGG + Intergenic
1199860612 X:151797786-151797808 ACTCAGGAGGTGGGGATGGTTGG - Intergenic
1200080011 X:153571657-153571679 GCTCCGGAGGTGGGGAGGAGGGG - Intronic