ID: 900994364

View in Genome Browser
Species Human (GRCh38)
Location 1:6112489-6112511
Sequence CTGGGTGGTCCTGATGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900994364 Original CRISPR CTGGGTGGTCCTGATGTGGT CGG (reversed) Intronic
900156025 1:1203598-1203620 CTTGCTGGCCCTGATGGGGTGGG - Exonic
900737129 1:4306068-4306090 CTGGGTGGTCTTGAGGTGGGAGG - Intergenic
900966242 1:5960727-5960749 CTGGGTGGTCCTCATGGCCTGGG - Intronic
900994364 1:6112489-6112511 CTGGGTGGTCCTGATGTGGTCGG - Intronic
902066290 1:13690919-13690941 CTGGGTTGTCCTAATTGGGTGGG - Intergenic
902172095 1:14620362-14620384 CTGGGTGTTTCTGATGTGCTAGG - Intronic
902882399 1:19381266-19381288 GTGGTTGGTTCTGTTGTGGTGGG - Intronic
903283631 1:22263975-22263997 CTGGGTGGTGGTGGTGGGGTGGG + Intergenic
905106004 1:35563953-35563975 CTGGGTGGACCTCCTGTGTTTGG + Intronic
905650190 1:39651063-39651085 CAGGGTGGTCTTCATGTGCTGGG + Intergenic
908237419 1:62159919-62159941 CTTGGAGGTCCTGAGGTGCTGGG - Intronic
908329073 1:63052459-63052481 CTGAGTGCTTCTGATGTGCTAGG - Intergenic
909870466 1:80732037-80732059 CTGGGTGGTCTTGATGCTCTTGG - Intergenic
911487309 1:98517366-98517388 CTGGATGGTCTTGATGTTTTTGG - Intergenic
911797000 1:102088381-102088403 CAGGCTGGTGCTGATGTGCTGGG + Intergenic
912770222 1:112456896-112456918 CTTGTTGGTCCTGATCTGCTTGG - Exonic
914225830 1:145718929-145718951 CAAAATGGTCCTGATGTGGTGGG - Intergenic
915826256 1:159080657-159080679 CTGGGTGATTCTGATGCTGTTGG + Intronic
915981870 1:160425408-160425430 CTGGGGGGTCCTGAGGGGGTGGG + Exonic
916443249 1:164847897-164847919 CTGAGTGCTCCAGAGGTGGTGGG - Exonic
919779958 1:201215406-201215428 CTTGTTTGTCCTCATGTGGTGGG + Intronic
919794628 1:201313858-201313880 CTGGGTGATGCTGATGTTGCTGG - Intronic
920458063 1:206116276-206116298 CAGGGTGGTCCAGGTGAGGTAGG + Exonic
921546678 1:216482312-216482334 CTGGGTGGCCCTGAGGTTGCAGG - Intergenic
923404506 1:233646639-233646661 CTGGAGGGTTCTAATGTGGTGGG + Intronic
924049063 1:240061965-240061987 CTGGTTGGTCCTGAGTTGGATGG - Intronic
924698561 1:246426411-246426433 CTGGGAGGTCGAGATGGGGTAGG - Intronic
1066063440 10:31744606-31744628 CTTGGTGGTCCTGTTGTTATTGG - Intergenic
1067392462 10:45876442-45876464 CTGGGTGGGCCTGATTCAGTTGG - Intergenic
1067860787 10:49845557-49845579 CTGGGTGGGCCTGATTCAGTTGG - Intronic
1067975949 10:51025386-51025408 CTGGCTGGTCCTGGTGTCATGGG + Intronic
1069274370 10:66570610-66570632 CTGGTTTGTTCTGATGTGTTTGG - Intronic
1070554544 10:77517542-77517564 CTGGGTGGTTCTGCTGAGTTGGG + Intronic
1072211278 10:93249035-93249057 CTGGGAGCTCCTGATCTGCTTGG + Intergenic
1073177566 10:101565710-101565732 CTGGGGGGTGGTGATGAGGTGGG - Intergenic
