ID: 900994444

View in Genome Browser
Species Human (GRCh38)
Location 1:6112846-6112868
Sequence GGTCCAGAGGGCACCCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900994438_900994444 4 Left 900994438 1:6112819-6112841 CCTGGGAGACTGTGGGAGGCTGA 0: 1
1: 0
2: 4
3: 37
4: 670
Right 900994444 1:6112846-6112868 GGTCCAGAGGGCACCCTCAAGGG 0: 1
1: 0
2: 0
3: 14
4: 119
900994434_900994444 18 Left 900994434 1:6112805-6112827 CCAAGGGGACGGCGCCTGGGAGA 0: 1
1: 0
2: 0
3: 12
4: 160
Right 900994444 1:6112846-6112868 GGTCCAGAGGGCACCCTCAAGGG 0: 1
1: 0
2: 0
3: 14
4: 119
900994431_900994444 25 Left 900994431 1:6112798-6112820 CCTGGGGCCAAGGGGACGGCGCC 0: 1
1: 0
2: 0
3: 16
4: 189
Right 900994444 1:6112846-6112868 GGTCCAGAGGGCACCCTCAAGGG 0: 1
1: 0
2: 0
3: 14
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900994444 Original CRISPR GGTCCAGAGGGCACCCTCAA GGG Intronic
900477495 1:2882756-2882778 AGCACAGAGGGCACCCTCAGGGG + Intergenic
900994444 1:6112846-6112868 GGTCCAGAGGGCACCCTCAAGGG + Intronic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
902189172 1:14749409-14749431 GGTGCTGAGAACACCCTCAATGG + Intronic
902581426 1:17410151-17410173 GGGCCAGAGGGCATCATCACTGG - Intronic
904947062 1:34207027-34207049 GGCCATGAGGGAACCCTCAAGGG + Intronic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
911479571 1:98421252-98421274 TGTACAGAGGGAACCATCAAGGG - Intergenic
912439650 1:109688376-109688398 AGGCCAGAGGGCTCCCTCACCGG - Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
914332130 1:146682121-146682143 TGTCCACGGGGCACGCTCAAGGG - Intergenic
914340311 1:146754468-146754490 GGTGCAGAGGGAACCCAGAAAGG + Intergenic
914900598 1:151709219-151709241 GGGCCAGATGGCACCAGCAAAGG - Exonic
915917756 1:159951330-159951352 GGTCTAAAGGGCCCCCTCACAGG - Intergenic
919824493 1:201493800-201493822 GATTCAGTGGGCACCCTGAATGG + Intronic
920559814 1:206931101-206931123 GGTCCTGAGCAAACCCTCAAGGG + Intronic
923584169 1:235250416-235250438 GGTCCAGAGTGCACCCAATAGGG - Intronic
1064120274 10:12612200-12612222 GGTCTACAAGGCACCTTCAAGGG + Intronic
1067553255 10:47249789-47249811 GTCCCAGAGGGCACTCCCAAGGG + Intergenic
1070609732 10:77925508-77925530 GTTCCAAAAGGCACCCTCAAGGG + Intronic
1076478256 10:130767416-130767438 GGGACAGAGGGGACCCTGAAGGG - Intergenic
1076887815 10:133270627-133270649 GGTCCAGAGCAGACCCTCATGGG + Intronic
1078665352 11:13320369-13320391 GAAGCTGAGGGCACCCTCAAAGG - Intronic
1085386042 11:76158894-76158916 GGTCCAGAGAGCAACTTCACCGG - Intergenic
1091918381 12:4285351-4285373 GGTGCAGAAGGCACGCTCAGGGG - Intronic
1092192935 12:6533647-6533669 GGCCCAGAGGCCTCCCACAAAGG - Intergenic
1096418325 12:51432985-51433007 GGTCCAGAGAGGAGCCTCAGGGG + Intronic
1102547400 12:113666617-113666639 GGTGCAGTGGGCACACTCCATGG + Intergenic
1102616448 12:114158660-114158682 TGTCCATGGGCCACCCTCAAGGG - Intergenic
1103891139 12:124239968-124239990 GGTCCAGCAGGCACCCTGATTGG + Intronic
1103958585 12:124593422-124593444 GGTCCAGAGTCAACCCTCAAAGG - Intergenic
1104349835 12:128035640-128035662 GCTCCAGGGGGAACCCTCAGTGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1107601954 13:42022772-42022794 GGTCCTGAAAGGACCCTCAAGGG + Intergenic
1108548903 13:51523382-51523404 GAGCCAGAGGGCAGTCTCAATGG + Intergenic
1112973401 13:105287770-105287792 GGGCCTGAAGGCATCCTCAAAGG + Intergenic