1073860183 10:107729946-107729968 CTGGGTGCTCCTGTTTTGGGTGG + Intergenic
1075553961 10:123415909-123415931 CTGGATAGTCCTGATTTGTTGGG - Intergenic
1076675646 10:132146294-132146316 CCAGGTGGGCCTGATGTGGTGGG - Intronic
1076698081 10:132256718-132256740 GTGGGTGGTCCTGGGGTGCTGGG - Intronic
1078564598 11:12403477-12403499 GTGGGAGGTTCTGATGCGGTGGG + Intronic
1080542443 11:33280863-33280885 CTTGGGGGCCCTGATTTGGTAGG + Intronic
1080852207 11:36079544-36079566 CTGGTTGGGGCTGATGTTGTGGG + Intronic
1083170566 11:60921946-60921968 CTTCGTGGCCCTGATGAGGTCGG + Exonic
1084408861 11:68994474-68994496 CTGAGTGCTCATGATGTGCTGGG - Intergenic
1084659911 11:70540589-70540611 CTGGGTGGGGCTGACGGGGTGGG - Intronic
1084779256 11:71397771-71397793 CAGGGTGGCCCTGATGGGGCTGG - Intergenic
1085256678 11:75177578-75177600 CAGGGTGGTCCAGTGGTGGTGGG + Intronic
1085263902 11:75224987-75225009 CTGGGTGGTGGTGAGGAGGTGGG - Intergenic
1086515319 11:87604762-87604784 CTGGTGGGTCCTCATGTGATGGG - Intergenic
1087482179 11:98716126-98716148 CTGGGTGCTCCTGTATTGGTTGG + Intergenic
1088818050 11:113434778-113434800 CTGGCTGGTGCTGATGGGGGGGG - Intronic
1089742977 11:120597646-120597668 CGTGGGGGTCCTGAGGTGGTGGG + Intronic
1090229421 11:125090846-125090868 CTTGGTGGTCCTGGTGTGTCCGG - Intergenic
1091648854 12:2294532-2294554 CGCGGTAGGCCTGATGTGGTGGG + Intronic
1092045679 12:5430635-5430657 CCGGTTGGTCCTGAACTGGTGGG + Intergenic
1094056536 12:26274438-26274460 CTGGGTGGTCCTTCTTGGGTGGG + Intronic
1094694985 12:32809338-32809360 CTGGGTGGTCCAGATGAGGAAGG - Intronic
1097229404 12:57500308-57500330 CTGGGTGATTCTGGTGAGGTGGG - Exonic
1097947014 12:65380291-65380313 TTGGGGGGTCCTGATATAGTTGG + Intronic
1098047079 12:66411087-66411109 CTGGGTGGTCTGGATGAGGGTGG + Intronic
1098539615 12:71639808-71639830 CTGGATGATCCTGACATGGTGGG - Intronic
1098909959 12:76198886-76198908 ATGGGTGCTGCTGATGTGCTGGG - Intergenic
1101725305 12:107383769-107383791 TTGGGTGGGCCTATTGTGGTTGG + Intronic
1103401011 12:120642499-120642521 TTGCGTGGTGCTGCTGTGGTGGG + Intronic
1103913870 12:124366138-124366160 CTGGGCGGTGCTGCAGTGGTGGG - Intronic
1105454653 13:20528906-20528928 CTGGGTGGTCCTTGTGAGGCTGG - Intergenic
1105539629 13:21304328-21304350 CTGGGTAGTTCTGTTGTGCTGGG + Intergenic
1115935200 14:38544393-38544415 CTTCCTGGTCCTCATGTGGTTGG + Intergenic
1116774388 14:49163419-49163441 CTGTGTTGGCCTGGTGTGGTGGG - Intergenic
1116889515 14:50254509-50254531 GTGGCTGGTCCTGATGTTGAGGG - Intronic
1118391791 14:65302071-65302093 CTGGTTGGTCCTGAGTTGGAAGG - Intergenic
1118447208 14:65862876-65862898 CTAGGTGCTGCTGCTGTGGTTGG - Intergenic
1118478158 14:66138073-66138095 CTGTGTGGGCCTGATCTGCTGGG + Intergenic
1118595605 14:67432790-67432812 CTGGGTGGTCCTGGGTTTGTAGG + Intergenic
1119088713 14:71760474-71760496 CTGAGTGGTCCTGTTGGGTTGGG + Intergenic
1119163379 14:72471702-72471724 CTGGGTGGTCAGGAGGTGGCTGG - Intronic
1120052864 14:79888406-79888428 CTGGGTGATTCTGATGTAATTGG + Intergenic
1120070700 14:80099181-80099203 CTGGGGTGTGCAGATGTGGTCGG - Intergenic
1121941450 14:98074717-98074739 CTATGTGGTTCTGATGTGTTTGG - Intergenic
1122115214 14:99524024-99524046 ATGGGTGGCTCTGATGGGGTGGG - Intronic
1122262599 14:100531775-100531797 CTGGGTGGGGGTGATGGGGTGGG - Intergenic
1122824428 14:104362708-104362730 CTGGGTGTTCCTCATGTTGACGG + Intergenic
1122929225 14:104925821-104925843 CTGGGGGGTCCTGCAGAGGTGGG - Intronic
1125966612 15:43880193-43880215 CTGGGTGGCTCTGAAGTGGGAGG + Intronic
1126183979 15:45812417-45812439 CTGGATGGTGCTGATGAGGCAGG - Intergenic
1126784243 15:52163668-52163690 CTGGGTGGTCTGGATGAGGGAGG + Intronic
1129616892 15:77105854-77105876 CTGGGTTGTCCGGAGGTGATGGG - Exonic
1130274850 15:82471035-82471057 CTGGGAGGTGCTGATGTGAGAGG - Intergenic
1130467200 15:84198404-84198426 CTGGGAGGTGCTGATGTGAGAGG - Intergenic
1130486411 15:84400779-84400801 CTGGGAGGTGCTGATGTGAGAGG + Intergenic
1130497063 15:84475132-84475154 CTGGGAGGTGCTGATGTGAGAGG + Intergenic
1130589494 15:85203002-85203024 CTGGGAGGTGCTGATGTGAGAGG - Intergenic
1132814229 16:1818270-1818292 CTGGGTGGTGCCGGTGTGGGAGG - Intronic
1136499858 16:30664762-30664784 CAGGGTGGCCCTGAGGTGGTGGG + Exonic
1136568300 16:31082674-31082696 GTGGGTGGCCCTGAGATGGTGGG + Intronic
1139120250 16:64007653-64007675 CTGTGTGGTGCTGGGGTGGTGGG - Intergenic
1140756763 16:78074575-78074597 CAGGGTGATGCTGATGTTGTGGG + Intergenic
1141556440 16:84839595-84839617 ATGGGTGTTCCAGGTGTGGTTGG + Intronic
1142159255 16:88548207-88548229 CTGGCTGGTGCTGACGTGGAGGG - Intergenic
1146921565 17:36716181-36716203 CTGGGTGGCTGAGATGTGGTGGG + Intergenic
1148034263 17:44646645-44646667 CTGGGTGGTGATGATGCTGTTGG + Intergenic
1148848037 17:50540658-50540680 CTGGGTGGTCCTGAGGCTGCAGG + Intronic
1150624169 17:66830755-66830777 ATGGGTGATGCTGATGTGGATGG + Intergenic
1150740579 17:67776157-67776179 CTGAGTGGGTCTGCTGTGGTGGG - Intergenic
1150813505 17:68375193-68375215 CTAGGTGACGCTGATGTGGTTGG + Intronic
1151507975 17:74541837-74541859 CAGGGGGGTGCTTATGTGGTTGG - Intronic
1152386085 17:79975623-79975645 CAGGGTGGACCTGTTGTGGGCGG - Intronic
1152576605 17:81143932-81143954 CTGGGTGCACCTGCTGTTGTGGG - Intronic
1152634422 17:81424752-81424774 TGGGGTGGTGTTGATGTGGTTGG + Intronic
1152634446 17:81424896-81424918 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634464 17:81425009-81425031 GTGGTTGGTGATGATGTGGTTGG + Intronic