1113065898 13:106374161-106374183 GGCCCAGAGAACACCCTCAAAGG - Intergenic
1113513960 13:110876690-110876712 GGTCAAGAGTGCCCCCTCTAGGG + Intergenic
1118604401 14:67492171-67492193 GGACCAGAGACCACCCTCCAAGG - Intronic
1118738550 14:68720994-68721016 GCTCCAGGGGGCCCCATCAAGGG + Intronic
1119045080 14:71311541-71311563 GGTTCAAAGGGCTCCCTAAAAGG + Intergenic
1121202392 14:92129294-92129316 GTTCCAGAGAGCATCCTGAAAGG + Intronic
1124336028 15:28857840-28857862 GGTGCAGAGGAACCCCTCAAAGG + Intergenic
1127998662 15:64171029-64171051 GGTCCAGAGGACATTCTCAGTGG - Exonic
1132691771 16:1184759-1184781 GGTCCAAAGGGCGCCTTCAGTGG + Intronic
1132934172 16:2472636-2472658 GGTCCCCAGGCCACCCTCCAAGG - Intronic
1135293483 16:21260205-21260227 GGGACAGAGGGCACTCTCGAGGG + Intronic
1138104388 16:54279943-54279965 GGACCAGAGGGCAGGCGCAACGG - Intergenic
1138416193 16:56872694-56872716 GGTCCAGATGGCACCTTCTTCGG + Exonic
1138454664 16:57114370-57114392 AGTCCAGAGGCCTCCCTCTATGG - Intronic
1139993977 16:70962940-70962962 GGTGCAGAGGGAACCCAGAAAGG - Intronic
1140001421 16:71028797-71028819 TGTCCACGGGGCACGCTCAAGGG + Intronic
1144050475 17:11493619-11493641 GGTCCAGAGGAGACTCACAAAGG - Intronic
1145004293 17:19328737-19328759 GCTCCAGTGGGCACCCCCCATGG - Exonic
1147422696 17:40330569-40330591 GGTCCACAGTGCCACCTCAAGGG - Intronic
1149507937 17:57211398-57211420 GTCCCAGGAGGCACCCTCAAGGG + Intergenic
1150006842 17:61475264-61475286 GGTCAAGAGGGAACAATCAAAGG + Intronic
1150135347 17:62692348-62692370 GCTGTAGCGGGCACCCTCAAAGG - Exonic
1152462322 17:80448091-80448113 AGTTCTGAGGTCACCCTCAAAGG + Intergenic
1152463906 17:80455172-80455194 GGTCCTGAGGGCTCCCTGGAGGG + Intergenic
1152740246 17:82015562-82015584 GGGCGAGAGGGCTCCCTCAGAGG - Intronic
1153820100 18:8825277-8825299 GGTACAGAGGGGACTATCAAGGG - Exonic
1154442806 18:14407934-14407956 GGTCCAGAGTTCAGTCTCAAAGG + Intergenic
1158217658 18:55116745-55116767 GGTCCAGTGGTCATCCTGAATGG - Intergenic
1160393928 18:78558494-78558516 GAGCCACAGGGGACCCTCAAAGG - Intergenic
1160701808 19:511163-511185 GGCCCAGAGGCCACCGTCACAGG + Intronic
1162034002 19:7929538-7929560 GGGCCAGAGGGAACCCACAGAGG - Intronic
1163617720 19:18339855-18339877 GGGCCAGAAGGAACCCTCAGAGG + Intergenic
1165321862 19:35090560-35090582 GGGCCGTAGGGAACCCTCAAAGG + Intergenic
1166202594 19:41248263-41248285 GCTCCAGTGGGCACCCTGATGGG - Intronic
1167035712 19:46994025-46994047 GGTCCTGAGGGGACTCTGAAGGG + Intronic
1168516411 19:57013310-57013332 CATCCAGAGGGCACCATCCAGGG + Intergenic
925293443 2:2763156-2763178 GGCCCTGAGGGGGCCCTCAAGGG + Intergenic
936350425 2:111708031-111708053 TGTCCAAAGAGCACCCTCCAGGG - Intergenic
938217015 2:129526629-129526651 GGCCCAGAGGGGAGCCCCAAAGG + Intergenic
938950943 2:136253940-136253962 GGGCCAGTGGGTACCCTCATAGG + Intergenic
939536418 2:143436524-143436546 GTTCCAGAGTCCATCCTCAATGG - Intronic
946729025 2:222690726-222690748 GGTCCCGAGGGCACACTAGAGGG + Intronic
1169263833 20:4155825-4155847 GGTACAGAGGGCAGACACAAAGG + Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1171154734 20:22861598-22861620 ATTGCAGAGGGCATCCTCAATGG - Intergenic
1171382133 20:24742094-24742116 GGTCAAGAGGGCACCAGCAAGGG + Intergenic
1173363622 20:42366187-42366209 GGTCCAGAGGCCACCCTTGAGGG + Intronic
1173924620 20:46771548-46771570 GCTCCAGAGGGCACCTTGAATGG - Intergenic
1173946174 20:46952622-46952644 GGTCCAGAGGCCGCACACAATGG + Intronic