1152634475 17:81425052-81425074 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634515 17:81425217-81425239 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634566 17:81425426-81425448 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634597 17:81425557-81425579 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634619 17:81425643-81425665 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634637 17:81425726-81425748 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634642 17:81425755-81425777 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634668 17:81425874-81425896 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634679 17:81425945-81425967 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634687 17:81425985-81426007 GTGGTTGGTGATGATGTGGTTGG + Intronic
1152634708 17:81426068-81426090 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634734 17:81426183-81426205 GTGGTTGGTGGTGATGTGGTTGG + Intronic
1152634736 17:81426198-81426220 GTGGTTGGTGATGATGTGGTTGG + Intronic
1152662256 17:81547990-81548012 CTGCGTGGCCCAGATGTGGGTGG - Intronic
1152772316 17:82177751-82177773 TTGGGTGGTCTTGTTGGGGTGGG + Intronic
1152863199 17:82708019-82708041 TTGGGGGGCCCTGCTGTGGTAGG + Intergenic
1155519223 18:26652321-26652343 CTTGGTGGTTCTCATGTGGATGG - Intronic
1159461984 18:68733128-68733150 CTGCTTGGGGCTGATGTGGTTGG - Intronic
1159919369 18:74213992-74214014 TGGGGAGGTTCTGATGTGGTTGG - Intergenic
1163328554 19:16621163-16621185 CTGGGTGGTTCTGATGTCAGAGG - Intronic
1163505536 19:17703871-17703893 CTGGATGGGCCTGGAGTGGTTGG + Intergenic
1165141233 19:33701104-33701126 CTGGGAGGCCCTGATTTGGAGGG + Intronic
1165354669 19:35296090-35296112 CTGGGAGGTGCTGATTTGGCTGG + Intronic
1165723448 19:38095955-38095977 CTGGGTGGCCCTGGGGTTGTGGG - Intronic
1167072531 19:47229008-47229030 CTGGATGCTCCTGCTTTGGTCGG - Intronic
1167094997 19:47370525-47370547 ATGGGTGGTCCTGCCATGGTGGG - Intronic
1167516706 19:49927779-49927801 CTGGGATGTCCTGATGTGGATGG + Exonic
1167569230 19:50276602-50276624 CTGGGTGGTGATGCTGTGGAAGG - Intronic
925538006 2:4936983-4937005 CAGGGGGGCCCTGATGTTGTGGG - Intergenic
927253541 2:21019663-21019685 CTAGGTGGCCATGATGTGGAAGG + Intronic
927408662 2:22800578-22800600 CTGGGTGGTCCTGTGCTGCTGGG - Intergenic
928698295 2:33872552-33872574 CTGGGTGGTCCAGGTTTGATAGG - Intergenic
929871360 2:45761922-45761944 CTGGGTGGTCCTGAAGGGCAAGG - Intronic
932818250 2:74878712-74878734 CCGTGAGGTCCTGATGCGGTTGG + Exonic
933051293 2:77605783-77605805 ATGGGTGGTGCTGATTTGTTGGG - Intergenic
933709756 2:85316307-85316329 CTGGGTGGCCCTCATGTGGAGGG + Intergenic
933713306 2:85343456-85343478 CTGGGTGGCCCTCATGTGGAGGG - Intronic
933990320 2:87629039-87629061 CTGGGTTGTCCTGTCCTGGTGGG - Intergenic
934716209 2:96546095-96546117 CTGAGTGGTCCTGCTTTGGTAGG - Intronic
936303526 2:111321785-111321807 CTGGGTTGTCCTGTCCTGGTGGG + Intergenic
937117001 2:119414298-119414320 CTGGGATGTGCTGATGTGGCAGG - Intergenic
937834884 2:126461844-126461866 ATTGGTGGGCCTGAAGTGGTTGG - Intergenic
939966176 2:148612489-148612511 CTGAGTGATTCTGATGTGATTGG - Intergenic
945321018 2:208423991-208424013 CTCCGTGGTCCTGATGTGTGGGG + Intronic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
946371168 2:219282126-219282148 CTGGGAGGCCCTGAGGTGGAAGG + Intronic
947286986 2:228528067-228528089 GAGGGTGGACCTGATGAGGTGGG - Intergenic
947342460 2:229154337-229154359 GTGGGTGGTCTTGGTGTGTTTGG - Intronic
948533953 2:238632377-238632399 CTGGATGGTCCTAATGAGATAGG - Intergenic
948756203 2:240161023-240161045 CTGGGTGGACCTGGGGTGATGGG + Intergenic
948815320 2:240507458-240507480 CTGGGTGGCCCTGATGAGCGGGG - Intronic
948928494 2:241115670-241115692 CTGGGTGGCCCTGGTGTAATGGG - Intronic
948928623 2:241116120-241116142 CTGGGTGGCCCTGGTGTAATGGG - Intronic
1169122110 20:3102927-3102949 CTGCGTGGTCCTGGTGGAGTGGG - Intergenic
1169781606 20:9316174-9316196 CTGGGTGGTGCTGATGATGCTGG - Intronic
1170820978 20:19756238-19756260 CTGGTCGGTCCTGAGGTCGTAGG + Intergenic
1172112615 20:32556199-32556221 CTTGGTGGTGCTGTTTTGGTCGG - Intronic
1173419080 20:42884619-42884641 CTGGGTGTTCTTTCTGTGGTTGG - Intronic
1173468511 20:43303569-43303591 CTCTGTGGTCCTGGTGTAGTAGG + Intergenic
1173973972 20:47173390-47173412 CCGGGGGATGCTGATGTGGTTGG - Intronic
1177757195 21:25362029-25362051 CTGGGGGGCCCGGAAGTGGTAGG - Intergenic
1179168697 21:38956080-38956102 CCAGGAGGTCCTGATGGGGTTGG - Intergenic
1179912612 21:44458190-44458212 CTGGGTGTGCCTGATGCGGGAGG + Exonic
1181112743 22:20611534-20611556 GTGGGAGTTCCTGATGCGGTAGG - Intergenic
1181258769 22:21582321-21582343 CTGGGTGGTATGAATGTGGTGGG + Intronic
1181359941 22:22326842-22326864 CTGGTTGGGCCTGATCTGCTGGG - Intergenic
1181369965 22:22408271-22408293 CTGGTTGGGCCTGATCTGCTGGG - Intergenic
1181906931 22:26205562-26205584 CTGGGTGATTCTGATGTAGGTGG - Intronic
1182115555 22:27754400-27754422 CAGGGTGGCCCTGCTGGGGTGGG - Intronic
1182125373 22:27811832-27811854 TTGGGTGCTCCTGATGGAGTGGG - Intergenic
1182351957 22:29704361-29704383 CGGGGTGGTCAGGAGGTGGTGGG - Intergenic
1183062476 22:35344643-35344665 CTGGGGGGTCCTCAGGTGCTGGG + Intronic
1183359128 22:37374329-37374351 CAGGATGGTCATGATGTAGTGGG + Exonic
1184459683 22:44630002-44630024 CTGGGTGGCCCTGATGTGGCTGG + Intergenic
1184691406 22:46119048-46119070 CTGGGGGGTCTGGGTGTGGTGGG + Intergenic
949418394 3:3837620-3837642 CTGGGTAATCCTGATGTGAATGG + Intronic