1175311866 20:58017982-58018004 CCTCCAGAGGCCACCCCCAAAGG + Intergenic
1175765691 20:61590975-61590997 CATCCAGATGGCACCCTCAGAGG + Intronic
1179473183 21:41625826-41625848 GGTCTAGTGTGCACCCTCAGTGG + Intergenic
1179807535 21:43849414-43849436 GGTCCAGAGGTTACCCTACATGG - Intergenic
1180152732 21:45959989-45960011 CGTCCAGAGTGCACCCTGGAAGG - Intergenic
1180190376 21:46160036-46160058 TGGCCACAGGCCACCCTCAAAGG + Intergenic
1183875670 22:40778365-40778387 GGTCAAGAGGACACACCCAATGG - Intronic
1185171971 22:49299506-49299528 GCTCCAGAGGGCACCCTATGGGG - Intergenic
949877392 3:8635188-8635210 GGTGCAGACGGCCCCCTCCAGGG + Intronic
950558321 3:13708125-13708147 TCTCCACAGGGCTCCCTCAATGG - Intergenic
952963297 3:38606162-38606184 GGGGCAGAGGTCACCCTCACTGG + Intronic
962383117 3:134912704-134912726 GGGCCAGAGGGCAGCCTCTGAGG + Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
982872837 4:160606035-160606057 ATTGCAGAGGCCACCCTCAAGGG - Intergenic
984872796 4:184342101-184342123 GTTCCAGAGGCCAGACTCAAGGG - Intergenic
985547888 5:519202-519224 GGTCCACAGGGCCCACTCACTGG + Intronic
988614724 5:32764357-32764379 GGGCCAGGGGGTACCCTCAAGGG + Intronic
990575407 5:57119100-57119122 GGTTCAGAGAGCTCCCTCAATGG + Intergenic
997595409 5:135103914-135103936 GGCCCAGAGGGAACCCTTATGGG + Intronic
999389430 5:151179570-151179592 GTTCCACAGGGCACCCTCACTGG - Intergenic
1001994655 5:176146661-176146683 GGTCCTCAGGACACCCTGAAGGG + Intergenic
1002232940 5:177782236-177782258 GCCTCAGAGGGCACCCTCAGAGG - Exonic
1007063723 6:38968323-38968345 GCTTCAGAGGGCACCATCAGAGG + Intronic
1007386443 6:41523352-41523374 GGTCCAGAGGGACCCCTCTGGGG + Intergenic
1010457663 6:76077024-76077046 GATCCAGAGGGTAAACTCAAGGG - Intergenic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1017218541 6:151938616-151938638 GGTACAGAGGGCACTCTCCAGGG - Intronic
1017823890 6:158067846-158067868 GCTCCGGAGGGCATCCTGAATGG - Intronic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1021688402 7:23209953-23209975 GGTCCAGGGGGCTCCCTGCAAGG - Intergenic
1023863413 7:44228075-44228097 GGGGCAGAGGGCACCCTCCAGGG + Intronic
1026626798 7:72000879-72000901 GGTCGAGAGGGAACCCTCTCCGG - Intronic
1035321067 7:158029534-158029556 GGTCCAGAAAGCACCTTCAAAGG + Intronic
1036636812 8:10556597-10556619 GGTCCAGTTGGCACCTTCACGGG + Intergenic
1038498597 8:28024794-28024816 GGTCCTGGGGGAAGCCTCAAAGG - Intronic
1040329413 8:46378316-46378338 CTTTCAGAGGGCACCCACAAGGG + Intergenic
1041448133 8:57975912-57975934 GGTGCAAATGCCACCCTCAAGGG - Intergenic
1042252176 8:66767488-66767510 GGTGGAGAGGGCATCTTCAAAGG + Intronic
1043458917 8:80439783-80439805 GGATGAGAGGGCACCCTGAAGGG - Intergenic
1046016003 8:108606026-108606048 GGTGCAGCTGGCACCCTCACTGG + Intergenic
1050589969 9:7150574-7150596 GGCCCAGAGGACACACTCAGAGG + Intergenic
1052375823 9:27716543-27716565 TACCCAGAGGGCACCTTCAAAGG + Intergenic
1054944155 9:70776857-70776879 GGACCATAGGCCACTCTCAATGG + Intronic
1055990707 9:82102475-82102497 GGGCCAGAGGGCAAAGTCAAAGG - Intergenic
1062715670 9:138008948-138008970 GGCCAGGAGGGCACCCCCAATGG + Intronic
1189733768 X:44048756-44048778 GTTACAGATGGCACACTCAAGGG - Intergenic
1190877548 X:54470552-54470574 GGTCCCTAGGGCACCCTCTAGGG - Intronic
1190960186 X:55239225-55239247 GGTCTGCAGGGCATCCTCAAAGG + Intronic
1198964669 X:142214947-142214969 GGTCCAGAGGAAACCAGCAAAGG - Intergenic