954224780 3:49174554-49174576 CCTGGTGGTCTTGCTGTGGTTGG + Intronic
954646506 3:52134965-52134987 CTGGGAGGTGGCGATGTGGTGGG - Intronic
956281054 3:67557393-67557415 CTTGGTGGTCAGGACGTGGTAGG - Intronic
957461182 3:80522567-80522589 CTGAGTGGTGGTGATGGGGTTGG + Intergenic
957862844 3:85979250-85979272 CTGGTTGTTGCAGATGTGGTTGG - Exonic
961447332 3:126987037-126987059 CTGGATGTGCCTGATGTGCTGGG - Intergenic
963539114 3:146563916-146563938 CAGGCTGGTCTTGATCTGGTGGG + Intergenic
965684342 3:171285851-171285873 CTTGGTGATTCTGATGTAGTCGG + Intronic
967917640 3:194590648-194590670 CTGGGTGCTTCTGGTGTGGCTGG - Intronic
968494850 4:909978-910000 CAGGGTTGTCCTGACGTGGGTGG - Intronic
968754563 4:2408665-2408687 CTGGGTGGTACTCATCTGGGCGG - Intronic
968876234 4:3269302-3269324 CTGGGTGGCCCTGCTGCTGTGGG - Intronic
974336857 4:60558974-60558996 CTCAGTGGTACTCATGTGGTTGG + Intergenic
976811139 4:89102452-89102474 CTGGGGGGTGCTGAGGTGGGAGG - Intronic
978928375 4:114279278-114279300 CTCGGTGTTGCTGATGTGGCTGG - Intergenic
979660911 4:123253743-123253765 TTGGGTTGTTATGATGTGGTGGG + Intronic
981948747 4:150380425-150380447 CTAGGTGATCCTGATGTAGGTGG - Intronic
983594060 4:169446512-169446534 CTGGGTGGTCTTGATGTTATGGG - Intronic
984786876 4:183575318-183575340 CACAGTGGTGCTGATGTGGTGGG + Intergenic
986162331 5:5241077-5241099 CTCAGTGGTGCTGATGTTGTGGG - Intronic
988610855 5:32723322-32723344 CTGTGTAGCCCTTATGTGGTAGG + Intronic
988970256 5:36459662-36459684 CTGGTTAGTCCTGATGAGGGTGG + Intergenic
993097352 5:83494867-83494889 GTGGGGGGTCCTGAGGTGGGAGG + Intronic
994406615 5:99352882-99352904 CTGGAGGGGCCTGAGGTGGTAGG + Intergenic
998453239 5:142250688-142250710 CTGGGTAGTCCTGAGGAGCTTGG + Intergenic
999977818 5:156929377-156929399 CTGGGTGGATGTGATTTGGTGGG - Intronic
1000018992 5:157302868-157302890 CTGGGTGATCCTGTTGTGGTTGG - Exonic
1002574029 5:180161477-180161499 CTGTGTGGACCTGATGGGGCCGG + Intronic
1003189030 6:3856776-3856798 CTGGGTGTTCCTCACGTGATTGG + Intergenic
1003572940 6:7267885-7267907 CTGGGTGGTTCTGATGCGTGTGG + Intergenic
1003701080 6:8466048-8466070 CTGGGTGGTCCTGGTTTGGGGGG - Intergenic
1004932653 6:20476833-20476855 TTGTGTGGGCCTGCTGTGGTTGG - Intronic
1006638336 6:35475683-35475705 CTGGATGGTGCTGTTGAGGTCGG + Exonic
1008535278 6:52502698-52502720 CTTGGTGGTCCTCATGTGGATGG - Exonic
1012655146 6:101807692-101807714 CTGGCTGGTTCTGATTTGGAGGG + Intronic
1015197113 6:130536449-130536471 CTGGGAGGTCCTGCTGAGTTAGG - Intergenic
1015610119 6:135008143-135008165 TTGGGTGATCATGATTTGGTGGG - Intronic
1016467066 6:144336234-144336256 GAGGGTGATCCTGATATGGTGGG + Intronic
1016989865 6:149921734-149921756 CTGGGTGGTGTGGATGTGATGGG - Intronic
1016993184 6:149943328-149943350 CTGGGTGGTGTGGATGTGATGGG + Intronic
1017005147 6:150024203-150024225 CTGGGTGGTGTGGATGTGATGGG - Intronic
1017715789 6:157212101-157212123 CTGGTGAGTCCTGATGTGGAAGG + Intergenic
1018101127 6:160441380-160441402 CAGGGTTGTGCTGATGTGCTGGG - Intronic
1019292884 7:258893-258915 CTGGATGGGCCTGGGGTGGTGGG - Intronic
1019577783 7:1745843-1745865 CAGGATGGTCATGATGTAGTGGG - Exonic
1021221904 7:17984506-17984528 CTGGGTAGTCCAGGTGTGGGAGG - Intergenic
1022684215 7:32580094-32580116 CTGGGTGGTAGTGCTGTGTTTGG - Intronic
1023241068 7:38147658-38147680 CTGGGTGGTCCTGATGCTTGTGG - Intergenic
1023476104 7:40579479-40579501 CTGAGTCTTCCTGCTGTGGTTGG + Intronic
1026991155 7:74586582-74586604 TTGGGAGGACCTGAGGTGGTGGG + Intronic
1027435381 7:78159037-78159059 ATGGGGAGTGCTGATGTGGTTGG - Intronic
1030789611 7:113707738-113707760 CTGAGTGGTCCAGAGGTGATGGG - Intergenic
1032519530 7:132533508-132533530 CAGGGGAGTCCTGATGTGGATGG - Intronic
1034039880 7:147866593-147866615 CTGGGTGCTCCTGTTTTGGTTGG + Intronic
1034255155 7:149720715-149720737 CTGGCTGCTCCTCATGTGGCTGG + Intronic
1034497496 7:151431404-151431426 CTGGGTCCTCCTGTTGGGGTGGG - Intronic
1035320758 7:158027835-158027857 CTCGGTGGCCCTGTTGGGGTGGG - Intronic
1036591423 8:10172303-10172325 TTGGGAGGTGCTGATGGGGTTGG + Intronic
1039637066 8:39179076-39179098 CTGGGTGGTCTCGATGAGGAGGG - Intronic
1041003539 8:53476795-53476817 CTGGATGGACCTGTTCTGGTTGG - Intergenic
1047111212 8:121791387-121791409 GTGGGTGGGCCTAATGTGGATGG - Intergenic
1047357610 8:124138589-124138611 ATGAGTGGTGCTGATGTGCTGGG - Intergenic
1048932188 8:139324124-139324146 GCGGGTGGCCCAGATGTGGTGGG - Intergenic
1051862631 9:21644175-21644197 CTGGGTGGTGCAGATGTGAGAGG - Intergenic
1059277669 9:113109412-113109434 ATGGGGGGTCCTGCTGTGGTGGG + Intergenic
1059278582 9:113115139-113115161 ATGGGGGGTCCTGCTGTGGTGGG - Intergenic
1062209973 9:135358286-135358308 CTGGGTCCTCCTGCTGCGGTGGG - Intergenic
1062433094 9:136534803-136534825 CTGGGGGGCTCTGATGTGCTGGG - Intronic
1062655226 9:137600935-137600957 CTGGTTGGTTCTGCTGTTGTTGG + Intergenic
1187273839 X:17801660-17801682 CTGGGTGGTCATGACGTAGGTGG + Exonic
1187829884 X:23370314-23370336 CTGGGAGGTGCTGATGTTGGTGG - Intronic
1189004493 X:36981837-36981859 CTGGGTGATCCTGATGTTGCGGG - Intergenic
1193360423 X:80573530-80573552 CCGTGAGGTCCTGATGCGGTTGG - Intergenic
1194580652 X:95666423-95666445 CTGGGTGCTCTGGATGAGGTGGG + Intergenic
1199709841 X:150461220-150461242 CTGGGTGGTCCTTCTGTGCATGG + Intronic
1202368946 Y:24184621-24184643 CTGGGAGGTACTGATGTGAGAGG + Intergenic
1202501839 Y:25485496-25485518 CTGGGAGGTACTGATGTGAGAGG - Intergenic